ID: 980922776

View in Genome Browser
Species Human (GRCh38)
Location 4:139103397-139103419
Sequence CCCTGTTTCCCGAGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980922776 Original CRISPR CCCTGTTTCCCGAGGCCCAG AGG (reversed) Intronic
900178671 1:1302023-1302045 TCCTGTTTGACCAGGCCCAGAGG - Exonic
901470133 1:9450316-9450338 CCCTGTGTCCCCATGCCCTGCGG + Intergenic
901744078 1:11361114-11361136 CCCTGGCTCCCGGGGCCAAGAGG - Intergenic
903006152 1:20300204-20300226 CACTGTTTCCTGAGTGCCAGAGG - Intronic
904239458 1:29134504-29134526 CCTTGAATCCTGAGGCCCAGAGG - Intergenic
904478145 1:30777580-30777602 CCCTGTCTCCTGGGGCCCACTGG + Intergenic
904536339 1:31201993-31202015 CCCTGGCTCCCCAGGCCCAGCGG - Intronic
905815729 1:40949367-40949389 CCCTGTGTCCCCAGCACCAGGGG + Intergenic
910432861 1:87176004-87176026 CCCTGTTGCCAGGGGCACAGTGG - Intergenic
913347750 1:117825337-117825359 CCATGTTTCCCATAGCCCAGTGG + Intergenic
915298895 1:154941061-154941083 CCCTCTTGCCCAAGGCCCACAGG + Intergenic
915466853 1:156103263-156103285 CCCAGTTTCCAGAGGGCCTGTGG + Intronic
920045630 1:203130424-203130446 TCCTGATTCCCCATGCCCAGTGG + Intronic
921587314 1:216963472-216963494 CCATGTTTCCTGAGGTCCTGAGG + Intronic
922236123 1:223723935-223723957 CCCTGGATCCAGAGGCCCATGGG - Intronic
923097776 1:230789092-230789114 CCCCCATTCCCCAGGCCCAGAGG + Intronic
924415430 1:243851126-243851148 CCCTCTTCCCCGAGGTGCAGGGG - Intergenic
1062826170 10:570500-570522 ACCAGTTTCCCGCAGCCCAGAGG + Intronic
1063158693 10:3403385-3403407 CCCAGTCCCCAGAGGCCCAGAGG - Intergenic
1064442908 10:15370431-15370453 CCCTGTGTCCCGGGGCCCCGAGG - Intronic
1068755087 10:60643708-60643730 CCCCATCTCCCGAAGCCCAGTGG + Intronic
1070967608 10:80539033-80539055 CCCTCTCTCCGGATGCCCAGTGG - Intronic
1072930755 10:99659735-99659757 CTCTGGTTCCTCAGGCCCAGGGG - Intronic
1073185172 10:101611472-101611494 CCCAGGATCCCCAGGCCCAGGGG + Intronic
1075804708 10:125178186-125178208 CCCTGGTCCCCGATCCCCAGAGG - Intergenic
1076272479 10:129166328-129166350 CCCAGTTTCCAGAGGCCCAGTGG + Intergenic
1076840383 10:133042394-133042416 CCCTGTTTTCCGTGGCCCTGTGG + Intergenic
1076861694 10:133140963-133140985 CCGTGGTTCCCGAGGCCCCTGGG - Intergenic
1077209316 11:1361182-1361204 CCATCTCTTCCGAGGCCCAGTGG + Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1082980237 11:59114307-59114329 CCCTCTTTTCCAAGGCCCATGGG - Intronic
1083720550 11:64601633-64601655 CTCCATTTCCAGAGGCCCAGAGG + Exonic
1083776414 11:64896264-64896286 CCAGGTCTCCCGAGGCCCACAGG - Intronic
1083877292 11:65531045-65531067 CCTTGGTTCCCAGGGCCCAGGGG + Intronic
1085044501 11:73345250-73345272 TGCTGTTTCCGGAGGCCCTGAGG + Intronic
1086820988 11:91435940-91435962 GCCTGGTTCCCGAGGCACATAGG + Intergenic
1089175726 11:116547648-116547670 CCCTCTCTCCCAAAGCCCAGAGG + Intergenic
1090091979 11:123705997-123706019 CCCATTTTCACAAGGCCCAGTGG - Intergenic
1091749373 12:3012803-3012825 CCCTGGTTCCAGGGTCCCAGAGG - Intronic
