ID: 980940766

View in Genome Browser
Species Human (GRCh38)
Location 4:139272029-139272051
Sequence TTGAGACTAGGCCATGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980940766_980940770 21 Left 980940766 4:139272029-139272051 CCTATCACATGGCCTAGTCTCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 980940770 4:139272073-139272095 GGCCTACACCTCAACTAGAGTGG No data
980940766_980940768 -3 Left 980940766 4:139272029-139272051 CCTATCACATGGCCTAGTCTCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 980940768 4:139272049-139272071 CAATCTCTGTTTTTTTTTTTTGG 0: 1
1: 0
2: 35
3: 675
4: 4245
980940766_980940771 22 Left 980940766 4:139272029-139272051 CCTATCACATGGCCTAGTCTCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940766_980940769 0 Left 980940766 4:139272029-139272051 CCTATCACATGGCCTAGTCTCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 980940769 4:139272052-139272074 TCTCTGTTTTTTTTTTTTGGTGG 0: 1
1: 22
2: 332
3: 3975
4: 21587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980940766 Original CRISPR TTGAGACTAGGCCATGTGAT AGG (reversed) Intronic
903412431 1:23156739-23156761 TTGAGTCTTGGCCACATGATTGG - Intronic
905658635 1:39702750-39702772 TTGCTACTAGGACCTGTGATGGG + Intronic
906797164 1:48707459-48707481 TTGACACTCTGCCATGTGCTTGG + Intronic
909755010 1:79214738-79214760 TTGGGACTGGGCCATGAGACAGG + Intergenic
909857573 1:80557862-80557884 TTGAGACTAGGCCATAGGGTAGG - Intergenic
911281600 1:95936218-95936240 TAGATACTCGGCCATGAGATGGG - Intergenic
913417675 1:118629617-118629639 TTGAGACTAGACTGTCTGATGGG - Intergenic
913559790 1:120005975-120005997 TTTTGACTAAGCCATTTGATAGG + Intronic
914280377 1:146165397-146165419 TTTTGACTAAGCCATTTGATAGG + Intronic
914541421 1:148616337-148616359 TTTTGACTAAGCCATTTGATAGG + Intronic
914625219 1:149454909-149454931 TTTTGACTAAGCCATTTGATAGG - Intergenic
921621176 1:217328151-217328173 CTGAGAAAAGGCCATGTGAAAGG + Intergenic
921774040 1:219076600-219076622 TTGAAACTAGGCCATATATTTGG - Intergenic
1068701168 10:60021550-60021572 TTGTGCCAAGGACATGTGATGGG + Intergenic
1072979279 10:100086255-100086277 TAGAGACCATGCCAGGTGATGGG + Intergenic
1074606851 10:114980363-114980385 TTTAGACAAGGTCATGAGATTGG - Intergenic
1076085946 10:127632015-127632037 TTCAGAATAGACCATGTGATAGG - Intergenic
1078218601 11:9333095-9333117 TTGGGAGGAGGCAATGTGATAGG - Intergenic
1084697293 11:70763292-70763314 TTGAGACAGGGCCATGGGATGGG + Intronic
1084736419 11:71108468-71108490 TTGGGACAAGGGCATGTGGTGGG - Intronic
1086881928 11:92159784-92159806 TTGACACAAGGCCATGCCATGGG + Intergenic
1088432285 11:109771982-109772004 TTGAGAGTAGGCATTCTGATTGG - Intergenic
1090734103 11:129596280-129596302 TTGAGGCTAATCCATGAGATGGG + Intergenic
1094580117 12:31726996-31727018 TTGAGACCAGGTTATGAGATTGG + Intronic
1095516069 12:43006953-43006975 GTGAGACCAGGCTTTGTGATGGG - Intergenic
1096600277 12:52724102-52724124 TTCAGACTGGGCCAGGTCATTGG - Intergenic
1098488093 12:71045091-71045113 TTGAGATTAGCCCAACTGATAGG + Intergenic
1098903478 12:76137318-76137340 TTGAAACTAGCCCGTGTGTTTGG + Intergenic
1101055748 12:100911656-100911678 TTGAGACCAGGCCTTGACATTGG - Intronic
1102712019 12:114936483-114936505 TTGAGAGGAGTCCATGTGAAGGG - Intergenic
1102817752 12:115881700-115881722 TTGAGACAAAGCCCTGTGACGGG + Intergenic
1105254865 13:18737497-18737519 TCAATACTAGTCCATGTGATTGG - Intergenic
1109578416 13:64292847-64292869 TAGGGACAGGGCCATGTGATTGG - Intergenic
1110537656 13:76670322-76670344 TTGAGGCTTGGCAATGGGATAGG + Intergenic
