ID: 980915787

View in Genome Browser
Species Human (GRCh38)
Location 4:139032002-139032024
Sequence CACGCCCAGCCTCCCACTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980915774_980915787 25 Left 980915774 4:139031954-139031976 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915776_980915787 21 Left 980915776 4:139031958-139031980 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915775_980915787 22 Left 980915775 4:139031957-139031979 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915782_980915787 9 Left 980915782 4:139031970-139031992 CCCAAAGTGCTGGGATTACAGGG 0: 3574
1: 298705
2: 273637
3: 155315
4: 139595
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915784_980915787 8 Left 980915784 4:139031971-139031993 CCAAAGTGCTGGGATTACAGGGG 0: 2655
1: 199469
2: 274982
3: 197235
4: 162301
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915780_980915787 12 Left 980915780 4:139031967-139031989 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data
980915778_980915787 18 Left 980915778 4:139031961-139031983 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 980915787 4:139032002-139032024 CACGCCCAGCCTCCCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980915787 Original CRISPR CACGCCCAGCCTCCCACTTG TGG Intronic
No off target data available for this crispr