1095939760 12:47718262-47718284 CTCTGTTTCCCCAGCCTCAGGGG + Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1103063100 12:117874936-117874958 CCCTCTAACCCCAGGCCCAGGGG - Intronic
1104650257 12:130526045-130526067 CCCTTGGTCCCAAGGCCCAGAGG + Intronic
1104689679 12:130816092-130816114 CCCTCATTCCCCAGGCACAGTGG - Intronic
1104980246 12:132570351-132570373 ACGTGCTTCCCCAGGCCCAGGGG - Exonic
1105752390 13:23433500-23433522 CCTGGTTTCCCAAGGCTCAGGGG + Intronic
1106480392 13:30133190-30133212 CCCTCTTTCCCCAGAGCCAGCGG + Intergenic
1108701426 13:52947651-52947673 CCCAGTTTCCCCAGCCCCTGGGG - Intergenic
1113788593 13:113015769-113015791 CCCTGCTTCCCATGGCCAAGTGG + Intronic
1115508947 14:34120869-34120891 CTCTGTTTTCAAAGGCCCAGTGG - Intronic
1119652291 14:76392437-76392459 CCCCGTTTACAGAGGTCCAGAGG + Intronic
1119877071 14:78069951-78069973 CCCTGCCTCCCGAGGCTCTGAGG - Intergenic
1121328130 14:93033729-93033751 CCCTGGTTCCTGAGGCCCTGGGG - Intronic
1122023467 14:98858342-98858364 CTCTGTTTCCCGTGGCTCACAGG - Intergenic
1122838569 14:104443353-104443375 CCTTGCTTTCCGGGGCCCAGTGG + Intergenic
1124911912 15:33929438-33929460 CTCTTTTTCCCTCGGCCCAGAGG - Intronic
1126472327 15:49026901-49026923 AGCAGTTTCCTGAGGCCCAGAGG - Intronic
1126629312 15:50717729-50717751 CCATGTCTTCCGAGGCTCAGAGG - Intronic
1127922630 15:63505010-63505032 CTTTGTTTCCCGAGGCCCGACGG + Intronic
1132558550 16:583348-583370 CCCTGTGTACCCAGGTCCAGAGG + Exonic
1133240121 16:4409203-4409225 CCCTGTCTCCTGAGGCCGGGAGG - Intronic
1133442465 16:5832235-5832257 TCCTGTTTCAGGAGGCCCTGGGG - Intergenic
1135255660 16:20939683-20939705 CCCTGATTCCAGAGGACCAGGGG - Intronic
1136480629 16:30539446-30539468 CCCTGCTTCCTGTTGCCCAGCGG - Intronic
1139779541 16:69339433-69339455 ACCGCTTCCCCGAGGCCCAGTGG - Exonic
1141943597 16:87295070-87295092 CCATGTTGCACGCGGCCCAGGGG - Intronic
1142169163 16:88611542-88611564 CCCTGCTTCCTGAAGCCCAGGGG + Intronic
1143503344 17:7351388-7351410 CGCTGTGACCCGAGGCCCACGGG + Exonic
1144735726 17:17554268-17554290 CCTTGTTTACCGAGGGACAGAGG - Intronic
1147637868 17:41974889-41974911 CCCTGTTAGAGGAGGCCCAGAGG - Exonic
1147790769 17:43013247-43013269 CCCTGTTTCCCACCACCCAGTGG + Exonic
1147945125 17:44076447-44076469 CCCTGTTTCCAGGGGCAGAGAGG + Intergenic
1148082835 17:44976937-44976959 CCCTGCTCCCCGAAGCACAGAGG - Intergenic
1151235828 17:72719298-72719320 CCCTGCCTCCCGAGGCCCCGTGG + Intronic
1152181325 17:78823504-78823526 CCCTTTGTCCCCAGGCTCAGTGG - Intronic
1152247231 17:79191398-79191420 TTCTGTTTCCCGAGGCCTTGCGG - Intronic
1152262237 17:79273485-79273507 CCCTGTGCCCAGAGTCCCAGTGG + Intronic
1153799380 18:8656054-8656076 CCCTGGTTCCCCCAGCCCAGAGG - Intergenic
1155142195 18:23053765-23053787 CTCTGTTCCCCCAGCCCCAGGGG - Intergenic
1155990230 18:32272375-32272397 CCCTGGTTACTGGGGCCCAGTGG + Intronic
1157683782 18:49627018-49627040 CCCTGTTTCTCCAGGCCCACAGG + Intergenic