1111400480 13:87727638-87727660 TTGATTTTTGGCCATGTGATTGG + Intergenic
1112587421 13:100731568-100731590 CTTAGTCTAGGCAATGTGATGGG - Intergenic
1113695689 13:112343712-112343734 TGGAGACGAGGCCCTGTGTTCGG - Intergenic
1114143522 14:19945926-19945948 TTTAGACTAAGCAATTTGATAGG + Intergenic
1115466454 14:33719717-33719739 TTGAGACTAGTCCATCAGAAAGG - Intronic
1116154963 14:41191961-41191983 TTGAGGATAGGCCATATGTTAGG + Intergenic
1116257456 14:42574388-42574410 TCAAGAATAGGCCATGTGTTAGG + Intergenic
1122514932 14:102300762-102300784 TTGAAACAATGCTATGTGATTGG + Intronic
1126748763 15:51854029-51854051 TGGAGTATAGGCTATGTGATGGG + Intronic
1130553253 15:84905358-84905380 TTCAGAACAGGCCATGTGCTTGG - Intronic
1133495789 16:6315631-6315653 TTGACACTAGCCCATGAGATTGG + Intronic
1135395466 16:22128360-22128382 TTGAGCCAAGGCAATGTGAATGG + Intronic
1137509281 16:49084264-49084286 TAGAGACGAGGACATGTGAAGGG - Intergenic
1138626134 16:58253471-58253493 TTGAGACAAGGGCCTGTGCTAGG - Intronic
1143609505 17:8009587-8009609 GTGAGACTTGGGCCTGTGATGGG + Intronic
1146069660 17:29668527-29668549 TTGAGACTAGCCCAGGCAATTGG + Intronic
1147542263 17:41370225-41370247 TAGAAACTAGACTATGTGATAGG + Intronic
1148984896 17:51612837-51612859 TTTAGAGTGGGCCATGTGATAGG + Intergenic
1149870991 17:60181517-60181539 TTGAGTCGAGGGCATGTGCTGGG - Exonic
1151057123 17:71045975-71045997 TTTAGCCTAGGCCAAGTGGTTGG + Intergenic
1151415557 17:73960416-73960438 TTGTGGCCTGGCCATGTGATTGG + Intergenic
1151830291 17:76545296-76545318 TTCACACTAAGCCCTGTGATGGG - Intronic
1154436163 18:14343106-14343128 TCAATACTAGCCCATGTGATTGG + Intergenic
1155308059 18:24498526-24498548 TTGATACAAGGCCAAATGATGGG + Intergenic
1157992560 18:52514539-52514561 TAGAGACTTGGAAATGTGATTGG + Intronic
1158739305 18:60121396-60121418 TGGAGACTAGGATATGTGTTAGG - Intergenic
1160152772 18:76407516-76407538 AGGAGACGGGGCCATGTGATTGG + Intronic
1167718940 19:51164433-51164455 TTGGGGCTCGTCCATGTGATGGG - Intergenic
1167764465 19:51471692-51471714 TTGAGACTCAGCTATGTGATTGG + Intergenic
1167851271 19:52204214-52204236 GTGAGACTAGGACATGAGGTTGG + Intronic
926157253 2:10463383-10463405 TTGAGACCAGGTCATGAGACTGG - Intergenic
927107320 2:19839427-19839449 TAGAGACTTGGGGATGTGATGGG - Intergenic
927517537 2:23680931-23680953 CTGAGAATAGGCCATGTTGTTGG + Intronic
929144556 2:38695277-38695299 TTGAGACTGGGCTGTGAGATTGG - Intronic
931263016 2:60636909-60636931 CTGAGACTGAGCCATGTGGTTGG - Intergenic
933802257 2:85971326-85971348 TTGAGACCAGGTCATGAGACTGG + Intergenic
936623140 2:114120775-114120797 TTGAGAATAGCCAATGTCATTGG - Intergenic
939043098 2:137215874-137215896 TTTAGATTAAGCTATGTGATAGG + Intronic
941183507 2:162290711-162290733 TTAAGACTAGGAGATTTGATAGG + Intronic
942065096 2:172263356-172263378 TTGAGCAGGGGCCATGTGATTGG - Intergenic
942079876 2:172389874-172389896 TTTAGGCTAGGTCATGTGGTTGG - Intergenic
943647315 2:190420405-190420427 TTGAGAAGAGGTCATGAGATAGG - Intronic
947147223 2:227079199-227079221 TTGAGACCAGGCCATGTAGAAGG - Intronic
947374508 2:229482222-229482244 TTGGGACTAGACAATGTGAAAGG - Intronic
947581267 2:231320386-231320408 TTGAGATTGTGCCAAGTGATGGG - Intronic
1170060920 20:12258304-12258326 TAGAGACTTGGTCATGTGAATGG - Intergenic
1176373859 21:6077730-6077752 CTGAGACCAGGCCCTGTGGTGGG + Intergenic
1176840875 21:13842531-13842553 TCAATACTAGTCCATGTGATTGG - Intergenic
1177689134 21:24481222-24481244 TTGAAACAAGGCCATGTAATAGG + Intergenic
1179749618 21:43460513-43460535 CTGAGACCAGGCCCTGTGGTGGG - Intergenic
