ID: 980940767

View in Genome Browser
Species Human (GRCh38)
Location 4:139272041-139272063
Sequence AAAAAACAGAGATTGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1086
Summary {0: 1, 1: 0, 2: 9, 3: 86, 4: 990}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980940767_980940771 10 Left 980940767 4:139272041-139272063 CCTAGTCTCAATCTCTGTTTTTT 0: 1
1: 0
2: 9
3: 86
4: 990
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940767_980940770 9 Left 980940767 4:139272041-139272063 CCTAGTCTCAATCTCTGTTTTTT 0: 1
1: 0
2: 9
3: 86
4: 990
Right 980940770 4:139272073-139272095 GGCCTACACCTCAACTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980940767 Original CRISPR AAAAAACAGAGATTGAGACT AGG (reversed) Intronic
900921408 1:5673462-5673484 AAAAAAAAAAGTCTGAGACTGGG - Intergenic
901458763 1:9378833-9378855 AAAAATAAAAGATTCAGACTCGG + Intergenic
901621057 1:10587923-10587945 AAAAAAAAGAGATGGAGTCTTGG + Intronic
901918727 1:12520441-12520463 AAAAAAAAGAGAGAGAGATTAGG + Intergenic
902182831 1:14702543-14702565 ACAAAACAGGGATTGTGAGTGGG - Intronic
902737554 1:18411183-18411205 AAAAAGGAAAAATTGAGACTTGG + Intergenic
903564596 1:24255204-24255226 AAAAAAGAGAGAGCGAGTCTAGG - Intergenic
903961543 1:27060896-27060918 AACAAACAGAGGTAGAGAGTGGG - Intergenic
904220547 1:28964743-28964765 AAACAATGGAGGTTGAGACTGGG - Intronic
904352658 1:29918975-29918997 AAGAAACAGAGATGGAGAAAGGG - Intergenic
904511586 1:31014459-31014481 TAAAAATAGAGATTGGGTCTTGG - Intronic
904861517 1:33541461-33541483 AAAAAAAAGAAATTTAGAATGGG - Intronic
905055734 1:35091902-35091924 AAAAAAAAGAGAAAAAGACTTGG + Intronic
905192757 1:36248433-36248455 AAAAAAAAGAGGCTGAGGCTGGG - Intronic
905509583 1:38508183-38508205 AAAAAACAGTGAATGAGTGTAGG - Intergenic
906111248 1:43323462-43323484 AAAAAAAAGAGACAGAAACTGGG + Intergenic
906396977 1:45474771-45474793 AAAAAAAAGAGATGGAGGCCAGG - Intronic
906486065 1:46236009-46236031 AAAAAAAAAAAATTGAGACAGGG - Intergenic
906577993 1:46908175-46908197 AAAGAACAGAGAATGAGAGAGGG - Intergenic
906594873 1:47067112-47067134 AAAGAACAGAGAATGAGAGTGGG + Intergenic
907015905 1:51012668-51012690 AAAAAAAAAATATTGAGACAGGG + Intergenic
907081562 1:51628048-51628070 AAAAAAAAAAAATTGAGAGTAGG - Intronic
908293817 1:62693244-62693266 CAAAAATAGAGCTTGAGGCTTGG + Intergenic
909270952 1:73623241-73623263 AAAAAACATGGATAAAGACTTGG + Intergenic
909563744 1:77032626-77032648 AGAAAACTGAGACTGAGAGTAGG + Intronic
909574437 1:77158310-77158332 AAAAAAGAGAGATTTAGGCTGGG - Intronic
909701243 1:78525755-78525777 CATTAACAGAAATTGAGACTTGG + Intronic
909798154 1:79770419-79770441 AACAAACAAAGTTTGAAACTAGG + Intergenic
909926249 1:81441030-81441052 ACAAAACAGGGATTGAGAGAGGG - Intronic
910089547 1:83445983-83446005 AATAAAGAGATATTGTGACTTGG + Intergenic
910819112 1:91327218-91327240 AAAATACATAGACTGAGGCTGGG + Intronic
911266256 1:95747685-95747707 AAAAAAAAGATATAAAGACTGGG - Intergenic
911298326 1:96144586-96144608 AAAAAACAGAGGTAGAGACAAGG + Intergenic
911548603 1:99252261-99252283 AAAAAAAAAACATTAAGACTAGG + Intergenic
911607592 1:99926116-99926138 GAAAATCAGAGTTTGAGTCTTGG - Intergenic
911818649 1:102387435-102387457 AAAGAAGAGAGACTGAGAGTGGG + Intergenic
912220733 1:107671970-107671992 AAAAAAGATAAATTTAGACTGGG + Intronic
912253536 1:108035608-108035630 AAAAAAAAGATATTGATCCTGGG - Intergenic
912795498 1:112690653-112690675 AAAAAACAGAGATGTTGGCTGGG - Intronic
912918214 1:113839375-113839397 AAAAAAAAAAGATTGAGGCCAGG - Intronic
913048388 1:115092965-115092987 AAAAAAAATAGATTGAGAAATGG - Intergenic
913150869 1:116041643-116041665 AAGAAACAGAAATTGAAGCTTGG + Intronic
913437329 1:118860689-118860711 AAAAAACATAGTTTGAAAATAGG - Intergenic
913669874 1:121087170-121087192 GAAAATCAGAGATTCAAACTGGG + Intergenic
914021636 1:143874568-143874590 GAAAATCAGAGATTCAAACTGGG + Intergenic
914660124 1:149782519-149782541 GAAAATCAGAGATTCAAACTGGG + Intergenic
914748772 1:150518374-150518396 AAAAAAAAAAGAGAGAGACTTGG - Intergenic
915061685 1:153191114-153191136 TGAAATCAGAGACTGAGACTGGG - Intergenic
915097711 1:153475401-153475423 AAAAAAAAAAGATTGGGTCTAGG + Intergenic
915151282 1:153833964-153833986 AAAAAAAAGAGAGAGAGACAGGG - Intronic
915188018 1:154123886-154123908 AAAAAAGAGAGAGAGAGGCTGGG + Intronic
916505123 1:165421938-165421960 AAGAAACAGAGATTAGCACTTGG + Intronic
917424993 1:174904209-174904231 GAAAAACTGAGATTGAGGCCAGG + Intronic
917588393 1:176451958-176451980 AGAAAACAGGGTTTGAGAGTAGG - Intergenic
918319162 1:183348517-183348539 AAAAATCAGAGAAGGAGATTGGG + Intronic
918471142 1:184875855-184875877 AAAAAACACAGATTTGGACTGGG - Intronic
918696594 1:187553178-187553200 AAAAAAAAGAAACTGGGACTGGG - Intergenic
918901084 1:190418689-190418711 AAAAAACTGAGCTTGAGTTTTGG + Intronic
918927772 1:190809839-190809861 AAAATACAGGGAATGAAACTAGG + Intergenic
918961042 1:191278142-191278164 AACAAACATAAATTAAGACTAGG - Intergenic
919840082 1:201602621-201602643 AAAAAACATAGCTTAAGTCTAGG - Intergenic
919859741 1:201731640-201731662 AAGAATGAGAGATTGAGGCTGGG - Intronic
919899433 1:202033175-202033197 AAAAAAAAGAGAGAGAGACTGGG - Intergenic
920233621 1:204487098-204487120 AAAAAACAAACATAGAGGCTGGG - Intronic
920555805 1:206903492-206903514 AAAAAACAGAGAGGGATGCTTGG + Intronic
920565271 1:206968042-206968064 AAAAGACAGAGATTGTGGCCGGG + Intronic
920905863 1:210166868-210166890 GTAATACAGAGATTAAGACTAGG + Intronic
920910733 1:210213898-210213920 AAAAGACAGAGATGGAAAATGGG + Intergenic
921174596 1:212583214-212583236 AAAAAACAGAGAGAGAAATTAGG - Intronic
921559872 1:216644239-216644261 TAAAAGCAGAGGTTGAGAATTGG - Intronic
921628866 1:217409337-217409359 AAAAAAAAGAGAGTGAGAGATGG + Intergenic
921660341 1:217793587-217793609 AACTAACTGTGATTGAGACTTGG - Intronic
921779460 1:219144942-219144964 AAAAAACACATATTGAGAACAGG + Intergenic
922029830 1:221787216-221787238 AGAAAAAAGAGAATGGGACTGGG + Intergenic
922118349 1:222636494-222636516 AAAAAAAAAAGATGGACACTAGG - Intronic
922487065 1:225981641-225981663 AAAAAAAAAAGACAGAGACTCGG + Intergenic
922634769 1:227156899-227156921 AGAAAACAGAGATTGAAATCAGG - Intronic
923220190 1:231885868-231885890 AGAAAACAAAGACAGAGACTAGG - Intronic
923270207 1:232348466-232348488 ACAACATAGAGATTGACACTGGG - Intergenic
923404109 1:233643587-233643609 GAAGAAGAGAGATGGAGACTTGG + Intronic
923497446 1:234537754-234537776 AAAAGACAGACAGTGAGAATAGG + Intergenic
923721032 1:236467087-236467109 AAAAAACACACATTGACACCAGG + Intronic
923964724 1:239124822-239124844 ATAAAACAGAGAAAGAGACTAGG + Intergenic
924048930 1:240060888-240060910 AAAAAACAGAGAGAGAGAAATGG + Intronic
924704428 1:246488392-246488414 AAATAACAGAGATTTAGGCTGGG + Intronic
924743738 1:246813621-246813643 GAAAAGCAGAGAATGAGAATTGG - Intergenic
1062902640 10:1157525-1157547 AAGAAATAGAGATAGAGACAGGG + Intergenic
1063107094 10:3001920-3001942 AAGAAACAGAGAAGGAGAGTGGG + Intergenic
1063400219 10:5736424-5736446 AAAAAAAAGAGAGAGAGACGGGG + Intronic
1063648718 10:7912270-7912292 AAAAAAAAGAAATGGAGACAGGG + Intronic
1063733371 10:8724123-8724145 CAAAAACAGTGATTTCGACTAGG - Intergenic
1063734502 10:8737637-8737659 AGAGAACAGAGATTCAGAATAGG - Intergenic
1064528477 10:16283075-16283097 AATAAAGACATATTGAGACTTGG - Intergenic
1064694550 10:17952453-17952475 AAAAAAAAGAGTTTTAGACAAGG - Intronic
1064733475 10:18356928-18356950 AAAAAAAAGAAATTGAGTCTGGG - Intronic
1064801917 10:19085439-19085461 AGAAAACAGATATTGCCACTGGG + Intronic
1064881563 10:20060503-20060525 AAAAAAAAGTCATTGAGGCTGGG + Intronic
1064991161 10:21258271-21258293 AGAAAACAGAGGTTGAGGCTGGG + Intergenic
1065930086 10:30471629-30471651 AAAAAAAAGAGTTTGAGGCTGGG - Intergenic
1065978446 10:30864980-30865002 ACAAAGCAGGTATTGAGACTTGG + Intronic
1067432072 10:46251471-46251493 CAAAAGCAGAGATGGAGGCTGGG - Intergenic
1068105472 10:52609631-52609653 CACAAACAGAGATTGAGAGAGGG + Intergenic
1069046170 10:63745904-63745926 CAAAAACAGAAATTGACAGTTGG + Intergenic
1069683677 10:70302699-70302721 AAAAAAAAGAAATAGAGACTGGG - Intronic
1069998119 10:72355487-72355509 AAAACACAGGGATAGAGAGTGGG + Intergenic
1070071870 10:73097302-73097324 AAATAATAGAGATTCAGTCTTGG + Intergenic
1070533339 10:77356745-77356767 AAAACAGAGGGATTGAGAGTGGG - Intronic
1070887337 10:79915066-79915088 AAAAAAAAAAAATTGACACTTGG - Intergenic
1071055046 10:81499782-81499804 GAAAAACAAAGATTAAGATTAGG + Intergenic
1071307841 10:84314606-84314628 CAGAAAAAGAGATTGAGAATAGG - Intergenic
1071762314 10:88622350-88622372 AGAAAACAGAGCTTGAGACAGGG - Intergenic
1071788357 10:88928369-88928391 AAAAAACAGAGAAGGACTCTGGG + Intronic
