ID: 980940765

View in Genome Browser
Species Human (GRCh38)
Location 4:139272025-139272047
Sequence GACTAGGCCATGTGATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980940765_980940770 25 Left 980940765 4:139272025-139272047 CCAGCCTATCACATGGCCTAGTC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 980940770 4:139272073-139272095 GGCCTACACCTCAACTAGAGTGG No data
980940765_980940768 1 Left 980940765 4:139272025-139272047 CCAGCCTATCACATGGCCTAGTC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 980940768 4:139272049-139272071 CAATCTCTGTTTTTTTTTTTTGG 0: 1
1: 0
2: 35
3: 675
4: 4245
980940765_980940771 26 Left 980940765 4:139272025-139272047 CCAGCCTATCACATGGCCTAGTC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940765_980940769 4 Left 980940765 4:139272025-139272047 CCAGCCTATCACATGGCCTAGTC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 980940769 4:139272052-139272074 TCTCTGTTTTTTTTTTTTGGTGG 0: 1
1: 22
2: 332
3: 3975
4: 21587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980940765 Original CRISPR GACTAGGCCATGTGATAGGC TGG (reversed) Intronic
900417642 1:2542500-2542522 GATTAGGCCCTGTGAGGGGCTGG + Intergenic
901493642 1:9609194-9609216 CACCAGGCCAGGGGATAGGCTGG - Intronic
901768194 1:11517097-11517119 GACCAGGCCATGTGCTAGTGAGG - Intronic
903503764 1:23818018-23818040 GACTATGCCATGTTATATACAGG - Intronic
913557811 1:119986487-119986509 AACTAGGCAAAGTGTTAGGCAGG - Intronic
922801685 1:228367481-228367503 GACAAGGCCATGTGGGTGGCGGG - Intronic
1063498072 10:6528373-6528395 TCCTTGGCCATGTCATAGGCTGG + Intronic
1071488643 10:86120947-86120969 CACTAGGACATGTGAGAGACAGG - Intronic
1074186421 10:111102748-111102770 GCCTAGACCATGTGAATGGCAGG - Intergenic
1078944237 11:16045725-16045747 GTCCAGGCCATATGAAAGGCAGG - Intronic
1080722180 11:34860662-34860684 GACTAGCACATGTGATTGACAGG + Intronic
1084736418 11:71108464-71108486 GACAAGGGCATGTGGTGGGCAGG - Intronic
1090425915 11:126606975-126606997 TACCCGGCCATGTGATAGGCAGG - Intronic
1094110345 12:26855296-26855318 AAATAGGGCATGTGAGAGGCTGG - Intergenic
1103199594 12:119076463-119076485 GACAAAGCCATGTGAATGGCAGG - Intronic
1107616682 13:42175770-42175792 GACTAGGCCCTGAACTAGGCTGG + Intronic
1114488077 14:23076240-23076262 GAACAACCCATGTGATAGGCAGG + Intronic
1117097245 14:52311509-52311531 GACTAGGCCATGGGATGCCCAGG - Intergenic
1118979162 14:70701987-70702009 GACTGGTCCAGGTGAGAGGCAGG - Intergenic
1119998123 14:79275628-79275650 GCCTCGGCTATGTGATAGTCTGG - Intronic
1120662792 14:87270585-87270607 GACTGGGCCATGAGGTATGCAGG + Intergenic
1121267131 14:92611547-92611569 AAGAAGGCCATGTGATGGGCTGG - Intronic
1121961971 14:98268679-98268701 GACTAGGCACTATGCTAGGCAGG + Intergenic
1123061121 14:105594950-105594972 GGCCAGGCCATGTGGAAGGCAGG + Intergenic
1123085576 14:105715861-105715883 GGCCAGGCCATGTGGAAGGCAGG + Intergenic
1140443709 16:75006788-75006810 GACTAGGCCATGAGAAAGCTTGG - Intronic
1142788036 17:2240453-2240475 AACTAAGCCATGTGACAGGGTGG + Intronic
1148233566 17:45952345-45952367 GCCCAGGCCAGGTGAGAGGCAGG - Intronic
1153518804 18:5932321-5932343 GAGGAGTCCATGTGTTAGGCAGG + Intergenic
