ID: 980907983

View in Genome Browser
Species Human (GRCh38)
Location 4:138967573-138967595
Sequence GTTCAGGTTGAAAGGTCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980907983_980907987 2 Left 980907983 4:138967573-138967595 CCCAATGACCTTTCAACCTGAAC No data
Right 980907987 4:138967598-138967620 AGTTCTTGTTTTAACTCATCAGG No data
980907983_980907988 13 Left 980907983 4:138967573-138967595 CCCAATGACCTTTCAACCTGAAC No data
Right 980907988 4:138967609-138967631 TAACTCATCAGGATCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980907983 Original CRISPR GTTCAGGTTGAAAGGTCATT GGG (reversed) Intergenic