1158305628 18:56102400-56102422 ACTTCTTTCCCGAGTCCCAGAGG + Intergenic
1159557661 18:69962161-69962183 TCATGTTACCCGTGGCCCAGTGG + Intergenic
1160516245 18:79480680-79480702 CCCGGTTGCCCCAGCCCCAGCGG + Intronic
1160629207 18:80233580-80233602 ACCTGTATCCCGTGGCTCAGGGG - Intronic
1160698695 19:496469-496491 CCCTCTGTCCCGAGGCCGCGGGG - Intronic
1161171482 19:2814431-2814453 CCCTGCTTCCCGAGGCCTATGGG + Exonic
1161272430 19:3397471-3397493 CCCTGATTCCCCAGGTCCAGGGG - Intronic
1163029792 19:14536925-14536947 CCCCGTGTCCAGAGGTCCAGAGG - Intronic
1163655679 19:18543545-18543567 ACCTGGTTCCCGAGGCGCGGCGG - Exonic
1165403629 19:35617336-35617358 TCCTGCTTCCCCAGGCCAAGAGG + Exonic
1166231351 19:41427244-41427266 CCCTGGTTCCCCAGTCCCTGGGG - Intronic
1167678728 19:50906515-50906537 CCCTCCTTCCCCAGACCCAGAGG - Exonic
1168398261 19:56066861-56066883 CCCTGCTTCCCGTGGACCAGCGG - Intergenic
925745675 2:7041710-7041732 CCCTGTGTCCAGTGGCCCACAGG + Exonic
925928076 2:8685020-8685042 CCCCGTCTCCGGAGGCCCGGAGG - Intergenic
926196232 2:10765237-10765259 CCCTGTGACTCGAGTCCCAGGGG + Intronic
933214872 2:79618521-79618543 CCCTGTTTCCAGAGCTTCAGAGG - Intronic
933725673 2:85425806-85425828 TCCTGTTTCCAGAGGCTTAGGGG - Intronic
933890998 2:86769814-86769836 CCCTTCTTCCCCAGGCCCACTGG - Intronic
934571353 2:95375008-95375030 CCCTGTTTCCCACGGGACAGGGG - Intronic
934663198 2:96154030-96154052 CTCTGTTTCCCCAGGGGCAGGGG + Intergenic
935792123 2:106602143-106602165 CACTGTTTCCTGAATCCCAGCGG - Intergenic
939900594 2:147845135-147845157 CCCATTTTCCCGAGGCGCCGGGG - Exonic
940100753 2:150035593-150035615 CCATGTTTCCTGTGGCCCAGGGG - Intergenic
940144193 2:150528129-150528151 CCCACTTTCCCCATGCCCAGGGG + Intronic
940357580 2:152762313-152762335 CCCTGGTCCCTGAAGCCCAGTGG + Intergenic
940850884 2:158687165-158687187 CCCAGTTTCCTGGGGACCAGAGG + Intergenic
941754529 2:169170765-169170787 TCCTGTGTCCCAAGCCCCAGAGG + Intronic
944602901 2:201321302-201321324 CCCTGTTCCCCTAGGATCAGGGG - Intronic
946102296 2:217336300-217336322 CACTGTTGCAGGAGGCCCAGCGG + Intronic
947527261 2:230886284-230886306 TCCTGTGTCCCGAGGTCCCGGGG + Intergenic
947589664 2:231378459-231378481 GCGTGTTTCCAGAGGCCCAGAGG - Intergenic
947719887 2:232363835-232363857 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
947731455 2:232433700-232433722 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
947844765 2:233235196-233235218 CCCTGCATCCCCAGGCACAGGGG - Intronic
948273148 2:236689007-236689029 CCCTGTCTCCTGAGTCCCTGCGG - Intergenic
948631836 2:239307386-239307408 CCCTCTCTCCTGGGGCCCAGTGG - Intronic
948650763 2:239442236-239442258 CCCTCTTCCCTGATGCCCAGAGG + Intergenic
949026942 2:241770717-241770739 CCCAGTCCCCAGAGGCCCAGCGG - Intergenic
1169496819 20:6123274-6123296 CCCTGTTCCCCCAGGCCCGCCGG + Exonic
1171567704 20:26209451-26209473 CTCAGGTTCCCGAGGCCGAGCGG - Intergenic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1172914698 20:38434910-38434932 CCCTGTTTCCCGCCATCCAGGGG + Intergenic
1173227598 20:41171049-41171071 CTCTGTTCCCCCAGGCTCAGGGG - Intronic
1173641888 20:44609258-44609280 CTCTGTGTCCCGAGGGCCAGTGG + Intronic
1175290369 20:57871184-57871206 CCCTGTTGCCCCAGACACAGTGG + Intergenic
1176213639 20:63938420-63938442 CCCTGTTTCTCCTGGTCCAGGGG + Intergenic
1176311683 21:5154142-5154164 CTCTGTTTCCCGAGGCCGGAGGG - Intronic
1179845367 21:44107893-44107915 CTCTGTTTCCCGAGGCCGGAGGG + Intronic
1180000903 21:44995118-44995140 GCTGGTCTCCCGAGGCCCAGAGG + Intergenic
1180593325 22:16958308-16958330 ACCTGTTGCCAGGGGCCCAGTGG + Intergenic
1181932918 22:26417300-26417322 CCCGGTTTCAGGAAGCCCAGGGG - Intergenic
1182034094 22:27183955-27183977 CCCAGTCTCCCTGGGCCCAGGGG + Intergenic
1182057840 22:27373883-27373905 CCCTGTTTGCCTAGGAGCAGTGG - Intergenic
1182424208 22:30263650-30263672 CCCAAGTTCCCCAGGCCCAGTGG - Exonic
1184433636 22:44456727-44456749 GCCTCTTTCCAGAGGCTCAGAGG + Intergenic
1184616520 22:45641605-45641627 CCCTGTCTTCCCAGGGCCAGCGG - Intergenic
1184864755 22:47195892-47195914 CCCTGTGTCCTGCAGCCCAGGGG - Intergenic
1185199092 22:49491146-49491168 CCCTGTTTCCTGGGGCACAAAGG - Intronic
949544598 3:5061687-5061709 TCCTGTTTCACCAGGCTCAGTGG - Intergenic
950765784 3:15272032-15272054 CCCCTCTTCCCGAGTCCCAGGGG - Intronic
952316728 3:32238564-32238586 ACCTGTTGCCCGACTCCCAGCGG - Intergenic
952959248 3:38579462-38579484 GCCTGTGTCCGGTGGCCCAGAGG - Exonic
953772300 3:45787163-45787185 CCCTGTTCCCCAAGCCTCAGAGG - Intronic
954661910 3:52230915-52230937 CCCTGCAGCCTGAGGCCCAGCGG - Exonic
955518544 3:59752165-59752187 GCCTCTTTCCTGAGGCCCACGGG + Exonic
960995138 3:123335726-123335748 ACCTGTTTCCACAGGCCCTGTGG - Intronic
961014600 3:123457885-123457907 TCCTGTTCTCTGAGGCCCAGAGG - Intergenic
961525179 3:127492234-127492256 CCCTGTTTGACCAGGCTCAGAGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
968729067 4:2261350-2261372 GCCTGTTTCCCCAGACCCACGGG + Intronic
969136618 4:5034388-5034410 CTGTGTGTCCGGAGGCCCAGCGG - Intergenic
970537218 4:17041935-17041957 CCTTGCTCCCCCAGGCCCAGAGG - Intergenic
972840019 4:42919691-42919713 CCTTGTTTCCCCTGACCCAGTGG - Intronic
975139353 4:70903455-70903477 CCCTGTTTTCAGAGGACCTGAGG - Intronic
980922776 4:139103397-139103419 CCCTGTTTCCCGAGGCCCAGAGG - Intronic
980969127 4:139552938-139552960 TTCTGTTTCCAGATGCCCAGGGG + Intronic
982399509 4:154951638-154951660 CCCTGTTTCTTGAAGGCCAGTGG - Intergenic
983318455 4:166164218-166164240 TCCTGTTTGGCGAGGCACAGAGG - Intergenic
985546902 5:514449-514471 CCCTGCCCCCCGAGGCCCATCGG + Intronic
985745943 5:1647801-1647823 GCCTGTTACCCCAGGCCCTGTGG + Intergenic
987093921 5:14531815-14531837 CCCAGGTTCCTGATGCCCAGCGG + Intronic
990023643 5:51159618-51159640 CCCTGTCCCCAGAGGCTCAGGGG + Intergenic
998272526 5:140719574-140719596 CCTTTTTGCCTGAGGCCCAGAGG + Intergenic
1002098414 5:176845448-176845470 GCCCGTTCCCCGAGGCCCTGAGG + Intronic