1071848196 10:89541298-89541320 AAAAAACATGGATTGAGGATGGG + Intronic
1072116355 10:92373990-92374012 AAAAAAGAGAGAGAGAGAATGGG - Intergenic
1072630873 10:97145659-97145681 AAGAGCCAGAGATTAAGACTTGG + Intronic
1072905595 10:99450446-99450468 TTAAACCAGAGATTGTGACTTGG - Intergenic
1072946612 10:99816259-99816281 AAAAAACAGAGATGGAGGCCGGG - Intronic
1073008087 10:100339865-100339887 AGAAAAAAGACATTGACACTTGG + Intergenic
1073156371 10:101350293-101350315 AAAAAAGAGAGAGAGAGACAAGG + Intergenic
1073240878 10:102057101-102057123 AAAAAACAGAGACTCAGGCTGGG - Intergenic
1073249956 10:102115120-102115142 ACAAAAGAGAGACAGAGACTGGG + Intronic
1073278227 10:102331486-102331508 AAAAAAAACAGATTGGGGCTGGG + Intronic
1073889001 10:108075581-108075603 AGAATACAGAGAATGAGAATTGG + Intergenic
1073922404 10:108474047-108474069 AAAACATGGAGATTAAGACTGGG + Intergenic
1074074801 10:110113239-110113261 AAAAAACAAAAATAGAGACAAGG - Intronic
1074220128 10:111428512-111428534 AAAAAAAGGAAATTGAGACATGG + Intergenic
1074457075 10:113604529-113604551 AAGAAGCAGAGATTGACACCCGG + Intronic
1075586057 10:123659048-123659070 GAGAGAGAGAGATTGAGACTGGG + Intergenic
1076338652 10:129727909-129727931 AAACAACATAGACTGAGGCTGGG + Intronic
1076412305 10:130260993-130261015 AAAAGACAGAGATAGAAAATAGG - Intergenic
1077756849 11:5039928-5039950 AGAAAACAGAAAATGAAACTAGG - Intergenic
1077998802 11:7476368-7476390 AAGAAACAGAGACTCAGAGTAGG + Intergenic
1078516992 11:12030965-12030987 AAATACCTGAGACTGAGACTGGG - Intergenic
1078767239 11:14310377-14310399 AAACAACAGAGACTGGGACCTGG + Intronic
1078771275 11:14354658-14354680 AAAAAAAAGAAATTGTTACTTGG - Intronic
1079608137 11:22395667-22395689 TAAAAACAGAAATGGATACTGGG + Intergenic
1080154055 11:29087661-29087683 AAAAAATTGAGATTGAGTATTGG - Intergenic
1080278201 11:30526866-30526888 AGAAAATAGAGATTGATACCTGG - Intronic
1080282895 11:30579254-30579276 TAAAAAAAGAGCTTGTGACTTGG + Intronic
1080522897 11:33083080-33083102 AAAATACAGAGATGTAGGCTGGG - Intronic
1080853158 11:36088928-36088950 CAGAAACAGAGTGTGAGACTGGG - Intronic
1080929407 11:36792909-36792931 AAAAACCACAGAGTGTGACTTGG + Intergenic
1080945116 11:36964060-36964082 ATAAAACAGATATTGATATTAGG + Intergenic
1081326089 11:41746743-41746765 AAAAAACAGAAAATGAGTGTTGG + Intergenic
1081399024 11:42621239-42621261 AAAAAAAAGAGAGTGAGTTTTGG - Intergenic
1081579220 11:44340486-44340508 CAAAAACAGAGCCTGAGCCTTGG - Intergenic
1081924867 11:46817120-46817142 AAAAAAAAGAGAGAGAGACAGGG + Intronic
1082073756 11:47960724-47960746 AAAAAAAAAAGATGGAGGCTGGG - Intergenic
1082771678 11:57212715-57212737 AAAAATCTGACTTTGAGACTTGG - Intergenic
1083101977 11:60317690-60317712 AGAAAACAGAGCCTGAGACAGGG - Intergenic
1083312392 11:61790928-61790950 AAAAAAAAGATATTGAGATCTGG - Intronic
1083312439 11:61791249-61791271 AAAAAAAAAAAATTGAGCCTGGG - Intronic
1083780591 11:64915443-64915465 ATACAACAGGGACTGAGACTGGG + Intronic
1084234228 11:67776088-67776110 ATAAAACATAGATTCAGACTGGG - Intergenic
1084535256 11:69752755-69752777 AAAAAAAAGAGAGAGAGATTTGG + Intergenic
1084549043 11:69830014-69830036 AAGAAACAGATAATGAGGCTGGG - Intergenic
1084928960 11:72538565-72538587 CAAAAACAGAGCCTGAGACAAGG + Intergenic
1085086246 11:73669519-73669541 AAAGAACAGAGATGGAGGCCGGG + Intergenic
1085422197 11:76372414-76372436 AAAAAAGAGAGAGAGAGACAGGG + Intronic
1085445622 11:76598993-76599015 ATAAAACAGAATGTGAGACTCGG - Intergenic
1086512091 11:87569978-87570000 AAAAAACTAACATTGAGGCTGGG + Intergenic
1087257873 11:95977001-95977023 AAAAAACAAGGATTGAAACCTGG + Exonic
1087267540 11:96077205-96077227 AAAAAAAAGAGAGAGAGAGTTGG - Intronic
1088252035 11:107869424-107869446 AAAAAAAAAAGCTTGAGCCTGGG + Intronic
1088443202 11:109895031-109895053 AAAACACAGAGATAGAAAATAGG + Intergenic
1088547115 11:110970296-110970318 AAAAAACTCAGCTGGAGACTAGG + Intergenic
1088605157 11:111522823-111522845 AAAAAAAAAAAATTGAGGCTGGG + Intronic
1088964284 11:114702372-114702394 TAACAAAAGAGATTGAGACCCGG - Intronic
1089115903 11:116094909-116094931 AAAAAACAGAGCCTGATACGAGG + Intergenic
1089265791 11:117260624-117260646 AAAAAAAAGAAATAGAGACTAGG - Intronic
1089597107 11:119587449-119587471 AAAAAACAGAAAAAGAGGCTGGG + Intergenic
1089909713 11:122084813-122084835 AAAATACAAAAATTGAGGCTGGG + Intergenic
1090237546 11:125160516-125160538 CAAACACAGAAACTGAGACTTGG + Intergenic
1090293081 11:125563542-125563564 AAAAAACACAAATTAAGACAGGG + Intergenic
1090651944 11:128814666-128814688 AAATAACAGATATTGAAAATAGG - Intergenic
1090679423 11:129037805-129037827 AGAAAACACATATAGAGACTGGG + Intronic
1090997581 11:131880789-131880811 AAAAAAAAAAGAGTGAGATTTGG - Intronic
1091172600 11:133531774-133531796 AAGAAACAGAGAGAGAGACAGGG + Intronic
1091569958 12:1676407-1676429 AAAAAAAAGAGAGAGAGATTTGG - Intergenic
1091630641 12:2158009-2158031 AAAAATCAGAGATGGAAATTAGG + Intronic
1092035102 12:5327451-5327473 AAAAAAAAGAGAGTGACACTTGG - Intergenic
1092167483 12:6351638-6351660 AAAAAAAAAAGATTCAGAATAGG + Intronic
1092852904 12:12647201-12647223 AAAAAACAAAAACTGAGACTGGG + Intergenic
1092996139 12:13952768-13952790 AAAAAACAGAAATTAAAAGTGGG - Intronic
1093461100 12:19407595-19407617 AGAAAAAAGAGATGGAGGCTGGG - Intronic
1094268711 12:28587691-28587713 ATAAAACAGAGTTAGAGTCTAGG - Intergenic
1094293133 12:28874395-28874417 AAAAAGCAAAGATTGAGAGAGGG + Intergenic
1094408201 12:30141651-30141673 AAAAAAAAAACACTGAGACTGGG + Intergenic
1095139264 12:38641553-38641575 AAAAAAAAGAGAGAGAGATTTGG + Intergenic
1095157989 12:38881909-38881931 AAAAAAAAGAGACTGAGAGCAGG + Intronic
1095262834 12:40117151-40117173 TAAAAACAGAGCTTCAGCCTGGG + Intergenic
1095467008 12:42498141-42498163 GAAAAAAAGAAAATGAGACTAGG - Intronic
1095528167 12:43152870-43152892 AAAAAATAGAAATTTAGGCTGGG - Intergenic
1095756831 12:45777085-45777107 AAAAAATAGAGATGGAGGTTGGG - Intronic
1095816876 12:46432477-46432499 GAAAACCAGAGTTTGAGTCTAGG + Intergenic
1095818559 12:46451410-46451432 AAAAAAAAGAGAAAGAGACAAGG - Intergenic
1096258417 12:50076473-50076495 AAAAAACTGAGTTTGGGTCTTGG + Intronic
1096285836 12:50299297-50299319 AAAAAACAGAATTAGGGACTGGG - Intergenic
1096316256 12:50569050-50569072 GAAAAGCAGAGATTGTGATTAGG - Intronic
1096361336 12:50990309-50990331 ACAAAACAGAGGTGGAGAATAGG - Intronic
1096378303 12:51133299-51133321 AAAAAAGAGAGAGTGAAAATAGG - Intronic
1096526884 12:52215346-52215368 AAAAAAGAGAGAGAGAGATTGGG - Intergenic
1096736624 12:53660552-53660574 AAGAAACACAGATTAAGGCTGGG + Intronic
1096786978 12:54022507-54022529 AAAAGAGAGAGAGAGAGACTGGG - Intronic
1097032299 12:56098420-56098442 AAAAAAAAGAATTTGGGACTTGG + Intronic
1097306090 12:58070777-58070799 AAAAGACAGTGATTTAGAATGGG - Intergenic
1097483888 12:60168808-60168830 ACAAAATAGAGATTTAGACAAGG + Intergenic
1097639586 12:62163888-62163910 AAAACACAGAGATTGGGAGATGG + Intronic
1098152818 12:67565399-67565421 AAAAACCAGAGAATCAGACTGGG + Intergenic
1098212070 12:68177167-68177189 CAGAAACAGAGCTTGAGACAAGG + Intergenic
1098295539 12:69000580-69000602 AAAAAACAGAGAAAGAAACAAGG + Intergenic
1098568825 12:71966238-71966260 AAAAAAAAAAGATTTAGACAGGG - Intronic
1098903012 12:76132238-76132260 AAAGAAAAGAGATTTAGGCTGGG + Intergenic
1098953777 12:76668021-76668043 AAAAAAAAAAGATTGACAGTTGG - Intergenic
1098993179 12:77088817-77088839 AAAAAACAGAGAATAAGATAGGG - Intergenic
1099333682 12:81326157-81326179 TAAAAACAGACTTTAAGACTTGG - Intronic
1099462820 12:82944918-82944940 AAAGAACTGAGATTCACACTAGG + Intronic
1099610656 12:84864618-84864640 GAAACATAGAGATTAAGACTGGG - Intronic
1099711053 12:86224414-86224436 AAAAAAAAGGGATTTAAACTAGG + Intronic
1100272435 12:93039193-93039215 AGAAAAGAGAGATAGAGACGGGG + Intergenic
1100389618 12:94137076-94137098 AAAAACCAGACTTTGAGAATAGG - Intergenic
1100450243 12:94699031-94699053 AAAAAAAAGAGATGGTGAGTTGG - Intergenic
1100544173 12:95585812-95585834 AAAAAACAAATACTGAGGCTAGG - Intergenic
1100685668 12:96984089-96984111 AAAAAAGAGAGAGAGAGATTGGG + Intergenic
1100725394 12:97403137-97403159 AAAAGAGAGAGAGAGAGACTGGG + Intergenic
1100884307 12:99052751-99052773 AAAAAAAAGAAATAGAGACAAGG + Intronic
1101058064 12:100940180-100940202 AAAAAACAGAAAAAGAAACTTGG - Intronic
1101121314 12:101583623-101583645 AAAAAACAGAAATAAAGATTTGG - Intronic
1101169752 12:102078334-102078356 AAAAAAAAGATTTTGAGATTTGG + Intronic
1101245739 12:102883002-102883024 AAAGAACAGAGATTGGGATCAGG + Intronic
1101344127 12:103869606-103869628 AAAAAAGAGAGAGAGAGATTGGG - Intergenic
1101359957 12:104016958-104016980 AACAAACAGAGCTGGAGGCTTGG - Intronic
