ID: 980916161

View in Genome Browser
Species Human (GRCh38)
Location 4:139035091-139035113
Sequence CTGAGCGACCAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980916161_980916165 -10 Left 980916161 4:139035091-139035113 CCTCCATCCTTCTGGTCGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 204
Right 980916165 4:139035104-139035126 GGTCGCTCAGCTGGAAACTGTGG 0: 1
1: 0
2: 1
3: 17
4: 222
980916161_980916166 18 Left 980916161 4:139035091-139035113 CCTCCATCCTTCTGGTCGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 204
Right 980916166 4:139035132-139035154 TTTTTTTTAAAGAGATAGATAGG 0: 1
1: 3
2: 41
3: 283
4: 1892
980916161_980916167 19 Left 980916161 4:139035091-139035113 CCTCCATCCTTCTGGTCGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 204
Right 980916167 4:139035133-139035155 TTTTTTTAAAGAGATAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980916161 Original CRISPR CTGAGCGACCAGAAGGATGG AGG (reversed) Intronic
900899983 1:5509738-5509760 CGGAGCGACCAGGGGGATTGAGG + Intergenic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
903539158 1:24087079-24087101 CCGAGGGACTGGAAGGATGGGGG - Intronic
904311538 1:29632661-29632683 CTGAGGGGCCAGGAGGCTGGGGG - Intergenic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906800136 1:48729895-48729917 CTGAGAGACAAGAAGGTAGGAGG + Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
912410817 1:109479644-109479666 CTCAAAGACCAGAATGATGGGGG - Exonic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
916472402 1:165137220-165137242 CTGAGTGCCCAGAATGAGGGAGG + Intergenic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
919965537 1:202520091-202520113 CTGAGCAAGCTGAAGAATGGAGG + Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920664313 1:207950107-207950129 CTGAGGGACCATAATGATTGGGG + Intergenic
921083919 1:211769344-211769366 CTAAGTGACAGGAAGGATGGAGG + Intronic
921086293 1:211796436-211796458 CTGAGGGACACCAAGGATGGTGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923854333 1:237829471-237829493 ATTAGCCACCAGATGGATGGTGG + Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1066065136 10:31756334-31756356 CTGACAGCCCAGAAGGAAGGAGG + Intergenic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1068958323 10:62841567-62841589 CTGGGAGACCAGAAGTTTGGGGG - Intronic
1069280091 10:66644910-66644932 CTGAGCTAGCAGGAGGATGTGGG - Intronic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1071058367 10:81538545-81538567 CTGAGTGAGCAAAATGATGGAGG - Intergenic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074157679 10:110812568-110812590 ACGAGCGACCAGAAGGAGGGAGG + Exonic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075679570 10:124322674-124322696 GTGGGAGACCAGAAGGATTGGGG - Intergenic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1081340786 11:41924591-41924613 CTAAGCCACCACAAGCATGGTGG + Intergenic
1081615372 11:44587655-44587677 CTGAGCCACCAGGTGGGTGGAGG + Intronic
1082982635 11:59137362-59137384 CTGAGGTACCAGGAAGATGGAGG + Intergenic
1083193529 11:61069296-61069318 CTGAGGGGCCAGAAGAAAGGGGG - Intergenic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097863652 12:64542488-64542510 CTGAGAGACCAGAAGGGAAGGGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1106075528 13:26457631-26457653 CTTAGTGACGGGAAGGATGGTGG - Intergenic
1106421238 13:29587944-29587966 GTGATCGACCAGAAAGGTGGTGG - Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1113944071 13:114033845-114033867 CTGAGGGGCCACAAGGATGTTGG + Intronic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117294090 14:54363063-54363085 CTCAGGGACCATCAGGATGGAGG + Intergenic
1120701470 14:87703756-87703778 CTGAGCCATGAGAAGAATGGTGG + Intergenic
1122757928 14:103997409-103997431 CTGAGAGACTGGGAGGATGGAGG + Intronic
1125452420 15:39823383-39823405 ATGAGCAACCAGGGGGATGGAGG - Intronic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131832188 15:96361124-96361146 CGGAGCTAGGAGAAGGATGGGGG - Intergenic
1132485647 16:189378-189400 CTGAGCGGCCAGCAGAAGGGGGG - Intronic
1132613688 16:830026-830048 CTCAGCCACAAGAAGGAAGGAGG - Intergenic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1134456757 16:14400691-14400713 CTGAACGAACAGATGAATGGGGG - Intergenic
