ID: 980920744

View in Genome Browser
Species Human (GRCh38)
Location 4:139083690-139083712
Sequence GCCGCTGCTGCCCGCGTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980920744_980920748 -2 Left 980920744 4:139083690-139083712 CCCCGAACGCGGGCAGCAGCGGC 0: 1
1: 0
2: 2
3: 12
4: 99
Right 980920748 4:139083711-139083733 GCCTCTCCGGCCAGACAGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 133
980920744_980920750 2 Left 980920744 4:139083690-139083712 CCCCGAACGCGGGCAGCAGCGGC 0: 1
1: 0
2: 2
3: 12
4: 99
Right 980920750 4:139083715-139083737 CTCCGGCCAGACAGCGTGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980920744 Original CRISPR GCCGCTGCTGCCCGCGTTCG GGG (reversed) Intronic
900137891 1:1126150-1126172 GCCGCTGCTGCCAGCTGACGGGG - Intergenic
900609674 1:3539245-3539267 GCCGCTGCTGCCTGTGTCCCTGG - Intronic
901768716 1:11519779-11519801 GCCGCGGCTGCCCGTGTTGGAGG - Exonic
905664277 1:39753172-39753194 GCTGCTGCTGCCCAGGTTCCGGG + Intronic
906027241 1:42683301-42683323 GCCGCGGCGGCCGGCGTGCGAGG + Intronic
912345875 1:108963129-108963151 GCCGCGGTTGCGCGCGTTCCGGG - Intronic
912710336 1:111945221-111945243 GCCTCTGATGCCCTTGTTCGAGG + Intronic
914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG + Exonic
916961582 1:169894373-169894395 GCCGCTGCTGGCGGAGGTCGTGG + Intergenic
1067848992 10:49743358-49743380 GCAGCTGCTGACAGCGTTTGGGG - Intronic
1068783259 10:60944050-60944072 GCCACGGCTGCGCGCGGTCGCGG + Exonic
1069531393 10:69222137-69222159 ACCTCTGCTGCCCGGGTTCAAGG - Intronic
1072654327 10:97319732-97319754 GCTGCTGCCGCCCGCGTTGGCGG + Exonic
1073577905 10:104640837-104640859 GCCGCTTCTGGACGCGTTTGGGG - Intergenic
1076873420 10:133204559-133204581 GCCGCTGCTGAACCCGTGCGTGG + Intronic
1078407305 11:11081580-11081602 GCCGCTGCTGCCCGTCTCCATGG - Intergenic
1078527228 11:12110453-12110475 GCCGCTGCCGCCGGCGCACGTGG - Intronic
1085689381 11:78652979-78653001 CCCACTGCTGCCCTCGTTCAGGG - Exonic
1088401220 11:109423704-109423726 GCCGCTGCCGCTGGCGTTGGGGG - Exonic
1097199879 12:57269344-57269366 GCAGCTGCTGACCACGTTGGGGG + Exonic
1099440026 12:82687535-82687557 GCCGCTGCTGCCCTCGCGCTGGG + Exonic
1100477654 12:94949048-94949070 GCCGCTGCTGCCCAGGTCCAAGG - Intronic
1101970455 12:109309139-109309161 GCCGCCGCTGCCGGCGCTCCGGG + Exonic
1104568240 12:129903783-129903805 GCCGCCTCTGCCCGCGTCCCGGG - Intergenic
1104891885 12:132144149-132144171 CCCGCTGCTGCTGCCGTTCGCGG + Exonic
1106776812 13:33016785-33016807 GCCGCTGCAGCCCGCCACCGGGG + Exonic
1112402069 13:99086318-99086340 GCCGCTGCTCCCCGCCTCGGCGG - Intronic
1117424718 14:55581239-55581261 GACGCCGCTGCCCGCGTCCGGGG - Intronic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118849468 14:69573056-69573078 GCTGCTGCTGCCCGCGCTCGGGG + Exonic
1120881303 14:89417027-89417049 GCCCCTGCCGCCCGCGCCCGCGG - Intronic