1101729781 12:107417375-107417397 GAGAAACAGAGAGAGAGACTGGG - Intronic
1101923683 12:108953814-108953836 ATAAAACAGATATTTAGGCTGGG + Intronic
1101953474 12:109194163-109194185 AAAAAACAGAGACAGAGACTGGG - Intronic
1102509665 12:113405772-113405794 AAAAAAGAGAGAGAGAGACAAGG + Intronic
1102770607 12:115472814-115472836 AAAAAAAAAAGATTTAGAATAGG + Intergenic
1102961290 12:117095024-117095046 AAAAAAAAGAGAGAGAGACAAGG + Intronic
1103116065 12:118333838-118333860 AAAAAAAAAAAATTGAGGCTGGG + Intronic
1103184773 12:118946880-118946902 AGAAAACAGAAAATGAAACTAGG + Intergenic
1103765976 12:123280056-123280078 TAAAAACAGAAATAGAGACCGGG - Intergenic
1103827915 12:123754912-123754934 AATAAACAGATATTCACACTTGG - Intronic
1103835630 12:123818240-123818262 AAAATAAAGAGATAGAGGCTGGG - Intronic
1104038137 12:125112686-125112708 AAAAAAGACATACTGAGACTGGG + Intronic
1104207674 12:126656018-126656040 AAAAAACAGAAAACGTGACTGGG - Intergenic
1105554032 13:21428512-21428534 AAAAAACATAGTTTGGGCCTGGG - Intronic
1105633619 13:22196492-22196514 AAAAAAGAGAGACTGAGACAGGG + Intergenic
1105638031 13:22235159-22235181 AAAACAGACGGATTGAGACTGGG + Intergenic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1107381494 13:39861492-39861514 AAAAGACAAAGAATGAGACCAGG + Intergenic
1107485756 13:40825831-40825853 AAAAAAAAAAAATTGAGACAGGG - Intergenic
1107618550 13:42199208-42199230 AAAAAAGAGAGAGAGAGAATTGG + Intronic
1107998578 13:45886302-45886324 AAAGAAAAGAGGTTTAGACTGGG + Intergenic
1108070463 13:46623857-46623879 AAAAAACAGAGATGGGGAGGGGG - Intronic
1108366318 13:49718132-49718154 CAAATACAGAGATTGAAACTCGG - Intronic
1108494630 13:51012358-51012380 AAAAAAAACAGAGTGAGATTGGG - Intergenic
1108539947 13:51432105-51432127 AAAATGCAGAGATTTAAACTGGG - Intronic
1108700041 13:52935999-52936021 AAGAATCAGAGATTGAAACAAGG + Intergenic
1108888616 13:55224419-55224441 AAAAAAGAGAGAGAGAGAGTGGG - Intergenic
1109320697 13:60805987-60806009 AAAATACAGATATTGGGAATAGG - Intergenic
1109351852 13:61192798-61192820 ATAAAGCAGAGAATGAGACAAGG + Intergenic
1109880359 13:68465749-68465771 CAAAAACAAAAATTGAGAATTGG - Intergenic
1109899713 13:68750924-68750946 AAAAAACTGAGCTTCAGATTAGG - Intergenic
1110150510 13:72247156-72247178 AAAAAACATAAATTGAGCCCTGG + Intergenic
1110311739 13:74057889-74057911 TGAAAACAGAGATAGAGACTTGG + Intronic
1110333511 13:74299844-74299866 AAGAAACAGAGCTAGAGGCTTGG - Intergenic
1110684997 13:78362241-78362263 AATAAAGAGAGAATGATACTTGG - Intergenic
1110920726 13:81081177-81081199 AAACAACAGAGAATAAGATTTGG + Intergenic
1111013990 13:82352672-82352694 AAAAAACAGAGATTGTCATTTGG - Intergenic
1111023686 13:82489986-82490008 TAAAAGAAGATATTGAGACTGGG - Intergenic
1111508342 13:89226161-89226183 AAAATACAGAGATTCAGAGCAGG + Intergenic
1111613022 13:90628757-90628779 CAAAAGCAGAGCTTGAGACAAGG - Intergenic
1111778804 13:92695495-92695517 AAAAAACAGATATAAATACTTGG - Intronic
1111987945 13:95083894-95083916 AGAAAACTGAGATTTAGAGTAGG + Intronic
1112191058 13:97178062-97178084 AATAAAAAGACATTGAGTCTTGG + Intergenic
1112224227 13:97522293-97522315 GAAAAACAGAGACAAAGACTAGG + Intergenic
1112524265 13:100128980-100129002 AGAAAACAGAGTTGGAGTCTAGG - Intronic
1112908407 13:104452529-104452551 GAGAGAGAGAGATTGAGACTTGG + Intergenic
1113747911 13:112758030-112758052 TAAAAACAAAGGTTGAGACTTGG - Intronic
1114283574 14:21218388-21218410 AAAAAACTAAAATTGAGGCTGGG + Intronic
1115109735 14:29807401-29807423 AAAAAAAAAAAATTGAGACAGGG + Intronic
1115230320 14:31153373-31153395 AAAAAAAAAAAATAGAGACTGGG + Intronic
1115355100 14:32438569-32438591 TAAAAGCAGAGATTGAAAATTGG + Intronic
1115443250 14:33460391-33460413 ATAAAACAGAGACAGAAACTTGG - Intronic
1115486144 14:33913304-33913326 AAAAAACAGAAATGAATACTGGG - Intergenic
1115826870 14:37288327-37288349 AAAAAAGAGAGATAGGGAGTGGG + Intronic
1115849435 14:37577810-37577832 AGAAAATAGAGATTGGGAATGGG + Intergenic
1116369470 14:44110771-44110793 AAAAAAAAGAGAGAGAGAATTGG - Intergenic
1116636646 14:47404499-47404521 AAAAAAAAAAAATTGAGACAGGG + Intronic
1116947801 14:50852476-50852498 AAAAAAAAAAGACTGAAACTTGG - Intergenic
1117268222 14:54113253-54113275 AAATACCTGAGACTGAGACTGGG - Intergenic
1117720849 14:58627508-58627530 TAAAAACAGAAACTGAGGCTGGG + Intergenic
1118023212 14:61740751-61740773 AAAGGACACAGATTTAGACTTGG + Exonic
1118565776 14:67139228-67139250 AAAAAAGAGAGAGAGAGACTAGG + Intronic
1118790665 14:69089311-69089333 AAAATACAGAGATTTATATTTGG - Intronic
1118858489 14:69642970-69642992 AAAAAACAGAGTTGGAAATTTGG - Intronic
1119339841 14:73867780-73867802 AAACAACGGTGATTCAGACTAGG - Intronic
1119358355 14:74026145-74026167 AAAAAAAAAAGAGAGAGACTGGG + Intronic
1119393665 14:74309547-74309569 AAAAAACACACAGTGAGGCTAGG + Intronic
1119524724 14:75313562-75313584 AAAGAACAGAGTATGAGGCTGGG + Intergenic
1119576539 14:75728410-75728432 AAGAAAGAGAGATAGAGATTTGG + Intronic
1119731237 14:76952606-76952628 AAAAAATATTCATTGAGACTGGG + Intergenic
1120032366 14:79656600-79656622 AAAAAAGAGAGAGAGAGAGTAGG - Intronic
1120116697 14:80626486-80626508 AAAAAAAAAAGAGTGAGACAGGG + Intronic
1120163833 14:81173086-81173108 AGAAAACAGGGATGGGGACTCGG - Intergenic
1120245729 14:82003994-82004016 AAAAAAAAAAAATTTAGACTGGG - Intergenic
1120384941 14:83832749-83832771 AACAAACAGACACTGAGATTTGG - Intergenic
1120452868 14:84692440-84692462 AGAATACAGAGATTTAGAATGGG + Intergenic
1120534528 14:85677479-85677501 AAGAAACAGAGATAGAGAGCTGG - Intergenic
1121207951 14:92185233-92185255 AAAAAATGTAGATTGAGACTGGG + Intergenic
1121284480 14:92724665-92724687 GACAAACAGAGATTGTGACTTGG + Intronic
1121754863 14:96393822-96393844 AAAAAACAGAGATTTAGGGTGGG + Intronic
1122357096 14:101129631-101129653 AAAAAATAGAAATTGACAATGGG + Intergenic
1122535748 14:102460988-102461010 AAAAAAAAAAAATTGAGGCTGGG - Intronic
1122882076 14:104694738-104694760 AACAAAGACAGATTGAGAGTGGG - Intronic
1124301123 15:28544855-28544877 AAAAAAAAGAGAGAGAGACCGGG + Intergenic
1124351639 15:28960163-28960185 AAAAAAGACACTTTGAGACTGGG + Intronic
1124892529 15:33746336-33746358 AAAGAACAGAAAGTGAGGCTGGG - Intronic
1124996314 15:34726440-34726462 AAAAAAGAGAGATTAAGAGATGG + Intergenic
1125094538 15:35835883-35835905 AAAAAACACAGATTTATAGTAGG + Intergenic
1125188645 15:36963386-36963408 AAAAAAAAAAGAGTGAAACTTGG + Intronic
1125366868 15:38926808-38926830 AAATAACAGAAACTGAGGCTGGG - Intergenic
1125421536 15:39509856-39509878 ACACAAAAGAGACTGAGACTTGG + Intergenic
1125653707 15:41338651-41338673 AAAAAAAAGAGAGAGAGACCAGG + Intronic
1125798856 15:42426404-42426426 AAAAAAAAGAGAGAGAGACAGGG + Intronic
1125929926 15:43593351-43593373 AAATAACAGGGCTTCAGACTTGG + Intronic
1125943094 15:43693183-43693205 AAATAACAGGGCTTCAGACTTGG + Intronic
1126469048 15:48987428-48987450 GAAATACAGAGATTGAGACTGGG + Intergenic
1126585479 15:50281795-50281817 AGAAAAAAGAGATATAGACTGGG + Intronic
1127266699 15:57367957-57367979 GAGAAGCAGAGATTGAGACCTGG - Intergenic
1127899830 15:63333008-63333030 ACATAACAGAGATGGAGACGTGG + Intronic
1128116664 15:65111778-65111800 AAAAAAAAGAGATATAGGCTGGG - Intronic
1128334332 15:66776432-66776454 CAAATACAGAGACTGAGGCTTGG + Intronic
1128729190 15:70009291-70009313 TAAATACACAGATTGAGGCTAGG + Intergenic
1128898866 15:71400840-71400862 AAAAAAAAGAACTTGAGCCTGGG + Intronic
1129285676 15:74522641-74522663 AAAAAAAAAAGAATGAGGCTGGG + Intergenic
1129381474 15:75170348-75170370 AAAAAACAGAGCTTGGGTCAAGG + Intergenic
1129746817 15:78027788-78027810 GAAAAAAAGAGATTAAAACTGGG - Intronic
1130205318 15:81870076-81870098 AAAAAAAAGAGATAGAGAATGGG - Intergenic
1130231667 15:82101932-82101954 AAAAAGAAGAGATTGAGAGTGGG + Intergenic
1130722972 15:86408086-86408108 GAGAAACAGAGATAGAGACAGGG - Intronic
1130740932 15:86599431-86599453 TAAAATAAGAGATTGAGACCAGG - Intronic
1131476715 15:92746250-92746272 AAAAAAAAAAGGTGGAGACTGGG - Intronic
1132139028 15:99374666-99374688 AAAAAAAAGAGATTGGAACAAGG - Intronic
1132526533 16:418735-418757 AAAAAGGAGACATTGAGGCTAGG + Intergenic
1133051911 16:3121798-3121820 AAAAAGCAGAGAATGGGAGTTGG - Intergenic
1133093669 16:3426115-3426137 AAAAATCAGATATTAAGACTTGG - Intronic
1133638434 16:7693401-7693423 AAAAAAAGGATACTGAGACTTGG - Intronic
1133646215 16:7767004-7767026 AAAAAATAGAGAGTGAGAAAGGG + Intergenic
1133794629 16:9035817-9035839 AAAAAAAAAAAATTGAGATTTGG + Intergenic
1133846982 16:9464189-9464211 TAAATACAAAAATTGAGACTAGG - Intergenic
1134610554 16:15605047-15605069 AAAAGACAGAGATTGTCACTTGG + Intronic
1134839714 16:17392009-17392031 GAAATAAAGACATTGAGACTGGG - Intronic