1156842943 18:41630703-41630725 CAGTAGGCCATGTGGTAGGTAGG + Intergenic
1157475212 18:48019675-48019697 GACAGGGCCATCTGAGAGGCAGG - Intergenic
1167687704 19:50967047-50967069 CACGAGGCCATCTGATAGCCAGG - Intronic
933874404 2:86604127-86604149 GACCAGCCCATGTGAAAGGAAGG - Exonic
936740410 2:115499316-115499338 CAATAGACCATGTGTTAGGCGGG + Intronic
941438946 2:165509308-165509330 GAGTAGGCCATGTAATATGTGGG + Intronic
945169748 2:206983210-206983232 CACTCGGCCATGGGAAAGGCAGG - Intergenic
947601549 2:231453960-231453982 GACAAGGCCACGTGAGAGGCGGG - Exonic
948815532 2:240508303-240508325 GGCTAGGCCCTGTTAGAGGCAGG - Intronic
1171963950 20:31515459-31515481 GACTAGGCCATGTCCAAGGTTGG - Intronic
1175988872 20:62777748-62777770 GACCATGCCATCAGATAGGCTGG - Intergenic
1176259752 20:64173369-64173391 GACTAGGCCAGGCCACAGGCTGG - Intronic
1177113547 21:17058087-17058109 GACTAGGACAGAGGATAGGCAGG + Intergenic
1179183071 21:39061837-39061859 GGCCTGGCCATGTGAGAGGCGGG - Intergenic
1184592278 22:45493079-45493101 GAGTAGACCATGTGATAACCAGG - Intergenic
949737017 3:7185165-7185187 TACTAGGCCATGTTATATGAGGG + Intronic
954150342 3:48654248-48654270 GACAGGGCCATGGGCTAGGCTGG + Intronic
960059887 3:113310190-113310212 GTGGAGGCCATGTGATAGCCTGG + Intronic
964515889 3:157507138-157507160 GAAGAGGCCATGTTAGAGGCAGG - Intronic
966620005 3:181953227-181953249 GACTAATCCATGTGAAAGGATGG + Intergenic
967138062 3:186529256-186529278 GGCCAGGCCATGTGATGGGGGGG + Intergenic
969724055 4:8908667-8908689 GACCAGGCCCTGTGCTGGGCGGG + Intergenic
971551778 4:27966406-27966428 GCCTAGGACATGACATAGGCTGG - Intergenic
979302642 4:119104827-119104849 GCTTAGGACATGTGGTAGGCAGG - Intergenic
980940765 4:139272025-139272047 GACTAGGCCATGTGATAGGCTGG - Intronic
981718780 4:147778283-147778305 CACTAGGCCACGTGATATGAGGG - Intronic
982091172 4:151881083-151881105 GAATGGGCCAGGTGAGAGGCAGG - Intergenic
987786397 5:22505688-22505710 GACAAGGCAATGTGATATCCTGG - Intronic
997808184 5:136940531-136940553 GAATAACCCATGTGAGAGGCAGG + Intergenic
1006803754 6:36775670-36775692 GTCTAGGGGATGTGAGAGGCAGG - Intronic
1008617943 6:53244282-53244304 GACTAGAAGCTGTGATAGGCTGG + Intergenic
1009742197 6:67759694-67759716 CACTCTGCCATGTGATGGGCTGG + Intergenic
1019666809 7:2256085-2256107 GACTTGGACATGTGAGTGGCCGG - Intronic
1021182262 7:17520394-17520416 TGCTAGGCCCTGTGCTAGGCTGG + Intergenic
1023055465 7:36286589-36286611 GGCTAGGGCATGTCCTAGGCTGG + Intronic
1023109118 7:36792363-36792385 GGCTAAGCCATGTAATTGGCTGG - Intergenic
1023325567 7:39052071-39052093 GCATAGGCTATGTGATAGGAAGG - Intronic
1027242056 7:76337324-76337346 GATTTGGACATGTGCTAGGCAGG + Intronic
1047608688 8:126499556-126499578 TAATAGGTCATGTGAGAGGCAGG - Intergenic
1057713605 9:97469403-97469425 TCCTTGGCCATGTGATAAGCGGG - Intronic
1058759669 9:108118778-108118800 TCCTAGTCCTTGTGATAGGCTGG + Intergenic
1061918651 9:133770188-133770210 TCCTGGGCCATGTGACAGGCGGG - Intronic
1062276976 9:135735886-135735908 GACTCGCCCAGGTGACAGGCAGG - Intronic
1190522941 X:51298686-51298708 GACAAGTCCTTGTGCTAGGCTGG + Intergenic
1198871448 X:141180297-141180319 CACTGGGCCAGGTGATTGGCAGG + Intergenic
1200628673 Y:5554506-5554528 GAGGAGGCTATGTGATAGGAGGG - Intronic