ID: 980930343

View in Genome Browser
Species Human (GRCh38)
Location 4:139177676-139177698
Sequence CGTGCACCTGCAGCGCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980930336_980930343 14 Left 980930336 4:139177639-139177661 CCGCACGGGGCAGGCGTGTGAGG No data
Right 980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG No data
980930341_980930343 -9 Left 980930341 4:139177662-139177684 CCGATGGGGCCGCGCGTGCACCT No data
Right 980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980930343 Original CRISPR CGTGCACCTGCAGCGCCCGC CGG Intergenic
No off target data available for this crispr