1135050920 16:19192426-19192448 AAAAAAAAGAAATGTAGACTGGG + Intronic
1135238751 16:20783802-20783824 AAAAAAAAAAAATTGAGACGGGG - Intronic
1135261083 16:20981436-20981458 AACAAACAGTGATTGAGCCTGGG + Intronic
1135777443 16:25269159-25269181 AAAAAAAAGCCATAGAGACTTGG + Intergenic
1135857309 16:26023739-26023761 GAAAATCAGAGATAAAGACTAGG - Intronic
1135890009 16:26348616-26348638 AAAAAAAAGAGAGAGAGATTAGG - Intergenic
1135938467 16:26800685-26800707 AAAAAACACAGAGTAAGGCTGGG - Intergenic
1136045632 16:27612767-27612789 AAAAAAAAGAAATGCAGACTTGG + Intronic
1136130011 16:28213968-28213990 AAAAAAAAGTGCTTGAGGCTGGG - Intergenic
1136458134 16:30394016-30394038 AAAAAAAAGAGAGAGAGAATGGG - Intronic
1136470810 16:30478777-30478799 CAGAAAAAGAGATTGGGACTAGG + Intronic
1136538187 16:30912801-30912823 AAAAAAAAGAGAGAGAGACAGGG + Intergenic
1137066421 16:35850114-35850136 AAAGAACAGAGATGGTGGCTTGG - Intergenic
1137492227 16:48942955-48942977 AAAAAACAGAGATGCAGTCTTGG + Intergenic
1137510078 16:49091518-49091540 AAAAAACCAAGAGTCAGACTTGG + Intergenic
1137517714 16:49162781-49162803 AAAACACCCAGATTGAGATTTGG + Intergenic
1137650073 16:50112269-50112291 AAAAAAAAGAGAGTGAAACCAGG + Intergenic
1138317462 16:56082494-56082516 AAATGACAGAGATTGGTACTGGG - Intergenic
1138398539 16:56727132-56727154 AAAACACAGGGACTGAGATTTGG + Intronic
1138694617 16:58800897-58800919 ATAAAACAGAGATTGTAACATGG - Intergenic
1139611041 16:68058914-68058936 AAAAAGCATAGATTGAGGCTGGG + Intronic
1139819006 16:69704964-69704986 AATAAACAGAGATTGTCTCTGGG - Intergenic
1139896530 16:70292144-70292166 AAAAAAAAGAGAGAGAGACAAGG - Intronic
1140710664 16:77674262-77674284 AAAAAAAAGAGTTTGAGGCCGGG + Intergenic
1141278235 16:82607123-82607145 AAAAAAAAGAGGGTGAAACTAGG + Intergenic
1141502842 16:84455663-84455685 AATAAACAAATATTGAGGCTAGG + Intronic
1141603634 16:85140903-85140925 AAAAAAAAGATATTCAGACCAGG - Intergenic
1141663680 16:85454795-85454817 AAGAAACAGAGAAGGAGACGTGG - Intergenic
1141819670 16:86436623-86436645 AAAAAAGAGAGAGAGAGACTAGG - Intergenic
1142551548 17:743596-743618 AAAAAAAAAAAATTGAGAGTGGG - Intergenic
1142689244 17:1595028-1595050 AAAAAAAAGAGAGAGAGACAAGG + Intronic
1142689284 17:1595288-1595310 AAAAAAGAGAGAGAGAGACAGGG + Intronic
1144158210 17:12529023-12529045 AAAATACAGAGATTGAGGCTGGG - Intergenic
1144571455 17:16402317-16402339 AAAAAAAAAAAATTGAGAGTTGG + Intergenic
1144607968 17:16684667-16684689 AAAAAAAAAAATTTGAGACTGGG + Intergenic
1144713003 17:17414706-17414728 ACAAAACAGAGATTTTGGCTCGG + Intergenic
1145046676 17:19623321-19623343 CAAACACAGAGATAGAAACTGGG - Intergenic
1145196868 17:20901520-20901542 AAAAAAAAAAATTTGAGACTCGG - Intergenic
1146197813 17:30828020-30828042 AAAAAAAAAAAATTAAGACTAGG - Intergenic
1146281654 17:31549164-31549186 GAAAAACAGAGAGGGAGCCTGGG - Intergenic
1146334001 17:31953701-31953723 AAAAAAAAAAAATTGAGGCTGGG - Intronic
1146543194 17:33715664-33715686 CAAAAACAGTGACTGAGATTCGG - Intronic
1146623119 17:34415626-34415648 AAAAAAGAGAGAGAGAGGCTGGG - Intergenic
1146801720 17:35829651-35829673 AAAAAAGAGAGAGAGAGACCTGG + Intronic
1146833768 17:36093171-36093193 AATAATAAGAGATAGAGACTAGG - Intergenic
1146848359 17:36200012-36200034 AATAATAAGAGATAGAGACTAGG - Intronic
1146946167 17:36875150-36875172 AAAATAAAGAGTCTGAGACTTGG + Intergenic
1146959288 17:36959146-36959168 AAAAAACAAACATACAGACTGGG + Intronic
1146993027 17:37292865-37292887 AAAAAAAAGAAATTGACTCTAGG + Intronic
1147041348 17:37721705-37721727 AAAAAAAAGAGAGAGAGATTTGG - Intronic
1147199001 17:38787020-38787042 AAAAGACAGAGAGGGAAACTTGG - Intronic
1147496974 17:40926092-40926114 AAAAAGCATTGCTTGAGACTAGG - Intronic
1147651810 17:42067075-42067097 AAAAAAAAGAGAGAGAGACAGGG + Intergenic
1147738660 17:42657372-42657394 AAAAAAAAAAGATTGTAACTTGG + Intergenic
1148233588 17:45952487-45952509 AAAAAATAAAAATTTAGACTGGG + Intronic
1148271295 17:46263867-46263889 AAAAAAAAGAGAGAGAGACAGGG + Intergenic
1148458725 17:47825331-47825353 AAAAAACAAAGAATCAGGCTGGG + Intronic
1148597188 17:48866127-48866149 AAAAAAAAGAGAGAGAGAGTTGG + Intronic
1148771350 17:50068795-50068817 AAAAAAGACTGATTGAGGCTGGG - Intronic
1148972774 17:51498786-51498808 GAGAAACAGAGATTGAGTCGGGG - Intergenic
1149301877 17:55312689-55312711 GAAAGACAGTGAGTGAGACTGGG + Intronic
1149587497 17:57802328-57802350 AAAACACAGAGGTGGAGAGTGGG - Intergenic
1149729829 17:58934104-58934126 AAAAAAGAGAGATGGAAACAGGG + Intronic
1149793244 17:59497434-59497456 AAAAAAAAGAGAGAGAGACTGGG - Intergenic
1149919654 17:60645056-60645078 AAGAAATAGAGATTGAGGCTGGG + Intronic
1151016440 17:70559133-70559155 AGAAAACAGATATTCAGATTCGG - Intergenic
1151030700 17:70734497-70734519 GAGAAACTGAGATTCAGACTAGG - Intergenic
1151137230 17:71958515-71958537 AATAATCAGAGACTGAAACTTGG + Intergenic
1152329899 17:79666589-79666611 AGAAAAGAGAGAATGAGGCTGGG + Intergenic
1152368925 17:79873048-79873070 AAATAACAGACTTGGAGACTTGG - Intergenic
1152620657 17:81362995-81363017 AAAAGAGAGAGAGAGAGACTGGG + Intergenic
1152664616 17:81560120-81560142 TAAAAACAAAGAGTGAGGCTGGG + Intronic
1152714940 17:81894701-81894723 AAAAAAAAGAAAATGAAACTGGG - Intronic
1153277565 18:3382766-3382788 AAAAATCAGGGATTCAGTCTAGG - Intergenic
1153344223 18:4008900-4008922 CAAAAACAAAGAGAGAGACTCGG - Intronic
1155052518 18:22161319-22161341 AAAAAACAGAGAGAGAGAATTGG - Intergenic
1155477200 18:26246831-26246853 AAAAAAAAAAGAATGAGATTAGG - Intronic
1155612112 18:27677438-27677460 AAACAGCAGAGATTGACTCTGGG - Intergenic
1156201189 18:34834198-34834220 AAAGAAAAGAGGTTGAGGCTGGG + Intronic
1156787795 18:40936740-40936762 AAAAGACAGAGAGAGAGAGTTGG - Intergenic
1157646259 18:49275702-49275724 AAAAAATAGAGATAGAGATAGGG - Intronic
1158083392 18:53621128-53621150 AAAAAAAAGAGAAAGAGACCAGG - Intergenic
1158290046 18:55930672-55930694 AAAAAAAAGAAAGTGAGATTTGG - Intergenic
1158460994 18:57645571-57645593 AAAAAAGGAAGATTGAGTCTGGG - Intergenic
1158504255 18:58032120-58032142 AAAAAAAAGAGAGAGAGACAGGG - Intergenic
1158575805 18:58636839-58636861 AAAAAAAAAAGATTGAGACAGGG - Intergenic
1158783358 18:60678679-60678701 AAAAAAGAGAGAGAGAGTCTAGG - Intergenic
1159052876 18:63437942-63437964 AAACAACAGAAATGGAGCCTGGG + Intergenic
1159629614 18:70734590-70734612 AAAAAACAGATATTATCACTAGG - Intergenic
1159755656 18:72360905-72360927 AATAAACACACATCGAGACTCGG + Intergenic
1160109641 18:76014047-76014069 TCAAAACAGAGATGGAAACTGGG + Intergenic
1160179703 18:76623657-76623679 AAGGCACAGAAATTGAGACTAGG + Intergenic
1160210213 18:76871452-76871474 CAAAAACAGAAATTGGGACAGGG - Intronic
1161390491 19:4017968-4017990 AAAATACAAAAAATGAGACTGGG - Intronic
1161638513 19:5404688-5404710 ACAAGACAGAGATAGAGACAGGG - Intergenic
1161704574 19:5813237-5813259 AAAAAAAACAGATGGAGGCTGGG + Intergenic
1161766248 19:6210657-6210679 AAAACACAGAGATTTGCACTGGG + Intergenic
1161791709 19:6364020-6364042 AAAAAAAAAAAATTAAGACTGGG - Intronic
1162025152 19:7889445-7889467 AAAAAAAAAAGATTGAGGCCAGG + Intronic
1162416092 19:10538520-10538542 AAAAAAAAGAGAGAGAGACGGGG - Intergenic
1162429150 19:10616747-10616769 AAAAAAAAAAAATAGAGACTGGG + Intronic
1162511034 19:11118598-11118620 AAAGAAAAGAGATTTAAACTGGG + Intronic
1162858083 19:13484447-13484469 AAGAAACAGAGATAGAGAGAGGG + Intronic
1163000283 19:14362832-14362854 ATAAAACAGAGACAGAGACATGG + Intergenic
1163101604 19:15100617-15100639 AAAAAAGAGAGAGAGAGACGGGG + Intergenic
1163224825 19:15951715-15951737 AAAATACAGAGATTGTCACAGGG - Intergenic
1163624110 19:18378762-18378784 AAAAAAAAGAGATGGGGTCTTGG + Intronic
1163925029 19:20332707-20332729 ATAAAATAGAGAATGAGGCTGGG - Intergenic
1164217814 19:23165434-23165456 AAAAAAAAGAGAGAGAGGCTGGG - Intergenic
1164284565 19:23801727-23801749 AAAGAAGAGAGATAGAGAGTGGG - Intronic
1164485391 19:28651492-28651514 CAGAAACAGAGACTGAGTCTGGG + Intergenic
1164970158 19:32525064-32525086 AGAAACAAGAGATTGAGGCTGGG + Intergenic
1165451075 19:35883441-35883463 AAAGAAGACAGATTGAGACCCGG + Intergenic
1165459057 19:35933554-35933576 AAAAAAAAGAGATGGGGGCTGGG + Intergenic
1165459133 19:35934012-35934034 AAAAAAAAGAGATGGGGGCTGGG + Intergenic
1165461674 19:35947498-35947520 AAAAAACAGAAAAGGAGCCTAGG + Intergenic
1165662981 19:37598337-37598359 AAAAATGAGACAGTGAGACTAGG - Intronic
1165732005 19:38151978-38152000 AAAAAATAGAGAATGCCACTGGG + Intronic
1165891113 19:39112756-39112778 AAGAAACAGAGATTCAGAGAGGG - Intergenic
1165957703 19:39511995-39512017 AAAAAAAAGAGCCTGAGACTGGG - Intergenic
1166082962 19:40456414-40456436 AAAAAACAAACATAGAGACAAGG - Intronic