1122761458 14:104031594-104031616 GCCGGTGCTGCCCGCCTGCTTGG + Intronic
1128374796 15:67066750-67066772 GCCCCCGCGGCCCGCGCTCGTGG + Intronic
1131466049 15:92655602-92655624 GCTGCTGCTGCTCGCGCTCCTGG - Exonic
1132055770 15:98649350-98649372 GCCGCTGCTGCCGGCGCTGAGGG + Exonic
1132938731 16:2496415-2496437 CCTGCCGCTGCCCGAGTTCGTGG + Exonic
1134107631 16:11495124-11495146 GCCTCTGCTTCCCGGGTTCAAGG - Intronic
1139880699 16:70177354-70177376 GCAGCTGCTGCCCGCGGGCTTGG + Exonic
1140371810 16:74418163-74418185 GCAGCTGCTGCCCGCGGGCTTGG - Exonic
1141443141 16:84042263-84042285 GCCGCTCCTGCCCGCTTCCTTGG + Intronic
1142263348 16:89052536-89052558 GCCACGGCTGCCAGCGATCGCGG + Intergenic
1143078734 17:4366215-4366237 GCTGCGGCTGTCCGCGATCGCGG + Intronic
1143452028 17:7042233-7042255 GCGGCTGCTGGCCGTATTCGGGG - Exonic
1143519412 17:7437119-7437141 GCCGCTGCTGCAGGCGCACGCGG + Exonic
1143781975 17:9233798-9233820 GCTGCTGCTTCCCGCGTCCCTGG - Intronic
1145999130 17:29121014-29121036 CCCGCTGATGCCCGCGATGGTGG + Exonic
1150311081 17:64129975-64129997 GCTGCTGCTGCCCGGCCTCGGGG - Exonic
1151155329 17:72120316-72120338 GCCGCCGCTGCCAACCTTCGCGG + Intergenic
1151767001 17:76137853-76137875 GCAGCTGCTGCGGGAGTTCGAGG - Exonic
1155152774 18:23135788-23135810 GCCGCTGCTGCAGGCGGCCGTGG - Exonic
1156008448 18:32470494-32470516 GCCGCCGCTGCTCGCGCTCGCGG + Intergenic
1160679774 19:407413-407435 GCGGCTGCTGGCCGAGTACGAGG - Exonic
1160928036 19:1556286-1556308 GCCGCGGCTGCCCGCGTAGAAGG + Exonic
1161241185 19:3224801-3224823 CCCGCTGCTGCCCACGGGCGAGG - Exonic
1161446837 19:4323415-4323437 GCCGCTGCTGCCTGCTTTCACGG + Exonic
1161668968 19:5593958-5593980 GCCGCAGCTCCTCGCGCTCGCGG + Exonic
1161973375 19:7596122-7596144 GGTGCTGCGGGCCGCGTTCGGGG + Exonic
1162751723 19:12833739-12833761 GCCACCGCTGCCCGCGCTGGCGG - Intronic
1165080179 19:33302328-33302350 GGCGCTGCTGGGCGCGTGCGGGG + Exonic
1166965740 19:46528550-46528572 GCCTCTCCTGCCCACGTTCCTGG + Intronic
1168209773 19:54881971-54881993 GCCTCTGCTGCCCGTGATCTGGG - Intronic
1168339176 19:55613990-55614012 GCCCCTGCCGCCCGCCTTCGGGG + Exonic
928094169 2:28393752-28393774 GCCGCTGCTGCCCCGGGACGAGG - Exonic
936038415 2:109130043-109130065 GGCGGTGCTGCCCGCGGCCGCGG - Exonic
938427130 2:131201814-131201836 CCCACTGCTGCCCGCGTAGGGGG + Intronic
940354067 2:152718899-152718921 GGCTCTGCTGCCCGCGGCCGCGG - Exonic
942444152 2:176067210-176067232 GGCGCTGCTGGCCTCGTTCGCGG + Intergenic
943811481 2:192194609-192194631 GCCTCTGCTGCCGCCGTCCGCGG - Exonic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
948523133 2:238554266-238554288 GCCGCTGCTGCCCCCCTCCCAGG + Intergenic
1169065849 20:2693699-2693721 GCCGCTGCTGCCCGCCGGCCTGG + Exonic
1174272814 20:49381783-49381805 GCCTCTGCTCCCCGGGTTCCTGG - Intronic