1135168615 16:20163647-20163669 CTGAGGGACCAGCAGGATCCTGG + Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1140384364 16:74521542-74521564 TTGAGCAACCAGAAGAATAGAGG + Intronic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141762982 16:86040738-86040760 CTGAGCCACCACAATGAAGGGGG - Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145103671 17:20097238-20097260 CTTAGAGACCAAAGGGATGGGGG - Intronic
1145205265 17:20981464-20981486 CTGAGAGACCAGAAGCGTGAGGG - Intergenic
1148795545 17:50195014-50195036 CTGGGCTGCAAGAAGGATGGCGG + Intronic
1150289394 17:63972856-63972878 CTCAGAGACCAGAAGGGTGGTGG + Exonic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152073323 17:78144796-78144818 GGGAGTGGCCAGAAGGATGGTGG - Intergenic
1153181082 18:2434647-2434669 AGGAGGGACCAGAAAGATGGAGG - Intergenic
1155442799 18:25879760-25879782 CTCCTCCACCAGAAGGATGGGGG + Intergenic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1158169985 18:54586621-54586643 CTGAGCCCTAAGAAGGATGGGGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1162120643 19:8464866-8464888 CTGAAGGACTTGAAGGATGGGGG + Intronic
1165105600 19:33468126-33468148 CTGAGAGACCTGGAGAATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166359241 19:42245719-42245741 CTGAGCGACCTGAAGGGGTGAGG + Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1166644267 19:44519559-44519581 CTGAGCCACCGAAAGGATGTAGG - Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926017337 2:9465701-9465723 CTGAGCTCTTAGAAGGATGGGGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927852558 2:26509390-26509412 CCCAGAGACCTGAAGGATGGAGG - Intronic
929005224 2:37387214-37387236 AGGAGGGACCAGAAAGATGGAGG - Intergenic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936962361 2:118088811-118088833 CTGAGCGGGAAGAAGGCTGGAGG + Intronic
942244764 2:173997435-173997457 CTGAGCAGCCAGAAGCATGCAGG - Intergenic
943485359 2:188473182-188473204 CTGAACCACCAGAAGTAGGGTGG + Intronic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
948711900 2:239830393-239830415 CTGAGCTCCCATAAGAATGGGGG - Intergenic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171523124 20:25790861-25790883 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171530864 20:25852839-25852861 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171553703 20:26065022-26065044 CAGAGCGACCTGAAAGAAGGTGG + Intergenic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1174349397 20:49956221-49956243 TTGAGCAATTAGAAGGATGGTGG - Intergenic
1175798629 20:61788114-61788136 CTGAGCTACCAGAAGGCCAGGGG + Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176424163 21:6537725-6537747 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177821311 21:26033702-26033724 ATGAGCTAGCAGAAGCATGGAGG + Intronic
1179699656 21:43146040-43146062 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1181310366 22:21941427-21941449 CTGAGCAACTAGAAGGCTCGTGG + Intronic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183163582 22:36131220-36131242 GTGACAGACCAGGAGGATGGGGG - Intergenic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
950983511 3:17334258-17334280 ATGAGCCACCTGAAGGATAGAGG + Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960194954 3:114754212-114754234 CTGAGCCACCAGAAGGGAAGGGG + Intronic
960673981 3:120177230-120177252 CTGAGGGAGCAGAGGGCTGGGGG + Intronic
965793557 3:172414282-172414304 GTGAAAGGCCAGAAGGATGGAGG + Intergenic
966101568 3:176275496-176275518 CTGAGCCTCAAGAAGGAAGGAGG + Intergenic
966388681 3:179428942-179428964 CTGAGTGCCCCTAAGGATGGAGG + Intronic
968571635 4:1345322-1345344 CCAAGCGAACAGAAGGATGCAGG + Intergenic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
969619213 4:8270480-8270502 CTGAAAGACCAGAGGGCTGGTGG - Intronic
972240545 4:37187341-37187363 ATCAGCCAACAGAAGGATGGAGG - Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
976848526 4:89517737-89517759 CTCAGAGAATAGAAGGATGGAGG - Intergenic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
979160130 4:117449048-117449070 CTGAGCCACCAGGAGGCAGGAGG + Intergenic