1166299916 19:41907699-41907721 AAAGAACAGAGAGTGAGACTCGG - Intronic
1166460779 19:42986278-42986300 AAAAAAAACAGAGAGAGACTGGG - Intronic
1166478073 19:43146256-43146278 AAAAAAGAGAGTGAGAGACTGGG - Intronic
1166802806 19:45468648-45468670 CGAAGACAGATATTGAGACTCGG - Exonic
1166929574 19:46293871-46293893 AAAAAAAAGAGATAGAGGCCGGG + Intergenic
1167290612 19:48623251-48623273 AAAAAAAAGAGAGAGAGACGGGG + Intronic
1167940664 19:52943217-52943239 AAAAAAAAGAGAGAGAGACAAGG - Intronic
1168230647 19:55028837-55028859 GAAAAACAAAGGTTGAGGCTGGG + Intronic
1168576472 19:57515807-57515829 AAAAAACAAAAATGGGGACTAGG + Intronic
1202645618 1_KI270706v1_random:138018-138040 ATAAACCAAAGATTGAGAATGGG - Intergenic
925517697 2:4702960-4702982 AGAAAAGAGAACTTGAGACTCGG - Intergenic
925602397 2:5622016-5622038 AAAAGAGAGAGACTGAAACTCGG + Intergenic
925880409 2:8347508-8347530 AAAAAACAGAGATGAGGACTCGG + Intergenic
926297806 2:11581235-11581257 AAGAAACATTTATTGAGACTTGG - Intronic
926653996 2:15379182-15379204 AAAAAAAAGAGAGAGAGACAAGG - Intronic
927130963 2:20060098-20060120 AAGAAACTGAGATTCAGACAAGG - Intergenic
927526230 2:23743571-23743593 AAAAAAAAGAGAGAGAGAGTTGG + Intergenic
927621389 2:24663755-24663777 AATGACTAGAGATTGAGACTAGG - Intronic
928148999 2:28809947-28809969 AAAAAAAAAAGATTTACACTGGG + Intronic
928734572 2:34272256-34272278 AAAAAAAGGAGATTGGGACTAGG - Intergenic
928745538 2:34409781-34409803 AATAAACAGAGATTGATAGAAGG + Intergenic
928813235 2:35254794-35254816 ATAAAAAAGAGATGGAAACTTGG + Intergenic
929020928 2:37552442-37552464 ATGGAACAGATATTGAGACTCGG + Intergenic
929152770 2:38762218-38762240 AGAAAAAAGAAATTCAGACTTGG - Intronic
929245042 2:39692518-39692540 AAAAGACAGTGATTGATAGTTGG + Intronic
930023758 2:47017218-47017240 AAAAAAAAAAATTTGAGACTGGG + Intronic
931285311 2:60827281-60827303 AAAAAACAAAAAAAGAGACTAGG - Intergenic
931370513 2:61658378-61658400 AAAAAAAAAAGAGTGAAACTTGG - Intergenic
931408906 2:62009307-62009329 AAAAAAGAAAGAATAAGACTGGG + Intronic
931486920 2:62703346-62703368 AAAAAAAAAAGATTAATACTCGG + Intronic
931738811 2:65223257-65223279 AAGAAATAGAGATTGTGGCTGGG - Intergenic
933316867 2:80726312-80726334 AAAAGGCAGAGATTTATACTCGG + Intergenic
933929946 2:87139912-87139934 AAAAAAAAGAGATGGAGAAAGGG - Intergenic
934001279 2:87715697-87715719 AAAAAAAAGAGATGGAGAAAGGG - Intergenic
934092834 2:88568861-88568883 AAACTACAGTTATTGAGACTTGG + Intronic
935644741 2:105325013-105325035 ATAAAACAGAAATTTGGACTGGG + Intronic
936362993 2:111823503-111823525 AAAAAAAAGAGATGGAGAAAGGG + Intronic
936496420 2:113025856-113025878 AGAAAGCAGAGACTGAGACAAGG + Intronic
936826508 2:116588389-116588411 CAAAAACAAAGATTGACAATTGG + Intergenic
937036753 2:118788508-118788530 AAAAGACACAGAGTGACACTGGG - Intergenic
937619885 2:123973224-123973246 AAAAAAGAAAGGTTCAGACTGGG + Intergenic
937695065 2:124799851-124799873 AATAGACAGAAATAGAGACTAGG + Intronic
937862381 2:126721186-126721208 AAAAAGTAGCGATTGAGACAAGG + Intergenic
938044569 2:128106098-128106120 AAAAAAAAAAGATTCAGGCTGGG - Intronic
938667397 2:133552763-133552785 AAAAAAAAAAGATTGAGAAGCGG + Intronic
938939015 2:136152953-136152975 AAGAAAAAGAAATAGAGACTTGG - Intergenic
938941753 2:136175798-136175820 AAAAAACCCAGAGTGAGAATGGG - Intergenic
938991287 2:136632596-136632618 AAAAAACAGAGCCTGAGGCGAGG + Intergenic
939387252 2:141516676-141516698 AAAAAAGAGAGAGAGAGACAGGG - Intronic
939513050 2:143130707-143130729 GAAAAATAGAGATTAGGACTTGG + Intronic
939980657 2:148776842-148776864 AAAAAAAAGAGAGAGAGACAGGG - Intronic
940199269 2:151132137-151132159 AAAAAAGAGAGAGAGAGGCTGGG + Intergenic
940364984 2:152838429-152838451 AAAAAAAAGAGATTTCGGCTAGG + Intergenic
940413081 2:153388900-153388922 AAAAAACTGAGATGGAGCCTGGG + Intergenic
940454148 2:153874087-153874109 AAAAAACAGAGATTGCGGGAGGG - Intronic
940469804 2:154081852-154081874 ATAAAACAGTGCTTGAGCCTTGG + Intronic
940716504 2:157230996-157231018 AAAAAAAAGAGATTGACAAGGGG - Intergenic
941150582 2:161909289-161909311 AAAAAACAGAGATGGAAATGTGG - Intronic
941215085 2:162696650-162696672 AAAAAAAAAAGATTGATTCTAGG + Intronic
941255425 2:163224502-163224524 AAAAAAAAGAGAGAGAGACAGGG + Intergenic
941789425 2:169535152-169535174 AAAAAACAAACATTGAAGCTGGG - Intronic
941996766 2:171608569-171608591 AAAAAATAAAAATTGAGACAGGG - Intergenic
942015851 2:171814472-171814494 AAAAGAAAGAAATTGAGATTTGG - Intronic
942850074 2:180473896-180473918 AAAAAACATAGTTTGAGAAGTGG - Intergenic
943079316 2:183238586-183238608 AAAAAACAGGGAATGGGAATGGG - Intergenic
943211362 2:184971775-184971797 AAGACACAGTGAATGAGACTTGG - Intergenic
943551410 2:189344938-189344960 AAACACCAGAGGTTCAGACTAGG + Intergenic
943648059 2:190428966-190428988 AAATAAAAAAGATTGAGGCTGGG - Intronic
943711647 2:191103028-191103050 AAAAGAGAGAGGTTGTGACTAGG - Intronic
943715435 2:191146999-191147021 AAAAAACAGAAAATGAGTGTTGG + Intronic
943987154 2:194637868-194637890 AAAAAACAAAAATTGAGAAGGGG + Intergenic
944330720 2:198463121-198463143 AAAAAAAAAAGATTGGGACCAGG - Intronic
944822450 2:203444136-203444158 AAAAAAGAGAGAGAGAGGCTGGG + Exonic
945251865 2:207770818-207770840 AAGAAACCGAGACTGAGACTTGG + Intergenic
945448760 2:209969526-209969548 AAAAAACAGAGATGATGAATGGG - Intronic
945916487 2:215709923-215709945 AATAAAGAGAGATTCGGACTAGG - Intergenic
946525868 2:220519607-220519629 ATAAAACAGAGAGAGTGACTGGG + Intergenic
946590896 2:221246040-221246062 AAAAAAAAAAAATTGAGACAGGG - Intergenic
946927411 2:224639467-224639489 AAAAAAAAAAGATTGAGATGGGG - Intergenic
947023224 2:225707348-225707370 AAAAAAGAAAGAGAGAGACTTGG + Intergenic
947427550 2:229997586-229997608 AAAAAAAAGAGAGAGAGAATAGG + Intronic
947598555 2:231429945-231429967 AAAAAAAAGAGAGAGAGAGTTGG + Intergenic
947679748 2:232019543-232019565 AAAAAAAAGAGAGAGAGACAGGG - Intronic
947766883 2:232643643-232643665 AAAAAACACAGATGGACATTGGG - Intronic
947861744 2:233364814-233364836 AAAATACAGAGATTGTGAGATGG + Intronic
948117459 2:235504135-235504157 AAAAAAGAGAGTTCGAGGCTGGG - Intronic
948470574 2:238175106-238175128 AAAAAAGAGAGAATGAGAGATGG - Intronic
1168745267 20:233807-233829 AAAAGAGAGAGAGTGAGATTAGG + Intergenic
1168930813 20:1622479-1622501 AAATACCTGAGACTGAGACTGGG + Intergenic
1169369399 20:5016982-5017004 AAAAAAAAGAGAAGGAGACAGGG - Intergenic
1169386199 20:5151736-5151758 AAAAAAAAGACATGGAGTCTAGG - Intronic
1169534436 20:6522868-6522890 AGAGCAGAGAGATTGAGACTAGG + Intergenic
1169612161 20:7393734-7393756 TGAAAACAGACATTTAGACTGGG + Intergenic
1169865677 20:10197352-10197374 AAAAAACAAAAAATGAGTCTGGG + Intergenic
1170016103 20:11783944-11783966 AAGAAACAGAGCTTGAGATGGGG + Intergenic
1170275486 20:14582145-14582167 AAAAAGCAGAGCTTGAGATGAGG - Intronic
1170347931 20:15407467-15407489 CAAAACCAGACATTGAGACTAGG - Intronic
1170404091 20:16018435-16018457 AAAAAAGAGAGAGAGAGAATGGG - Intronic
1170404645 20:16023487-16023509 AAAAAAAAGAGATGGTGCCTTGG + Intronic
1170649895 20:18229631-18229653 AAAAAAAAAAGATTCAGAATGGG + Intergenic
1171815325 20:29781299-29781321 CAAAAAAAGAAAATGAGACTGGG + Intergenic
1172075079 20:32289908-32289930 AAAAAACAGAGACTTAGACAGGG - Intronic
1172116890 20:32578379-32578401 AAAAAACAGAGAACGAGGCTAGG - Intronic
1172343469 20:34178173-34178195 AAAAAAGAGAGAGAGAGACAGGG - Intergenic
1172468793 20:35175883-35175905 AAAAAACAGGGGGTGAGGCTGGG - Intronic
1174491468 20:50899795-50899817 AAAAAAAAAAGTTTAAGACTAGG + Intronic
1174630669 20:51954235-51954257 AAAAAAAAGAGAGAGAGACAAGG - Intergenic
1174799334 20:53550081-53550103 AAATACCTGAGACTGAGACTGGG + Intergenic
1174830965 20:53812021-53812043 AAAAATCAGAGATCCTGACTGGG + Intergenic
1174997867 20:55590771-55590793 AAAAAAATGTGATGGAGACTAGG - Intergenic
1175213852 20:57379258-57379280 AAAAAACAGGGCTGGAGAGTGGG - Intergenic
1175428232 20:58884104-58884126 GGAAAACTGAGATTTAGACTGGG - Intronic
1176515133 21:7778160-7778182 AGAAAATAGAGAATGAGATTAGG + Intergenic
1176606267 21:8834730-8834752 ATAAACCAAAGATTGAGAATGGG + Intergenic
1176877425 21:14146762-14146784 AAAAAAAAAAAATAGAGACTGGG - Intronic
1176944015 21:14956676-14956698 AAAAAAAAGAGATATATACTGGG + Intergenic
1177403896 21:20641292-20641314 AAAAAAGAAAGATTGTAACTTGG - Intergenic
1177738494 21:25122697-25122719 GTAAAACAAAAATTGAGACTAGG + Intergenic
1177989717 21:28022342-28022364 AATAAACAGATATAGAGAGTAGG + Intergenic
1178045129 21:28685099-28685121 AAAAAACAGAAATAGGGAATCGG + Intergenic
1178112536 21:29383303-29383325 AAAAAAAAAAAATTGAGACAAGG - Intronic
1178420140 21:32436862-32436884 ATAAAACATAGATTCAGGCTGGG + Intronic