1002421167 5:179149816-179149838 CCCTGGTTCCCGAGGAGCACAGG - Intronic
1003009663 6:2414725-2414747 GCCTGTTTCTCAAGGCACAGTGG - Intergenic
1004744927 6:18500588-18500610 CCTTGCTTCCAAAGGCCCAGTGG - Intergenic
1006096391 6:31659286-31659308 CCATGTAGCCAGAGGCCCAGCGG + Exonic
1006911332 6:37565572-37565594 TTCTGTTTCCAGAGGCCCTGGGG + Intergenic
1007210398 6:40189322-40189344 TCCTGTGTCCCTATGCCCAGTGG - Intergenic
1007479624 6:42141819-42141841 CCCTGTTTCCCAAGCCCACGTGG - Intronic
1017228580 6:152047889-152047911 CCCTGTGACCCCAGGCACAGTGG - Intronic
1018480066 6:164181161-164181183 CCCTGTTTCCTGAGCCACAGTGG - Intergenic
1018652771 6:166005739-166005761 TCCTGTGTTCCGAGGCCCCGGGG - Intergenic
1018765305 6:166928179-166928201 GCTTGTTTCCAGAGGGCCAGAGG + Intronic
1018907421 6:168083645-168083667 CCCTGTCTCCCAAGGGGCAGAGG - Intergenic
1019015061 6:168874059-168874081 CCCTCTTTCTCCAAGCCCAGCGG - Intergenic
1020125403 7:5530354-5530376 CCCCATCTCCGGAGGCCCAGGGG + Intronic
1021505727 7:21382604-21382626 CACTGTTTGGCCAGGCCCAGTGG - Intergenic
1023286841 7:38629987-38630009 CCTTTTGTCCCCAGGCCCAGAGG - Intronic
1024972579 7:55084350-55084372 GCCTGCTTCTCCAGGCCCAGTGG + Intronic
1026874118 7:73869946-73869968 CCCTGCTGCCCCAGGCCCAGTGG + Intergenic
1027377865 7:77572300-77572322 CCATGTTGCCCAGGGCCCAGTGG + Intronic
1029519473 7:101051012-101051034 CCCTGTGTAACGAGGCCCATGGG - Intronic
1032094512 7:128931295-128931317 CCATCCTTCCCCAGGCCCAGGGG + Intergenic
1032410445 7:131690316-131690338 CCCTGCTGCCCTAGGGCCAGAGG - Intergenic
1033426941 7:141253159-141253181 CCCTGGTTCCTCAGGCCTAGGGG + Intronic
1037689208 8:21168690-21168712 CCCAGCTTCCCTAGGCCCGGCGG + Intergenic
1038950413 8:32408302-32408324 CCCTGTTCCCTCAGGCTCAGTGG + Intronic
1039888044 8:41666618-41666640 CACTGTTTTCAGAGGTCCAGTGG + Intronic
1041350329 8:56941902-56941924 CCCTGTTTCCAGCGGCAAAGGGG + Intergenic
1047303158 8:123632387-123632409 CCCTGCTTCCCCAGGCCAAATGG + Intergenic
1054449717 9:65397318-65397340 TCGTGTTTCCCAAGACCCAGGGG - Intergenic
1058090687 9:100802334-100802356 CCCTGGTTCCAGAGACCCATGGG - Intergenic
1059433121 9:114261497-114261519 CCCTGTCTCCCCAGCCCCACAGG - Intronic
1059447136 9:114345454-114345476 TCCTGTTTCCTGAGACACAGGGG + Intronic
1060106597 9:120876882-120876904 CCCGGGTTCCCGAGCCCCGGGGG - Intronic
1060295905 9:122342861-122342883 CCCTGCTCCCCGGGCCCCAGAGG - Intergenic
1061649961 9:132039675-132039697 CCCTGTGTCCCAAGGACGAGTGG + Intronic
1061664591 9:132153147-132153169 CCCTGTTGCTAGAGGCCCAAAGG + Intergenic
1062531032 9:137000482-137000504 CCCTGGTCCCCGAGGCCACGGGG + Intergenic
1190444179 X:50506548-50506570 CCCTGGGTCCCAAGGACCAGTGG - Intergenic
1191853195 X:65601490-65601512 CCCACTTTCCAGAGGCCCAATGG - Intronic
1192677533 X:73214316-73214338 CCCTTCTTCCCCAAGCCCAGCGG + Exonic
1193899713 X:87162294-87162316 GCCTGTCTCCAGAGTCCCAGGGG + Intergenic
1197600146 X:128518499-128518521 CCATGTTTCCTTAGCCCCAGTGG - Intergenic