1174300655 20:49579946-49579968 GCTCCTGCTCCCCGCGTTCCCGG - Intergenic
1176124496 20:63469457-63469479 GCCCCTGCTGCCCCCGCTCTGGG - Intronic
1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG + Exonic
1178961915 21:37073322-37073344 GCTGCTGCTGCCCGCGTCCGAGG + Intronic
1185100167 22:48836113-48836135 GCCGCTGCTGCCTGCCAGCGTGG + Intronic
954437290 3:50503048-50503070 ACCGCGGCTGCCAGCCTTCGGGG + Intronic
968225467 3:196969621-196969643 GCCGCTGCTGCCCGGATGCCCGG - Intergenic
968879568 4:3292324-3292346 CTCGCTGCTGCCCGCGCTCCGGG + Intergenic
969115688 4:4869437-4869459 GGCGCTGCTGCCAGAGTTTGCGG + Intergenic
969414974 4:7052222-7052244 GCCCCTGCCGCCCGCCTGCGCGG + Intronic
980920744 4:139083690-139083712 GCCGCTGCTGCCCGCGTTCGGGG - Intronic
985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG + Intergenic
985737849 5:1594813-1594835 GCCGCTCCCGCCCGCCTCCGCGG - Intergenic
993502075 5:88675874-88675896 GCCGCCGCCGCCCGCGCTCTCGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
998151381 5:139759394-139759416 GCGGATGCTGCCCCCGATCGCGG + Intergenic
1000319091 5:160119409-160119431 GCCGCTGCAGCCGGAGTTGGAGG - Exonic
1004847121 6:19656663-19656685 GCCCCTGCTTCCCGGGTTCAAGG + Intergenic
1006313432 6:33277240-33277262 GCAGCTGCGGACCGCGGTCGAGG - Exonic
1008598361 6:53065374-53065396 GCCGGTGCTGCCCGTGTGGGCGG - Intronic
1010075609 6:71793674-71793696 GCAGCTGCTGCCCCCGTGAGAGG - Intergenic
1014632564 6:123804055-123804077 GCTGCTGCTGCCAGCGTCCTGGG - Intergenic
1018195753 6:161355121-161355143 GCCCCTGCTGCTCGTGTTCCAGG - Intronic
1029055122 7:97733111-97733133 CCCGCTGCTGCCCGCGACCCAGG - Intronic
1035244424 7:157553024-157553046 GCCGCTGCTGTCCTCGTGCCTGG - Intronic
1035727438 8:1833677-1833699 GCCGCTGCTGCCCTCATGCCCGG + Intronic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1037529211 8:19757313-19757335 GCCGCTGCTCCCCGCCCCCGGGG - Intronic
1038449937 8:27633639-27633661 GCCGCGGGAGCCCGGGTTCGAGG + Intergenic
1039617355 8:38966640-38966662 GCCGCTGCTGCCCCCTTCTGGGG + Intronic
1039936518 8:42051432-42051454 GCCGCTTCTCCCCGCGCTCGCGG - Intronic
1042759076 8:72251603-72251625 GCCCCAGGTGCCCGCGCTCGTGG - Intergenic
1044675070 8:94720098-94720120 GCTGCTGGTGGCCGCGGTCGCGG + Intronic
1044840494 8:96332927-96332949 GCCCCTGCTGCCCACGATGGAGG - Intronic
1049253518 8:141601940-141601962 GCTGCTGCTCCCTGCCTTCGGGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1056475286 9:86946773-86946795 GCCGCCGCTGCCCGCGATGGTGG - Exonic
1187655268 X:21464317-21464339 GCAGCTGCTGCCCAGGTTTGGGG + Intronic
1188040697 X:25367283-25367305 GCTGCTGCTGCCAGAGGTCGGGG + Intergenic
1189244932 X:39556007-39556029 GCCGCTGCTGGCTGCGTCCTGGG - Intergenic
1191830124 X:65407262-65407284 GCCGCTGCTCCTCGAGCTCGGGG - Intronic
1196442259 X:115728088-115728110 GCCGCTGCTGGCCGCGCGCCGGG - Intergenic