1178587038 21:33879355-33879377 AAAAAAGAAAGATTGAGGCAGGG + Intronic
1178649161 21:34408172-34408194 AGAAAATAGAGAATGAGATTAGG + Intergenic
1178858637 21:36271191-36271213 AAAAAACAAAGAAAGAGTCTGGG - Intronic
1179133430 21:38660010-38660032 AAAAGACTGAGACTGAGAGTGGG + Intronic
1179240839 21:39590205-39590227 AAAAATCAGAGATTGTCAGTTGG + Intronic
1179316233 21:40246717-40246739 AAAAAGCTGAGATTTAAACTTGG - Intronic
1179944492 21:44662183-44662205 AAAAAACAGAGATTTTTAATTGG + Intronic
1180318770 22:11301866-11301888 CAAAAAAAGAAAATGAGACTGGG + Intergenic
1180336449 22:11580706-11580728 AAAAAAAAAAGTCTGAGACTGGG - Intergenic
1180356340 22:11844428-11844450 ATAAACCAAAGATTGAGAATGGG + Intergenic
1180381920 22:12147898-12147920 ATAAACCAAAGATTGAGAATGGG - Intergenic
1180890438 22:19284254-19284276 ATAAAGCAGTGAGTGAGACTGGG - Intronic
1181113326 22:20615006-20615028 AAAAAAGAGAGAGAGAGACGGGG + Intergenic
1181135193 22:20760657-20760679 AAAAAGGAGAGATGGAAACTGGG - Intronic
1181170763 22:21008509-21008531 AGAAAACAGAGGCTGAGGCTGGG - Intergenic
1181178383 22:21050790-21050812 AAAAAAAAAAAAGTGAGACTTGG + Intronic
1181347078 22:22227442-22227464 AAAAAAAAGAGAGAGAGGCTGGG - Intergenic
1181991042 22:26837114-26837136 AAAAGAGAGAGAGTGAGGCTGGG - Intergenic
1182099538 22:27648278-27648300 AAAAGACAAAGAGTGAGAGTTGG + Intergenic
1182699315 22:32221724-32221746 AAAAAAAAAACATTGATACTTGG - Intronic
1183034854 22:35133893-35133915 AGAAAACAGAGAGTGAGAGCAGG + Intergenic
1183212634 22:36460283-36460305 AAAAAAAGGAGAGAGAGACTTGG + Intergenic
1183476840 22:38040298-38040320 AAAAAAAAGAAATTGAGAAAAGG + Intronic
1183533444 22:38378608-38378630 AGAAAAGAGAGATTCAGATTTGG - Intronic
1184132456 22:42525161-42525183 AAAAAAGAAAAATTGAGGCTGGG - Intergenic
1184132827 22:42527923-42527945 AAAAAAAAAAAATTGAGACGTGG - Intergenic
1184156815 22:42673161-42673183 GAAAAAAAGAGATTGCGTCTGGG - Intergenic
949159704 3:866025-866047 AAAAAAAAGAAGTAGAGACTAGG + Intergenic
949604212 3:5635755-5635777 AAAAAAGAGAGAGAGAGACAAGG + Intergenic
949795143 3:7841794-7841816 AAAAAAGAGAGAGTGAGTCAAGG - Intergenic
949832516 3:8230672-8230694 AAATAACATAGATTGAGTTTTGG - Intergenic
950375250 3:12566188-12566210 AAATCACAGAGATTGAGTTTAGG - Intronic
950669476 3:14517480-14517502 AAAAAAAAGAGAGAGAGATTAGG - Intronic
950775121 3:15342667-15342689 AACATTTAGAGATTGAGACTTGG + Intergenic
951163177 3:19451474-19451496 AAAAAACTGCTATTGAGAGTAGG + Intronic
951175695 3:19596953-19596975 CAAAAACAAAAATTGAGAATGGG - Intergenic
951692186 3:25408082-25408104 CAGAAACAGACATTGAGACAAGG - Intronic
951778101 3:26332848-26332870 AAAAAAAAGAGATTTTGAGTAGG + Intergenic
951898701 3:27635433-27635455 AAAAAAAAGAAAATGATACTAGG + Intergenic
951977660 3:28530989-28531011 TAAAAACAGACATAGAGACCAGG + Intronic
951990636 3:28672440-28672462 AAAAAAAAGAGACAGAGACAAGG - Intergenic
952085985 3:29821751-29821773 CAAAAACCTAGAATGAGACTTGG - Intronic
952619445 3:35319765-35319787 AAGAAACAGAGGTGGAGAGTAGG + Intergenic
952693026 3:36232178-36232200 AAAAAAAAAAGATTAAGACATGG + Intergenic
952892203 3:38050924-38050946 AAAAAAGAGAGAGAGAGACATGG - Intronic
953392673 3:42542903-42542925 AGAAAACAGAGCCTGAGACAAGG + Intergenic
953663090 3:44905279-44905301 AAAAAAAAAAGTTTGAGGCTGGG - Intronic
953944329 3:47133347-47133369 AAAAAATAGAGATTTCCACTGGG - Intronic
953986307 3:47445864-47445886 AAAAAAAAAAAATTGAGACAGGG - Intronic
954429524 3:50462895-50462917 AAAAAAGAGAGAGGGAGGCTGGG + Intronic
954562482 3:51569675-51569697 AAAACAGAGAGAATTAGACTGGG - Intronic
954694265 3:52412207-52412229 AAAAAAAAGTGATAGAGCCTAGG + Intronic
954732283 3:52674492-52674514 AAAAAAGAGAGAGAGAGGCTGGG + Intronic
954805365 3:53216701-53216723 AAAAAAAAAAGCCTGAGACTGGG + Intergenic
955239877 3:57169011-57169033 AAAAAGAGGAGATGGAGACTGGG - Intronic
955264729 3:57431204-57431226 AAAAAACAGGGGTTGTCACTGGG - Intronic
955296932 3:57744428-57744450 AAAAAAAAGAAATAGAGGCTGGG + Intergenic
955501536 3:59589221-59589243 AAAAAAAAGAGAGAGAGAATGGG - Intergenic
955608759 3:60734658-60734680 AATATACAGAGATTGAGGCCAGG - Intronic
955959947 3:64330237-64330259 ACAAAACAGAGTTTGATACCTGG + Intronic
956013134 3:64852901-64852923 AAATAACAAAGAGTGAGATTAGG - Intergenic
956055011 3:65289470-65289492 GCAAAACAGACATGGAGACTGGG + Intergenic
956141643 3:66152461-66152483 GAGAAACAGAGCTGGAGACTTGG - Intronic
956208695 3:66780549-66780571 AGAAGTCAGAGAATGAGACTAGG - Intergenic
956241280 3:67133553-67133575 AAAAAAAAGAGAGAGAAACTTGG - Intergenic
956285099 3:67600205-67600227 AAAAAACATAGCTTCACACTTGG + Intronic
956435957 3:69234851-69234873 ATAAAACAGAGATTTTGGCTAGG + Intronic
956473607 3:69595379-69595401 AGAAAAGAGAGATAGAGTCTAGG + Intergenic
956539108 3:70314196-70314218 AAAATACTGAGATAGAGGCTAGG - Intergenic
956563359 3:70608439-70608461 CAAAAAAAGAGCTTTAGACTTGG - Intergenic
957352014 3:79036661-79036683 AAAAAAAAGAGATATTGACTGGG + Intronic
957396174 3:79641720-79641742 ACAAAGAAGAGATTGAGGCTAGG + Intronic
957466743 3:80603495-80603517 AAAAAAGAGAGAAAGAGTCTTGG + Intergenic
957667361 3:83250364-83250386 AAAAAAAAGACACTGAGATTTGG - Intergenic
958846589 3:99272409-99272431 TAAATACTGAGATTGAGATTTGG - Intergenic
958947816 3:100383531-100383553 AAAAAACAGAGAGAGAGACTGGG + Intronic
958973963 3:100644824-100644846 AAAAATAAAAGAATGAGACTAGG - Intronic
959596314 3:108132749-108132771 AAAGGACAGAGGTTGAGATTAGG + Intergenic
959782604 3:110254531-110254553 GAAAAACAAAAAGTGAGACTGGG - Intergenic
959883087 3:111468905-111468927 CAAAAACAAAAATTGACACTTGG - Intronic
959935496 3:112024142-112024164 AAAAGAAAGAAACTGAGACTGGG - Intergenic
960542593 3:118878314-118878336 AAAAAAAAGTAATTGAGACAGGG + Intergenic
960907293 3:122614131-122614153 ATAAAACTGAGATTCAGGCTGGG - Intronic
961147363 3:124605582-124605604 AAAAAAGAGAGAGAGAGAATAGG + Intronic
961211588 3:125129863-125129885 GAAAAACAGAGACAGAGACACGG + Intronic
961619939 3:128216233-128216255 AAAATAAACAAATTGAGACTCGG + Intronic
961852944 3:129840000-129840022 AAAAAACAGATTGTCAGACTGGG + Intronic
961867424 3:129963895-129963917 AGGAAAGAGAGATTGAGACGGGG - Intergenic
961903267 3:130236041-130236063 AAAATACAGAGTTTGGGTCTTGG + Intergenic
962093555 3:132270392-132270414 AAAAAACAGAGAGAGAGGCCCGG + Intronic
962186811 3:133269101-133269123 GAAAAACAAAGATTGACACATGG - Intronic
962791364 3:138814481-138814503 AAAAAAAAAAAATTGAGTCTTGG + Intronic
962888479 3:139650334-139650356 AAAATACATAGATTGGGAGTTGG + Intronic
962943908 3:140150337-140150359 AAAAATGAGAAACTGAGACTTGG - Intronic
963205605 3:142631079-142631101 AAAAGAATGAAATTGAGACTGGG + Intronic
963207477 3:142651493-142651515 AAAACAAAGAGATGGAGACAAGG + Intronic
964092684 3:152894795-152894817 AACAAGCAGACATTGACACTAGG - Intergenic
964321826 3:155506331-155506353 AAAAAAAAGAGAGTGAGAATGGG - Intronic
964352142 3:155813957-155813979 AAAAAAAAGAAATAGAGGCTGGG - Intergenic
964950947 3:162292275-162292297 AAAAAACAGAAATTGACAAGTGG - Intergenic
964999388 3:162933371-162933393 AAAAAACAGAGAGAGAAACAAGG - Intergenic
965128283 3:164658707-164658729 CAAAGAAAGAAATTGAGACTGGG + Intergenic
965382650 3:168009437-168009459 AAAAAAAAAAAATTGAGAATGGG + Exonic
965502304 3:169471285-169471307 AAAAAAGAGACATTGAGGCTGGG - Intronic
965508574 3:169543277-169543299 AAAAAAAAGTATTTGAGACTGGG + Intronic
965973350 3:174589504-174589526 AACAAACAGAAACTCAGACTTGG - Intronic
966020711 3:175205575-175205597 TAAAAACAAAGATTGATAGTTGG + Intronic
966086644 3:176076651-176076673 AAAAAAAAGAGAAAGAGAATAGG + Intergenic
966230882 3:177650515-177650537 ATAAAACACATTTTGAGACTTGG + Intergenic
966479159 3:180386002-180386024 AAAAAAAGGAGAGTGAGAATGGG + Intergenic
966546484 3:181155017-181155039 AAATAACAGAAATTTAGGCTAGG - Intergenic
966606921 3:181830760-181830782 AGAAAACAGAGATTGGGGCCAGG - Intergenic
966638044 3:182157384-182157406 ATAAACCAGAGGTTGAGACTGGG + Intergenic
967073489 3:185982119-185982141 AAAAAAAAGAGAGAGAGACAAGG - Intergenic
967502085 3:190209299-190209321 TAAAAACAAAGACTGAGATTGGG + Intergenic
967586287 3:191217908-191217930 AAAAAAAATAGAATGAGATTTGG + Intronic
967634587 3:191786211-191786233 AAAAAAGAGAAATGGATACTGGG - Intergenic
967718109 3:192787245-192787267 AAAAAAGAGAGAATAAGACATGG - Intergenic
967779758 3:193423847-193423869 AAAAAACAGACATTCAAATTGGG + Intronic
967790606 3:193544878-193544900 AAAAAACAGAAATTAAGCATAGG - Intronic
967969042 3:194985775-194985797 AAAAAACTGAGGTTGAAACGAGG - Intergenic
967998844 3:195187244-195187266 AAAAAAAAAAGATAGAGACGGGG + Intronic
