ID: 980905872

View in Genome Browser
Species Human (GRCh38)
Location 4:138948195-138948217
Sequence TACAAAAATTAGCTGGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980905865_980905872 15 Left 980905865 4:138948157-138948179 CCTGACCAACATGGTGAAACCCC 0: 12248
1: 99170
2: 173655
3: 184431
4: 138245
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data
980905868_980905872 -5 Left 980905868 4:138948177-138948199 CCCATTTCTACTAAAAAATACAA 0: 105
1: 3335
2: 10663
3: 12902
4: 32037
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data
980905866_980905872 10 Left 980905866 4:138948162-138948184 CCAACATGGTGAAACCCCATTTC 0: 1439
1: 44373
2: 100679
3: 133152
4: 108190
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data
980905864_980905872 19 Left 980905864 4:138948153-138948175 CCAGCCTGACCAACATGGTGAAA 0: 18554
1: 129811
2: 169790
3: 147924
4: 143504
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data
980905869_980905872 -6 Left 980905869 4:138948178-138948200 CCATTTCTACTAAAAAATACAAA 0: 205
1: 7717
2: 7865
3: 10674
4: 39403
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data
980905867_980905872 -4 Left 980905867 4:138948176-138948198 CCCCATTTCTACTAAAAAATACA 0: 100
1: 3071
2: 8343
3: 13361
4: 31905
Right 980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980905872 Original CRISPR TACAAAAATTAGCTGGGCTA TGG Intergenic
No off target data available for this crispr