980310390 4:131121758-131121780 CTGATCAACCAGAACAATGGTGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
984560636 4:181264984-181265006 CTGAGCGCCCAGCAGGCAGGAGG + Intergenic
994192627 5:96885146-96885168 CTGGGCTACTAGAAGGCTGGTGG - Intronic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
999885672 5:155920332-155920354 TTGAGCAACTAGAAGGATGATGG + Intronic
1001740880 5:174051869-174051891 CTGAGCCCTCAGAAGGGTGGAGG + Intronic
1005626777 6:27669855-27669877 CTCAGCGACCAGGAAGATGGTGG - Intergenic
1005719595 6:28587947-28587969 CTGCGCTACCAGAGGTATGGAGG - Intronic
1005866442 6:29941276-29941298 CTGAAGGATGAGAAGGATGGAGG + Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008757660 6:54816753-54816775 CTGAGTGACTAGAAGAATAGTGG - Intergenic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1012227949 6:96726410-96726432 CTGAGCCATCAGAAGAATGAGGG + Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013864847 6:114682992-114683014 CTGAGATACCAGAAAGATGGCGG - Intergenic
1014630992 6:123789774-123789796 TTCAGCCACTAGAAGGATGGTGG + Intergenic
1017819614 6:158039793-158039815 CTGAGCCTCCAGTAGGAAGGAGG + Intronic
1019272990 7:160986-161008 CTGAGCGACAGGCAGGGTGGGGG - Intergenic
1023681362 7:42690985-42691007 GTGAGTGACCAGAAGGACTGGGG + Intergenic
1024767771 7:52681312-52681334 CTGAGCAACTGGAAAGATGGAGG + Intergenic
1025249706 7:57343663-57343685 CTGAGCATCTGGAAGGATGGGGG + Intergenic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1030187481 7:106777966-106777988 CTGAGAGACCAGGATAATGGAGG + Intergenic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1030847813 7:114443054-114443076 CTGACCTACCATAAGGATGTGGG - Intronic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1031922636 7:127612985-127613007 CTGAGCGGGCAGATGGATGATGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1034827009 7:154274992-154275014 CTGAGGGTCCAGAGGCATGGGGG - Intronic
1035082296 7:156226907-156226929 CTGAGCCAGCAGAAGAATGAGGG + Intergenic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1039288523 8:36068806-36068828 CTCAGTGTCCAGAAGGCTGGTGG - Intergenic
1039419522 8:37424346-37424368 CTGAGCGACCCTGAGAATGGTGG - Intergenic
1041012560 8:53558910-53558932 CTGTGAGACCACAAAGATGGTGG - Intergenic
1047773957 8:128053811-128053833 CTGAGCAACCAGAAGGGTTGGGG + Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048846859 8:138610441-138610463 CTGAGCGAGGAGAAGGATTCTGG - Intronic
1049255877 8:141613531-141613553 CTGAGCCACCAAATGGGTGGTGG - Intergenic
1049732040 8:144183502-144183524 CTGATTGATCAGAAGGATGCTGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1055717105 9:79129860-79129882 CTGAGAGACCAGAAAAAAGGCGG + Intergenic
1055766480 9:79668993-79669015 ATAATCGAGCAGAAGGATGGCGG - Intronic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1057129389 9:92642434-92642456 ATGAGGGCCCAGACGGATGGAGG + Intronic
1058079856 9:100690299-100690321 TTGAGCCTCCAGAAGGAAGGTGG - Intergenic
1058708014 9:107653353-107653375 ATGAGTGACCAGGAGGGTGGAGG - Intergenic
1058854142 9:109043629-109043651 CTGAGCTACCAAAAGGAGGGAGG - Intronic
1059388079 9:113980765-113980787 GTGAGCAACCAGCTGGATGGAGG + Intronic
1060433056 9:123567148-123567170 CTGAACTGCCAGAAGTATGGGGG - Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1189141539 X:38612218-38612240 CTGAGCGCCCAGCAGGAATGTGG + Intronic
1189186795 X:39061857-39061879 TTGAGGGACTAGAGGGATGGTGG - Intergenic
1190191127 X:48278040-48278062 CTGATCAGGCAGAAGGATGGGGG + Intergenic
1190316741 X:49156505-49156527 TTGAGCGTCCGGAAGCATGGGGG - Intergenic
1191179929 X:57551130-57551152 CCCAGCTACCAGGAGGATGGAGG + Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1195239546 X:102937479-102937501 CTGGCCGTCCAGCAGGATGGTGG - Exonic
1195298162 X:103500574-103500596 CTGGCCGTCCAGCAGGATGGTGG + Exonic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1198517089 X:137420535-137420557 TTGAGCAACCAGATGGATGGTGG - Intergenic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic
1202301153 Y:23415892-23415914 CTGAGCAAGCTGAAGAATGGAGG + Intergenic
1202569658 Y:26254706-26254728 CTGAGCAAGCTGAAGAATGGAGG - Intergenic