968179309 3:196579979-196580001 AAAAGTCAGAGACAGAGACTGGG - Intronic
969051959 4:4379620-4379642 AAAAAACAAAGATAGTGACAGGG + Intronic
969820917 4:9719668-9719690 ATAAAACATAGATTCAGACTGGG + Intergenic
970241850 4:14017185-14017207 AAAGAAAAGAAATTGATACTGGG + Intergenic
970280609 4:14450648-14450670 AGAAAAAAGAAATTGAGGCTTGG + Intergenic
970294520 4:14614288-14614310 AAAAAACAGAGTTGCAGGCTGGG + Intergenic
970627192 4:17899743-17899765 AAAAAACAAGAATTGACACTTGG + Intronic
971033752 4:22669943-22669965 AGAAAAAAGAGATTAAGATTGGG - Intergenic
971662500 4:29437772-29437794 AAAAAAAAGAAATTGAGAGCTGG - Intergenic
971916701 4:32879248-32879270 AAAACACAGAGATAAGGACTAGG - Intergenic
972013052 4:34208231-34208253 AAAAAACAAAAGTTAAGACTAGG - Intergenic
972069303 4:34995405-34995427 AGAAATCAGAGAATGAGCCTCGG - Intergenic
972509476 4:39754030-39754052 AAAAAAAAGAGAGAGAGAGTGGG + Intronic
972767750 4:42167201-42167223 AAAAACCTGAGAATGAGACAGGG - Intergenic
973371840 4:49256436-49256458 ATAAACCAAAGATTGAGAGTGGG - Intergenic
973389164 4:49538881-49538903 ATAAACCAAAGATTGAGAGTGGG + Intergenic
973610142 4:52628462-52628484 AAAAAACAGAGAAAGAGAAGGGG + Intronic
974143358 4:57917375-57917397 ATAAAACAGAGGTTGAGACCTGG + Intergenic
974245853 4:59316424-59316446 AAAAAACGGAGATAGTGGCTGGG - Intergenic
974568871 4:63617421-63617443 AAAGCACAGATATTGAGACTGGG + Intergenic
974767275 4:66363171-66363193 AAATAAAAGGGAATGAGACTTGG + Intergenic
975343677 4:73269567-73269589 AAAAAAAAAAGATTGCGACCAGG + Intergenic
975394993 4:73864259-73864281 AAAATACAGAGCTTGAGTCATGG + Intergenic
975493583 4:75014355-75014377 AAAAGATAGACACTGAGACTGGG + Intronic
975591048 4:76000225-76000247 AAAATACAGATATTGAGAACTGG + Intergenic
976181597 4:82404737-82404759 AAAAAAAAAAGATAGGGACTGGG + Intergenic
976493560 4:85699593-85699615 AAAAAAAAAAAATTGAGACAGGG - Intronic
977317386 4:95467407-95467429 TAAAAACAGAGAGAGAGAATGGG + Intronic
977427571 4:96887858-96887880 AGAATACAGAGAATGAGACAAGG + Intergenic
977448268 4:97160065-97160087 GAAAAAGAGAGATGGAGAGTGGG - Intergenic
977636926 4:99309768-99309790 AGAGAACAGAAACTGAGACTCGG - Intronic
978173827 4:105706240-105706262 AAAAAAAAGAGATTGAAGTTGGG - Intronic
978858630 4:113422999-113423021 ACAAAACAGACATTATGACTAGG - Intergenic
979036175 4:115721451-115721473 AAAAAATAGAGAGAGAGGCTTGG + Intergenic
979341414 4:119528833-119528855 GAAAACCAGAGATTGAGTTTAGG - Intronic
980041704 4:127947589-127947611 AAAAAACAGAGAGAGAGAGAAGG + Intronic
980537519 4:134148142-134148164 GAAACACAGAGATTGATACTTGG + Intergenic
980620864 4:135301870-135301892 AAAAGACAGAGATACAGACAGGG + Intergenic
980940767 4:139272041-139272063 AAAAAACAGAGATTGAGACTAGG - Intronic
981542176 4:145857331-145857353 AAAAAAGAGTTAGTGAGACTTGG + Intronic
981723411 4:147824022-147824044 AAAAAACACAGATTCAGGCTGGG + Intronic
982321751 4:154084214-154084236 AAAAAACAGAGCCAGAAACTGGG + Intergenic
982567882 4:157009430-157009452 AAAAATCAGAGATAGAGAAATGG + Intergenic
982671481 4:158325081-158325103 AAAAAAAACAAATTTAGACTGGG + Intronic
983072709 4:163288870-163288892 AAAAAATAGAAATGAAGACTAGG + Intergenic
983225335 4:165081378-165081400 AAAAAAAAAAAATAGAGACTCGG - Intronic
983283179 4:165706894-165706916 AGAAATTAGAGATTGAGGCTGGG + Intergenic
983302455 4:165944740-165944762 AAAAAAATAAGATTGAAACTGGG + Intronic
983483927 4:168311079-168311101 AAAAAAGAGAGAAAGAGAATGGG + Intronic
983561137 4:169102903-169102925 AAAAAAAAAAGAATGTGACTGGG - Intronic
983720294 4:170843043-170843065 AAAAAACTGTGATTAATACTCGG + Intergenic
984367919 4:178822068-178822090 TAAAAACAGTTAATGAGACTAGG + Intergenic
984433292 4:179676152-179676174 AAAAAACATAAATTTAGGCTGGG - Intergenic
984868163 4:184300887-184300909 AAAACACAGACATTCAGGCTAGG + Intergenic
984871661 4:184330831-184330853 AAAAAAAAAAAAGTGAGACTGGG + Intergenic
985282017 4:188296956-188296978 AAAAAAAAGAGAGAGAGAATTGG + Intergenic
986466726 5:8033495-8033517 AAATCACAGAGCTTGAGGCTTGG - Intergenic
986963306 5:13241343-13241365 AAAGAACAGAGACTGACACAAGG + Intergenic
987910521 5:24138151-24138173 ATAAATCAGAAATTGAAACTAGG - Intronic
988882737 5:35521062-35521084 ACAAAACAGAAATTGAGACAAGG + Intergenic
989686399 5:44092756-44092778 AAAAAACAGACATTGAAATTAGG + Intergenic
990029533 5:51240287-51240309 AAGAATCAGAGTTTGAGTCTTGG + Intergenic
990170457 5:53042944-53042966 CAAAAATAGTGATTAAGACTTGG + Intronic
990190519 5:53254901-53254923 AAAAAAAAAAGGTTGAGATTTGG - Intergenic
990274861 5:54184467-54184489 AAAAGAGAGAGAGAGAGACTAGG + Intronic
990362362 5:55033479-55033501 ACAAAACAGAGATATAGACATGG + Intronic
990697755 5:58440657-58440679 CAAAAACAGAAATGAAGACTGGG - Intergenic
990799204 5:59580640-59580662 AAAAAATAGAGAGAGAGACAGGG + Intronic
991484447 5:67120019-67120041 AGAAAACAGACTTCGAGACTGGG - Intronic
991539953 5:67716637-67716659 AAAAAAAAGAGAGAGAGAGTAGG + Intergenic
992047714 5:72912510-72912532 AAAAAACAAAGAATGTAACTAGG - Exonic
992243786 5:74796697-74796719 AAAAAAAAAAGATTCAGGCTGGG - Intronic
992585838 5:78238866-78238888 AAAAGGCAGAGATTGACACACGG + Intronic
992686003 5:79200117-79200139 AAAAAAGAGAGAGAGAGACAAGG + Intronic
992855569 5:80857570-80857592 AAAAAACAGAAATTCTGAATAGG - Intronic
992883304 5:81131648-81131670 AAGAAAAAGAGATTGAGGCCAGG - Intronic
993208480 5:84918047-84918069 AAAAAACAGAAATTGACAAATGG + Intergenic
993400746 5:87447408-87447430 AAAAAACAGAGATAAATATTTGG - Intergenic
993626729 5:90234451-90234473 AAAAAACAAATCTTGAGGCTTGG - Intergenic
993917475 5:93760881-93760903 TAAAAACAAAGATAGATACTGGG + Intronic
994034803 5:95186167-95186189 AAAAAAAAGATATTCAGACTGGG + Intronic
994105633 5:95945440-95945462 AAAATAGGGAGATTGAGTCTTGG - Intronic
995256360 5:110051212-110051234 AGAAAAAAGAAATTGACACTGGG - Intergenic
995357687 5:111258208-111258230 TAAAAAAAGACATTCAGACTAGG - Intronic
995465048 5:112442915-112442937 AAACAACAGAGATTTAAACAAGG - Intergenic
995951445 5:117719288-117719310 TACAAACAGAGAATGAGAATTGG - Intergenic
996447007 5:123566613-123566635 AACAAACAGAGGTTGAGGCAGGG - Intronic
996498743 5:124192365-124192387 AAAAAAAAAAAACTGAGACTGGG + Intergenic
996850261 5:127943604-127943626 AAAATAAAGAGATGGAAACTCGG - Intergenic
997050886 5:130378300-130378322 AAAAGACAGAGATTGAGTCAGGG - Intergenic
997280337 5:132639540-132639562 AAAATACAGAGTTTGAAACATGG + Intronic
998209050 5:140179956-140179978 AGAAAAAAGAGAGTGAGGCTGGG - Intronic
998384895 5:141751383-141751405 AAAAAACTGAGACTCAGACTGGG - Intergenic
998682940 5:144490345-144490367 AAAAAGGAGAGATTGAGACAAGG + Intergenic
998701507 5:144706550-144706572 AAAATACAGAGGTTAAGAATAGG + Intergenic
998807669 5:145934874-145934896 AAAAAAAAGAGAAAGAAACTGGG - Intergenic
999466937 5:151816248-151816270 AAAAAAAGAAGAGTGAGACTTGG - Intergenic
999672763 5:153972125-153972147 AAAAAAAAAACATAGAGACTAGG + Intergenic
999847095 5:155495199-155495221 AAAAAAGAGAGAGAGAGCCTTGG - Intergenic
1000094674 5:157960823-157960845 TAAAAAGAGAGATTCAGGCTGGG - Intergenic
1000251344 5:159498519-159498541 AAAAAAGAGAGAGCGAAACTAGG + Intergenic
1000600650 5:163271002-163271024 AAAAAACAGAAGTTGGGGCTTGG - Intergenic
1000726836 5:164782340-164782362 ACAAGAAAGAGATTGAGGCTGGG - Intergenic
1000791898 5:165618407-165618429 ACAATACAGCAATTGAGACTTGG - Intergenic
1001076045 5:168628846-168628868 AGAAGAGAGAGATTGAGATTGGG + Intergenic
1001142747 5:169158985-169159007 AAAAAACAGAGACTGAGGCCGGG + Intronic
1001142765 5:169159087-169159109 AAAAAACAGAGACTGAGGCTGGG + Intronic
1001345676 5:170896335-170896357 AAAGAACAGAGAATTAGACATGG + Intronic
1003048256 6:2755735-2755757 ACAAAAAAGAGAGAGAGACTAGG - Intergenic
1003083421 6:3041063-3041085 AAAAAACAAAGATTAACATTGGG - Intergenic
1003221476 6:4164601-4164623 AATAAACAGAGATTTGGCCTTGG - Intergenic
1003256312 6:4478062-4478084 AGAAAACAGAGAATGAGAAAAGG + Intergenic
1003374642 6:5564506-5564528 TAAAAACAATGAATGAGACTAGG + Intronic
1003684498 6:8287775-8287797 AAAAAAGAAAAATTGAGGCTTGG - Intergenic
1004008824 6:11661547-11661569 AAAAAACTAAGATTGAGGCCGGG - Intergenic
1004029659 6:11853965-11853987 AAAAAAGAGACATTGAACCTTGG - Intergenic
1004197015 6:13514311-13514333 CTAAAACAGAGATTGAAAGTCGG + Intergenic
1004927710 6:20431749-20431771 CAAAAACAGAGGCTGAGACAAGG - Intronic
1005110526 6:22276534-22276556 AAAAAAAAGAGAGAGAAACTAGG - Intergenic
1005116899 6:22348976-22348998 AAAAAAAAGAGATGGAGTCTTGG + Intergenic
1005166720 6:22931142-22931164 AAAATACAGAAGTTGAGGCTGGG - Intergenic
1005241377 6:23833445-23833467 AAAAGCCAGAAATTAAGACTCGG + Intergenic
1005270926 6:24162626-24162648 ATAAAAGAAAGACTGAGACTTGG + Intergenic
