ID: 980913865

View in Genome Browser
Species Human (GRCh38)
Location 4:139016406-139016428
Sequence ATGGCCTCTAAGGGTCAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980913865_980913871 25 Left 980913865 4:139016406-139016428 CCCGCTTGACCCTTAGAGGCCAT 0: 1
1: 0
2: 2
3: 3
4: 97
Right 980913871 4:139016454-139016476 CGTTAAATTTCCCCCTTCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980913865 Original CRISPR ATGGCCTCTAAGGGTCAAGC GGG (reversed) Intronic
906777164 1:48540169-48540191 CTGAGCCCTAAGGGTCAAGCAGG - Intronic
907265095 1:53254309-53254331 ATGGCCTGGAAGGGTCAGGGTGG - Intronic
907649952 1:56285609-56285631 ATGGCTTCTTGGGGTGAAGCAGG - Intergenic
907900912 1:58740881-58740903 CTGGCCTCTTAGGGTAAAGGAGG - Intergenic
908452496 1:64269708-64269730 ATGGCCTGTAAGGGAGCAGCAGG - Intergenic
909250905 1:73354915-73354937 ATAGCCTCTAAGTTTCAGGCAGG - Intergenic
911321132 1:96415213-96415235 ATGGGCTCTAGGGGGGAAGCAGG + Intergenic
912410570 1:109478166-109478188 ATGTCCTCTCAGGGTCAGCCAGG - Intronic
912451935 1:109772786-109772808 ATGACTTCTCAGGTTCAAGCTGG - Intronic
913442629 1:118914928-118914950 ATGGCCCCTGAGGACCAAGCTGG - Intronic
916330743 1:163613676-163613698 ATGGCCTCTAAGGTCCCTGCTGG - Intergenic
917597255 1:176541588-176541610 ATGGCATTCAAGAGTCAAGCAGG - Intronic
922655049 1:227374764-227374786 TTTGCCTCTAAGGGAAAAGCTGG + Intergenic
924288170 1:242509529-242509551 ATGTCCTCTAAGTGTAAAGGAGG - Intronic
1062769168 10:85987-86009 ATGTCCTCTAGGGGTCAGCCTGG - Intergenic
1066002976 10:31121600-31121622 ACGTCCTCATAGGGTCAAGCTGG - Intergenic
1067827882 10:49592539-49592561 ATGACCTCTTAGGGTCTGGCTGG - Intergenic
1073814695 10:107193712-107193734 ATGGCCTCTAAGGCTAAAAATGG + Intergenic
1074086660 10:110213266-110213288 ATGGCAACTAATGTTCAAGCTGG + Intronic
1078738439 11:14043559-14043581 ATGGGCACTGAGGGCCAAGCTGG - Intronic
1078909394 11:15717038-15717060 ATTTCCTCTAAGGGGCAAGAGGG + Intergenic
1079313915 11:19391261-19391283 ATGGAAGCTAAGGGTGAAGCAGG - Intronic
1084443229 11:69187914-69187936 ATGGCTTCTGCCGGTCAAGCAGG - Intergenic
1090846109 11:130531289-130531311 ATGGCCTCTCTGGGTGAGGCAGG - Intergenic
1091013836 11:132031348-132031370 ATAGACTCCAAGGGTCAAGTTGG + Intronic
1097174311 12:57134003-57134025 ATGACAGCCAAGGGTCAAGCAGG + Intronic
1112185856 13:97127108-97127130 ATGGCCTCTAAGGGTGAAGAAGG + Intergenic
1124617033 15:31249262-31249284 CTGGCCTCTGAAGGTCAACCTGG - Intergenic
1125831123 15:42717911-42717933 ATGGGCTCTAAGGGTCACAAAGG - Intronic
1130313084 15:82771708-82771730 CTGGCATCTGAGGGTCAGGCTGG - Intronic
