ID: 980930055

View in Genome Browser
Species Human (GRCh38)
Location 4:139176688-139176710
Sequence CCGCGCCCCGCGCTCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 426}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980930047_980930055 -9 Left 980930047 4:139176674-139176696 CCCTCAGCCCTGCCCCGCGCCCC 0: 1
1: 1
2: 9
3: 118
4: 1011
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930043_980930055 14 Left 980930043 4:139176651-139176673 CCCGCCGGGGTCTGTAACCTCTT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930041_980930055 16 Left 980930041 4:139176649-139176671 CCCCCGCCGGGGTCTGTAACCTC No data
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930038_980930055 22 Left 980930038 4:139176643-139176665 CCATCCCCCCCGCCGGGGTCTGT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930048_980930055 -10 Left 980930048 4:139176675-139176697 CCTCAGCCCTGCCCCGCGCCCCG 0: 1
1: 1
2: 21
3: 201
4: 1462
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930040_980930055 17 Left 980930040 4:139176648-139176670 CCCCCCGCCGGGGTCTGTAACCT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930046_980930055 -3 Left 980930046 4:139176668-139176690 CCTCTTCCCTCAGCCCTGCCCCG 0: 1
1: 0
2: 7
3: 127
4: 1123
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930039_980930055 18 Left 980930039 4:139176647-139176669 CCCCCCCGCCGGGGTCTGTAACC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930044_980930055 13 Left 980930044 4:139176652-139176674 CCGCCGGGGTCTGTAACCTCTTC No data
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930037_980930055 23 Left 980930037 4:139176642-139176664 CCCATCCCCCCCGCCGGGGTCTG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930042_980930055 15 Left 980930042 4:139176650-139176672 CCCCGCCGGGGTCTGTAACCTCT 0: 1
1: 0
2: 2
3: 3
4: 63
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426
980930045_980930055 10 Left 980930045 4:139176655-139176677 CCGGGGTCTGTAACCTCTTCCCT 0: 1
1: 0
2: 2
3: 27
4: 255
Right 980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 74
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980930055 Original CRISPR CCGCGCCCCGCGCTCCCCGC GGG Intronic