ID: 980937018

View in Genome Browser
Species Human (GRCh38)
Location 4:139235247-139235269
Sequence ATGCCCTTTTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980937016_980937018 2 Left 980937016 4:139235222-139235244 CCACAGAAAAAGGACCTAACAAA No data
Right 980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980937018 Original CRISPR ATGCCCTTTTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr