ID: 980920202

View in Genome Browser
Species Human (GRCh38)
Location 4:139077116-139077138
Sequence AAGCTTATACTACTATAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980920198_980920202 12 Left 980920198 4:139077081-139077103 CCTGACACAAGTGTGAACAGATT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 980920202 4:139077116-139077138 AAGCTTATACTACTATAGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 80
980920197_980920202 25 Left 980920197 4:139077068-139077090 CCTGTGCTATAAACCTGACACAA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 980920202 4:139077116-139077138 AAGCTTATACTACTATAGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 80
980920196_980920202 26 Left 980920196 4:139077067-139077089 CCCTGTGCTATAAACCTGACACA 0: 1
1: 0
2: 0
3: 6
4: 150
Right 980920202 4:139077116-139077138 AAGCTTATACTACTATAGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980920202 Original CRISPR AAGCTTATACTACTATAGGT TGG Intronic
904121476 1:28201140-28201162 AAGCAAATACTACTCTATGTTGG + Exonic
906023661 1:42654692-42654714 AAGCTTATGGTATTATAGGAGGG - Intergenic
908009687 1:59763220-59763242 AAACTTACATTACTTTAGGTAGG + Intronic
918523154 1:185436991-185437013 AAGCCTATACTACTTTTGTTTGG - Intergenic
1063038019 10:2307493-2307515 GAGATTATACTGCTATAGATTGG - Intergenic
1079834660 11:25318700-25318722 AAGCCTAGACTACTATAATTTGG - Intergenic
1083040152 11:59678220-59678242 AAAATTATATTTCTATAGGTCGG + Intergenic
1086880602 11:92149172-92149194 AGACTGATCCTACTATAGGTGGG - Intergenic
1097757006 12:63417601-63417623 ATCCTTATACTATTATCGGTAGG + Intergenic
1097883243 12:64705040-64705062 TTGCTTATAATATTATAGGTTGG - Intergenic
1104449996 12:128861217-128861239 AAGCGTATAATAGTATAGCTGGG - Intronic
1105245151 13:18643341-18643363 AAGATGATAATACTGTAGGTAGG + Intergenic
1111898730 13:94174095-94174117 AATCATGTACTACTGTAGGTTGG + Intronic
1112777114 13:102856373-102856395 AAGCACATATTACTATTGGTTGG - Intronic
1115681883 14:35749065-35749087 AAGAATATATAACTATAGGTGGG - Intronic
1122391811 14:101394539-101394561 AAGCTTGTCCAACTATGGGTGGG + Intergenic
1135879989 16:26246085-26246107 ATGCTTTTATTACTATGGGTTGG - Intergenic
1143932969 17:10450325-10450347 CAGCTTATTTTATTATAGGTTGG - Intronic
1157457416 18:47846260-47846282 ATGCTTATACATCTAGAGGTTGG - Intronic
926655140 2:15395410-15395432 CAGCTTTTCCTATTATAGGTTGG - Intronic
927634911 2:24806679-24806701 AATCTTATACAACTATTGCTGGG - Intronic
928776728 2:34773699-34773721 AAGCAAATAATACTATAGCTAGG + Intergenic
929306064 2:40363130-40363152 AAGGTTTTACTACTGAAGGTTGG + Intronic
932938164 2:76130597-76130619 AAGCTGATAAGAGTATAGGTTGG + Intergenic
934628550 2:95888212-95888234 AAGCCTATACTAATACAGGCAGG - Intronic
934631121 2:95923781-95923803 AAGCCTATACTAATACAGGCAGG - Intronic
934802925 2:97185202-97185224 AAGCCTATACTAATACAGGCAGG + Intronic
934804976 2:97213305-97213327 AAGCCTATACTAATACAGGCAGG + Intronic
934832507 2:97544077-97544099 AAGCCTATACTAATACAGGCAGG - Intronic
934833275 2:97555346-97555368 AAGCCTATACTAATACAGGCAGG - Intronic
935468435 2:103428076-103428098 AGGCTAATACTACTATTGCTAGG - Intergenic
940623092 2:156138883-156138905 AGGGTTTTACTACTATATGTTGG - Intergenic
940704856 2:157091908-157091930 TAGCTCATAATACTATATGTCGG + Intergenic
944132951 2:196366587-196366609 AAGCAGATACCACTATAGCTGGG - Intronic