949368626 3:3310282-3310304 TTGAGAACACGCCATGTGCTAGG - Intergenic
950612041 3:14133064-14133086 TTGAGACCAAGCCCTGTGCTGGG + Intronic
950698771 3:14725625-14725647 TTGAGACTTTGCCATTTGTTGGG + Intronic
953334953 3:42086943-42086965 TTGAAACTAAGCAATGTGATTGG + Intronic
953431632 3:42845028-42845050 TTCAGGCTAGGGCATGGGATGGG + Intronic
957062456 3:75493024-75493046 TTGAGACTAAGCCAATTGACAGG - Intergenic
958777951 3:98508035-98508057 GAGAGACTAGGCTATGTAATAGG - Intronic
958830950 3:99088596-99088618 TAGACACCAGGCCATGTGCTGGG + Intergenic
959019436 3:101172152-101172174 TTGAGACTGGCCCATGTGACAGG - Intergenic
960002244 3:112745022-112745044 TTGAGACCTGGCAATGTGCTTGG + Intronic
961364537 3:126390928-126390950 TTGAGACTAGACCAGGTTGTGGG - Intergenic
967138058 3:186529252-186529274 TGGAGGCCAGGCCATGTGATGGG + Intergenic
971196625 4:24476179-24476201 TTGTGACTTGGCAATATGATAGG - Intergenic
973072105 4:45874830-45874852 ATGAGACAAGGCAATGTAATGGG + Intergenic
973656491 4:53053542-53053564 TTGAGATGAGGGCATCTGATTGG - Intronic
974825932 4:67130848-67130870 TTGAGCCTAGACTATATGATAGG + Intergenic
974988208 4:69055624-69055646 TAGAGACTGGGCTATGTGTTCGG - Intronic
976335452 4:83880092-83880114 TGGGGGCTAGGTCATGTGATGGG - Intergenic
980940766 4:139272029-139272051 TTGAGACTAGGCCATGTGATAGG - Intronic
988664217 5:33307612-33307634 CTGAGAATAGACTATGTGATAGG - Intergenic
989022087 5:37019661-37019683 TTGAGGCTAGGCTAGGTCATTGG + Intronic
995457364 5:112366537-112366559 TTGTGAAAGGGCCATGTGATAGG + Intronic
996801587 5:127409443-127409465 TTTTGACTAGGCCAGGTGACTGG - Intronic
999577672 5:152997718-152997740 GTGAGACTAAGGCATGTGATTGG - Intergenic
1001474168 5:172037777-172037799 TTGAGACTAGAGCATAAGATGGG - Intergenic
1006797622 6:36741677-36741699 TGGACCGTAGGCCATGTGATGGG - Exonic
1008163986 6:48113323-48113345 GTGAGACTAGGCTATGGGACTGG - Intergenic
1008620743 6:53269346-53269368 TTGAAACTAGGCCTAGTGTTAGG - Intronic
1022223326 7:28337108-28337130 TTGAGGCTAGACCATATGTTAGG - Intronic
1022954501 7:35368575-35368597 CTGAAACTATGCAATGTGATAGG + Intergenic
1023424125 7:40016434-40016456 CTGTTACTATGCCATGTGATAGG + Intronic
1023444737 7:40219589-40219611 TTGTGACCAGGCCATGTGAATGG + Intronic
1024569233 7:50710236-50710258 GTGAGGCTGGGCCATGTGCTGGG - Intronic
1033151006 7:138915104-138915126 TGGAGATTAGGCATTGTGATGGG - Intronic
1033839041 7:145351620-145351642 TTGAGAATTTGCTATGTGATAGG - Intergenic
1042218044 8:66446123-66446145 TTGTGAAGAGGCCTTGTGATGGG + Intronic
1042292048 8:67178849-67178871 TTGACACTTGTGCATGTGATGGG + Intronic
1047184585 8:122621038-122621060 TTTGGATGAGGCCATGTGATTGG + Intergenic
1050478974 9:6069972-6069994 TTGAGATTGGGCAATGTTATGGG + Intergenic
1052194520 9:25695209-25695231 TTGAGACTAGGACTGGTGATTGG - Intergenic
1056580529 9:87885977-87885999 TTGGGGCTGGGCCATGTGGTGGG - Exonic
1056774148 9:89498862-89498884 TTGTGACTAGCCCATGGGTTTGG + Intergenic
1057435119 9:95032869-95032891 TTCTGACCAGGCTATGTGATGGG + Intronic
1057587824 9:96345577-96345599 TTGAGTCGAAGCCATCTGATGGG - Intronic
1057974265 9:99587638-99587660 TTGAGACTAGGCACTGTGTGCGG + Intergenic
1058630625 9:106982804-106982826 TTGAGACTAAGGCATGACATTGG + Intronic
1189737420 X:44086156-44086178 GTGAGATTAGGGAATGTGATGGG - Intergenic
1190464220 X:50709496-50709518 TTAAAACTATGCCATGTGGTTGG + Intronic
1197098668 X:122625576-122625598 TTGAGAACAAACCATGTGATAGG + Intergenic
1197294731 X:124705012-124705034 TTGTTACTAGCCTATGTGATTGG - Exonic
1200240878 X:154492919-154492941 TTTAGACTAGGACAGGTGAAAGG + Intergenic