1131080553 15:89531064-89531086 ATCGTCTCTAAGGGCAAAGCTGG - Intergenic
1137395989 16:48116558-48116580 ATGGCCTGGAAGGGTGAACCAGG + Intronic
1137609878 16:49811106-49811128 GTGGCCTCAAGGGGTCAAACCGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140267305 16:73431824-73431846 ATGGCCTTCACGGGACAAGCTGG + Intergenic
1140789767 16:78380206-78380228 AGGGCTTCTAAGGGGCAAGGAGG + Intronic
1142278752 16:89137164-89137186 ATGGCGTCTTAGGCTCCAGCCGG + Intronic
1146644976 17:34571339-34571361 ATGGCCTCTAATGGCCCATCTGG + Intergenic
1147048043 17:37769367-37769389 ATGGCCTTTAAAGGTCAGCCAGG + Intergenic
1148133229 17:45274729-45274751 TTAGCCTCTGAGGGTCCAGCAGG - Intronic
1148371529 17:47103267-47103289 ATGCCATCAAAGGGCCAAGCAGG - Intergenic
1148902282 17:50887429-50887451 ATGGCCCCTATGGGTCAGCCTGG - Intergenic
1150472151 17:65446514-65446536 ATGGCCTTCAAGGGTCAGTCAGG - Intergenic
1152962236 18:86789-86811 ATGTCCTCTAGGGGTCAGCCTGG - Intergenic
1163085810 19:14979336-14979358 AACGGCTCTAAGGGGCAAGCAGG + Intronic
927348728 2:22080380-22080402 ATGGACTCTTAGGATCAAGTTGG - Intergenic
929573026 2:43034647-43034669 ATGGCCCCTAAGGGACACGCAGG - Intergenic
931076096 2:58714385-58714407 ATGGCCTCTAAGTGACTAGTGGG + Intergenic
933950737 2:87327016-87327038 ATTGCCTCTCAGTGTAAAGCAGG + Intergenic
936329041 2:111531562-111531584 ATTGCCTCTCAGTGTAAAGCAGG - Intergenic
937890081 2:126931851-126931873 AGGGCCTGTAAAGGTCAAGTGGG + Intergenic
942208680 2:173648968-173648990 ATGGCCTGGCCGGGTCAAGCAGG + Intergenic
945948124 2:216013627-216013649 CCGCCCTCTAAGGGTGAAGCAGG + Intronic
946120865 2:217513271-217513293 TTGACCTCTAGGGGTGAAGCTGG - Intronic
947913611 2:233818333-233818355 ATGCCCTCCATGGGTCAATCTGG - Intronic
1172071274 20:32259149-32259171 ATTGCCTTTATGGGTAAAGCAGG - Intergenic
1174743359 20:53038268-53038290 ATGAACTTTAAGGATCAAGCAGG - Intronic
1175225949 20:57444086-57444108 TTGGCCTGTAAGGGGAAAGCCGG + Intergenic
1177857412 21:26415268-26415290 ATGGCCACTGAGTGGCAAGCAGG + Intergenic
1178640992 21:34344702-34344724 TTGTCCTCTAGGAGTCAAGCAGG + Intergenic
1180920038 22:19516925-19516947 ATAGCCTCAAAGGGTCAGGTGGG - Intronic
1182289105 22:29265378-29265400 AAGGCCTCCAGGGGTCAAACAGG - Intronic
950014858 3:9748418-9748440 GAGGCCTCTAAGGGCCAAGTAGG - Intergenic
950506435 3:13397592-13397614 TTGGCTTCTGAGGGTGAAGCTGG - Intronic
951944517 3:28119906-28119928 ATGGCATCTTTGGGTGAAGCTGG + Intergenic
952198774 3:31103420-31103442 ATCGCCTCTAGGGGCCAGGCAGG - Intergenic
954139536 3:48597761-48597783 GTAGCCTCTAAGGGCCAGGCTGG + Intergenic