946574487 2:221059315-221059337 ATGCTTATACAACTGTTGGTGGG - Intergenic
947114752 2:226757205-226757227 AAGCTTTCACTACTAGAGGATGG + Intronic
1174714452 20:52742663-52742685 AAGCTTATAATAAGATAGATGGG - Intergenic
1176452292 21:6874634-6874656 AAGATGATAATACTGTAGGTAGG + Intergenic
1176830464 21:13739683-13739705 AAGATGATAATACTGTAGGTAGG + Intergenic
1177529854 21:22345019-22345041 AAGCTTGAAGCACTATAGGTAGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952705202 3:36370222-36370244 TAGCCTATACTGGTATAGGTCGG + Intergenic
962573684 3:136736385-136736407 AAGCAAATACTACTCTATGTTGG + Intronic
963393900 3:144706960-144706982 TAGCTTCTACTATTATAGATAGG - Intergenic
967433304 3:189414749-189414771 AAGCACCTACTACTATGGGTTGG + Intergenic
968862752 4:3185581-3185603 AAGCTTAGACTATTTTAGCTTGG + Intronic
970707960 4:18828269-18828291 AAGTTAATAATACTATTGGTAGG - Intergenic
974564466 4:63565748-63565770 AAGCTTATAAAAGTATGGGTGGG - Intergenic
975869060 4:78758038-78758060 AAGCTTTTACTGATATGGGTGGG + Intergenic
976249822 4:83039092-83039114 TAGCTTATAATTCTGTAGGTTGG + Intronic
976942736 4:90726058-90726080 AAGCTTCTTCTAATATTGGTGGG + Intronic
978483555 4:109223639-109223661 AAGCTTAGAGTACTTTAGGAAGG - Intronic
978657347 4:111080074-111080096 ACGCTTTTACAACTGTAGGTGGG + Intergenic
979888929 4:126065310-126065332 AGGCTCATACTACTGTGGGTAGG + Intergenic
980920202 4:139077116-139077138 AAGCTTATACTACTATAGGTTGG + Intronic
993217225 5:85041642-85041664 ATGCTTATACAACCATTGGTAGG - Intergenic
993830802 5:92755681-92755703 GAGCCTAGACTACTATAGATTGG + Intergenic
995737086 5:115312948-115312970 AAGGTTATACTACTTGAAGTGGG + Intergenic
1001375543 5:171253549-171253571 AAGCTTATAATAATACATGTAGG + Intronic
1003704104 6:8505168-8505190 AAAATTATACAACTAAAGGTAGG - Intergenic
1007164044 6:39815782-39815804 AAGCTTATTCTAAAATAGATTGG + Intronic
1015020417 6:128466933-128466955 AAGCTTTTACTATTATATTTTGG + Intronic
1015662601 6:135591919-135591941 AAGTGTAGACTACTAGAGGTGGG - Intergenic
1018351116 6:162960137-162960159 AAGCTTATAACACTGTTGGTGGG + Intronic
1021962701 7:25888352-25888374 AATCTCATAGTACTAGAGGTAGG + Intergenic
1023073581 7:36461406-36461428 AACATTATAATACAATAGGTAGG - Intergenic
1026130767 7:67619148-67619170 AACCTCATCCTACTATTGGTCGG + Intergenic
1028676225 7:93465051-93465073 AAGCTGATAGAAATATAGGTTGG - Intronic
1042380336 8:68105783-68105805 AAGATTATACTACTACATTTTGG + Intronic
1045378095 8:101595640-101595662 AAGGTTATACGACTATACTTGGG - Intronic
1045939480 8:107722753-107722775 AACCTTTCACCACTATAGGTTGG - Intergenic
1047211819 8:122846760-122846782 GATCTTATAATTCTATAGGTTGG - Intronic
1050768534 9:9166837-9166859 AACCTCTTACAACTATAGGTAGG - Intronic
1056467255 9:86869739-86869761 AAGATTTTACTACTAAAGTTAGG - Intergenic
1203516889 Un_GL000213v1:9881-9903 AAGATGATAATACTGTAGGTAGG - Intergenic
1186408248 X:9322755-9322777 AACCTTATGCTACTAAGGGTAGG + Intergenic
1187506290 X:19880994-19881016 AATCTTATAGTTCTAGAGGTCGG - Intronic
1194377969 X:93159453-93159475 ATGCTTATACTACTGTTGGTGGG + Intergenic
1195793565 X:108618387-108618409 AATTTTATACTACAACAGGTTGG - Intronic
1195813780 X:108863060-108863082 AATCTTATTTTACTATAAGTAGG + Intergenic
1202044451 Y:20724597-20724619 AAGCTTGTACTGCTATCGCTTGG - Intergenic
1202627172 Y:56871561-56871583 AAGCTTATACTACCTGAGGCTGG + Intergenic