956851213 3:73229913-73229935 GTGGCCTCTAAGGGTCATCTTGG + Intergenic
959192731 3:103135793-103135815 ATGGCCCCTAAGAGTAAAGCAGG - Intergenic
962033850 3:131630196-131630218 ATGGCCACTAAGGGACTAGCCGG - Intronic
980913865 4:139016406-139016428 ATGGCCTCTAAGGGTCAAGCGGG - Intronic
984955891 4:185045195-185045217 ATGGCCCCTAATGCCCAAGCTGG - Intergenic
997384106 5:133458976-133458998 ATGGCCTCTGAAAGTCAGGCTGG + Intronic
997475814 5:134141830-134141852 GAGGCCTGGAAGGGTCAAGCAGG + Intronic
1006768362 6:36529543-36529565 ATGGCCTCTAAGTGTGAAAGTGG - Intronic
1008760801 6:54849314-54849336 CTGGCCCCTAAGGGTAGAGCAGG + Intronic
1016304582 6:142670573-142670595 ATGGCCTCTATGGGTAAAGCAGG + Intergenic
1018741725 6:166734143-166734165 ATGGCCCCTGAGGGGCAAGGGGG + Intronic
1018863121 6:167726470-167726492 AGGGCCTCTAATTGTCAGGCAGG - Intergenic
1019815389 7:3196183-3196205 AAGGCCTCTGAGGCTCAATCTGG - Intergenic
1021922073 7:25495533-25495555 TTTGCCTCCAAGGGTCAAACTGG + Intergenic
1022319497 7:29275714-29275736 AGGGCCTCTCAGGGTCACTCAGG + Intronic
1030309396 7:108054280-108054302 ATGGCCAGCCAGGGTCAAGCTGG - Intronic
1035679725 8:1479079-1479101 AAGGCCTCTGAGGGTGGAGCAGG + Intergenic
1048984421 8:139727098-139727120 ATGGAATCAAAGGGTCAAGATGG + Intergenic
1052703760 9:31969505-31969527 ATGGCCTCCAAGGCACCAGCAGG - Intergenic
1053581678 9:39411315-39411337 ATTGCTTCTAAGGGCCAAGAGGG + Intergenic
1053846102 9:42238648-42238670 ATTGCTTCTAAGGGCCAAGAGGG + Intergenic
1054103258 9:60970047-60970069 ATTGCTTCTAAGGGCCAAGAGGG + Intergenic
1054583097 9:66936790-66936812 ATTGCTTCTAAGGGCCAAGAGGG - Intergenic
1055259604 9:74417645-74417667 AATGCCTCCAAGGGTCAGGCAGG - Intergenic
1055811478 9:80153772-80153794 ATGGCTTCGAAGGGGCAAGAAGG + Intergenic
1058982767 9:110185495-110185517 AGAGCCTCTCAGGGTCATGCGGG + Intergenic
1059596035 9:115721643-115721665 ATGTCTTTTAAGTGTCAAGCAGG - Intergenic
1060957342 9:127651987-127652009 ATGGCCACAAAGGGGCAAGAGGG - Intronic
1061357552 9:130118165-130118187 ATGGCCTCTGTGGGGGAAGCAGG - Intronic
1061566221 9:131442455-131442477 ATGGACTCTAAGTGTCATGAAGG - Intronic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1062735907 9:138137328-138137350 ATGTCCTCTAGGGGTCAGCCTGG + Intergenic
1187205105 X:17174602-17174624 ATGGCCTGCTAGGGTCAGGCTGG + Intergenic
1196273431 X:113738633-113738655 ATGGCCTCTGAGAGACATGCTGG + Intergenic
1200398129 X:156003138-156003160 ATGTCCTCTAGGGGTCAGCCTGG + Intronic
1202019441 Y:20449599-20449621 ATGGCCCCTAACGCCCAAGCTGG - Intergenic