1005352961 6:24954441-24954463 AAAAAAAGGAGAGAGAGACTGGG - Intronic
1005816994 6:29561452-29561474 AAAAAAGTCAGATTGACACTGGG - Intronic
1006206019 6:32343644-32343666 AGAAAACCGAGATTGAGAAAGGG + Intronic
1006621087 6:35364697-35364719 AAAAAACAAAGAGTAACACTTGG - Intronic
1006849633 6:37088649-37088671 AAAAAAGAGAGAGAGAGACAAGG + Intergenic
1007027359 6:38589930-38589952 AAAAAACAAAGTCTGAAACTTGG - Intronic
1007184843 6:39960925-39960947 AGAAAGCAGAGCTTGAGACAAGG + Intergenic
1007321715 6:41032765-41032787 AAAAAAAAGAGAGAGAGACTTGG + Intronic
1007499885 6:42288589-42288611 AAAAAAAAGAGAGAGAGACGGGG + Intronic
1007542541 6:42661290-42661312 AAAAAAAAGATATTTAAACTAGG + Intronic
1008095797 6:47338084-47338106 AATGAACAGGGTTTGAGACTGGG + Intergenic
1008101735 6:47398921-47398943 CAAAAACACAAAGTGAGACTTGG + Intergenic
1008655695 6:53611274-53611296 AAGAAACACAAATTGAGTCTAGG + Intronic
1008772653 6:54997934-54997956 AAATAATAGAGGTTGAGAATTGG - Intergenic
1008917214 6:56801260-56801282 GAAAAACAGCCTTTGAGACTGGG - Intronic
1008948922 6:57132814-57132836 AAAAAAAAGAGAATGCTACTTGG + Intronic
1009372716 6:62927365-62927387 TAGAAACAGAGATTGAGACTAGG + Intergenic
1009755874 6:67939625-67939647 ACAAAATAGAGAGAGAGACTTGG + Intergenic
1010600352 6:77817611-77817633 AAAAAATACAAATTGAGAGTAGG - Intronic
1011101840 6:83730583-83730605 AAAAAAAAAAGATAGACACTTGG - Intergenic
1011115743 6:83889673-83889695 AAATACCTGAGACTGAGACTAGG + Intronic
1011252027 6:85381568-85381590 AAAAAAGAGAGAATGAAACTTGG + Intergenic
1011346381 6:86373779-86373801 AAAAGACAGAGATTGAAAAATGG - Intergenic
1012007035 6:93726146-93726168 AAAAAACACAGGGTGAGACTGGG + Intergenic
1012033252 6:94099814-94099836 AAAAAACACAGGATGAGTCTGGG - Intergenic
1012079194 6:94734623-94734645 ATGAAATAGATATTGAGACTAGG + Intergenic
1012180620 6:96148042-96148064 AAAAAAAAAATATTGAAACTGGG + Intronic
1012210544 6:96513024-96513046 AGAAAACATACATTGGGACTGGG - Intergenic
1012949889 6:105506546-105506568 AAAAAACAGAGCTTGTCAATCGG - Intergenic
1012967031 6:105686194-105686216 AAAGAAAAGAGATTTAGGCTGGG - Intergenic
1013034320 6:106365459-106365481 AAAAAACATAAATAGAGACAGGG + Intergenic
1013145463 6:107386388-107386410 AAAAAACAAAAATTGACAATTGG + Intronic
1013261357 6:108446475-108446497 AAAAAAGAGAGAGAGAGAGTTGG - Intronic
1013571414 6:111430091-111430113 AAAGAAGCGAGATTGAGACGGGG + Intronic
1013628710 6:111963584-111963606 AAAAAACAAAAATTGACAATTGG - Intergenic
1013700990 6:112769376-112769398 AAATAACAGTGACTGGGACTAGG - Intergenic
1014244949 6:119058159-119058181 AAAAAAGAGAGAAGGAGAATTGG - Intronic
1014578741 6:123108007-123108029 AAATATCTGAGACTGAGACTGGG + Intergenic
1014593183 6:123298170-123298192 AAAAACCGGGGATTGGGACTAGG + Intronic
1014593324 6:123299826-123299848 GAAAAAAGGAGATTGAGAATAGG + Intronic
1014706303 6:124751681-124751703 AAAAGACAGAGATTTAGGCCAGG + Intronic
1014903210 6:126993940-126993962 ATAAAAAAGAGATGGAGACTAGG + Intergenic
1015017669 6:128433810-128433832 AAAAAACAGTGTTAGAGGCTGGG - Intronic
1015188807 6:130450248-130450270 AAAAACCAGCGATGGAGACTGGG - Intergenic
1015253621 6:131153139-131153161 AAAAAAGAGAGAGAGAGATTGGG + Intronic
1015287092 6:131498096-131498118 AAAAAACAGAGATTAACACAAGG + Intergenic
1015424899 6:133054224-133054246 AAAAAACACAGCCTGGGACTGGG + Intergenic
1015426273 6:133071743-133071765 AAAAAAAAAAGATAGAGACCAGG - Intergenic
1015481496 6:133715951-133715973 TTAAAAAAGATATTGAGACTAGG - Intergenic
1015579413 6:134707259-134707281 AAAAAACAGAGAGAGAGGCAAGG - Intergenic
1015640366 6:135325653-135325675 GAAGGAAAGAGATTGAGACTGGG - Intronic
1015654359 6:135499836-135499858 AAAAGGTAGAGAATGAGACTAGG + Intergenic
1015890087 6:137961776-137961798 AAAAAACAAAGATTTAGAAGAGG - Intergenic
1015980113 6:138830017-138830039 AAAACACAGAAATTTAGGCTGGG - Intronic
1016181216 6:141150285-141150307 AAAAAACAATTAATGAGACTAGG + Intergenic
1016311237 6:142735926-142735948 AAAAAACAAAGAAAAAGACTGGG - Intergenic
1017063590 6:150508312-150508334 AAAAAAAAGAGAGAGAGAATCGG - Intergenic
1017904101 6:158744210-158744232 AAAAAACAGCAACTGAGACCAGG - Intronic
1018063256 6:160107020-160107042 AAAAAAAAGGGATGGAGAATAGG - Intronic
1018133637 6:160756704-160756726 AAGAAAGAGAGATTGAGTTTTGG - Intergenic
1018869340 6:167769283-167769305 ATAAAACAGAGAGGGAGGCTGGG - Intergenic
1019331425 7:462581-462603 AAAAAACAAAGATTGAGGGTGGG - Intergenic
1019945937 7:4329306-4329328 AAGAAAAAGAGATAGAGACTTGG + Intergenic
1020073376 7:5241901-5241923 AAAAAAGAAAGAATGAGGCTGGG - Intergenic
1020368060 7:7401455-7401477 AGAAATCAGAAATTCAGACTTGG - Intronic
1020435449 7:8157685-8157707 AAAAAAAAAAAATTAAGACTAGG - Intronic
1020472108 7:8549598-8549620 AAAAAGCAGAGATTAATATTGGG - Intronic
1021279296 7:18697447-18697469 AAGAAAGAGAGATTGAGACTAGG - Intronic
1021330853 7:19337874-19337896 AAAAAAGAGAGATAGAGAAAGGG - Intergenic
1021560755 7:21966679-21966701 AAAAAAGAGAGAGAGAGACCAGG + Intergenic
1021613803 7:22482214-22482236 CAGAAGCAGAGCTTGAGACTGGG + Intronic
1021860527 7:24901357-24901379 AAAAAAAAGAGAGAGAGAGTTGG + Intronic
1021973723 7:25990529-25990551 AAAAAACTGAGTATCAGACTGGG - Intergenic
1022036454 7:26539034-26539056 AAAGAACAAAGAATGAGACGTGG + Intergenic
1022830399 7:34059753-34059775 AAAAAAAAGAGATAGAGAGGAGG + Intronic
1023128341 7:36977119-36977141 AAAGGACAGAGACTGAGAATTGG + Intronic
1024701093 7:51905081-51905103 AAACAAAAGAGATTGAGAAAGGG + Intergenic
1024929027 7:54650409-54650431 AGAAGAAATAGATTGAGACTAGG + Intergenic
1025228051 7:57180590-57180612 AAAATACAAAAATTAAGACTAGG + Intergenic
1025565841 7:62433115-62433137 AAGAAAGAGAGATAGAGACAAGG + Intergenic
1026328006 7:69327632-69327654 TAAAAGCAGAGATTGTGGCTGGG + Intergenic
1026517856 7:71088099-71088121 GAAAAACAGAGCTTGTGCCTGGG - Intergenic
1026633057 7:72054927-72054949 AACACACAGAGCTAGAGACTGGG + Intronic
1026933853 7:74240519-74240541 AAAAGAGAGAGAGAGAGACTTGG + Intronic
1027179445 7:75927947-75927969 AGAAACCTGAGATAGAGACTGGG - Intronic
1027306405 7:76902421-76902443 AATAAAGAGATATTGTGACTTGG + Intergenic
1027640714 7:80730275-80730297 AAAAATCAGTGGTTAAGACTAGG - Intergenic
1027760826 7:82277039-82277061 AAAAAAGAGAAATGGAGGCTGGG - Intronic
1028045900 7:86118532-86118554 AAAAAACAGAGAAAGAGGCTGGG + Intergenic
1028202596 7:87979455-87979477 ATGAAACAGAGAAGGAGACTAGG - Intronic
1029445625 7:100611238-100611260 AGAAAACAGACTTTGAGCCTGGG + Intergenic
1029888201 7:103896572-103896594 ACAAAACAGAGATTGCCTCTGGG + Intronic
1030022641 7:105291058-105291080 AAAAAAAAGAAATGAAGACTGGG + Intronic
1030170860 7:106601482-106601504 AGAAAAGAGAGATTGAGTATAGG - Intergenic
1030811543 7:113978572-113978594 AAAAAAAACAGATTGACTCTGGG - Intronic
1030984476 7:116224984-116225006 ATAAAAAGGAAATTGAGACTTGG - Intronic
1031606355 7:123772609-123772631 AAAAAACTGAGACCGAAACTAGG + Intergenic
1031662742 7:124446655-124446677 AAAAGACAGAGATTGATACATGG + Intergenic
1031781467 7:125972530-125972552 AAAAAAAAGAGAGTGACATTTGG - Intergenic
1031803382 7:126276653-126276675 AAATACCAGAGACAGAGACTGGG + Intergenic
1031867599 7:127055349-127055371 AAATAAAGGAGATTGTGACTTGG + Intronic
1031907789 7:127480028-127480050 AAAAAATACTGATTGGGACTGGG + Intergenic
1032354658 7:131199261-131199283 AAAAAAAAAAGATAGAGACAGGG + Intronic
1032413066 7:131714159-131714181 AAAAAAAAAAGATATAGACTGGG + Intergenic
1033115392 7:138620415-138620437 AAGAAACAGAAATCCAGACTGGG - Intronic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033471028 7:141649102-141649124 AAAAAAAAAAGATTGAAAATAGG + Intronic
1034402644 7:150875550-150875572 AAACAACAGAGATGGAGAAAAGG + Intergenic
1034530623 7:151694167-151694189 AAAGAACAGAAATTGTGGCTGGG - Intronic
1034888487 7:154818191-154818213 AAGAGACGCAGATTGAGACTCGG + Intronic
1035840381 8:2805568-2805590 AAAAAAAAGGAATTGAGAGTGGG + Intergenic
1036218432 8:6900357-6900379 AAATACCTGAGACTGAGACTGGG - Intergenic
1036510947 8:9399648-9399670 AAAAAACAGAAAATGAGTGTTGG + Intergenic
1036710272 8:11074015-11074037 AAAAAGCAGAGAGAGAGATTTGG + Intronic
1038338432 8:26663696-26663718 AACATACAGAGTTTGAGAGTGGG - Intergenic
1038464187 8:27744988-27745010 AAAAAGCTGTGATAGAGACTGGG - Intronic
1038792600 8:30681534-30681556 AAAAAAAAGAAAATGATACTCGG + Intronic
1039891605 8:41689481-41689503 AGAAAAGAGAGATTGAGCCATGG + Intronic
1039985345 8:42442915-42442937 AAAAAACAGATATTTACATTTGG - Intronic
1040082409 8:43300761-43300783 AAAAAACAGTTATTTAGACTGGG + Intergenic
1041283772 8:56238862-56238884 AAAAAACAGAAGTAGAGATTTGG - Intergenic
1041329319 8:56706784-56706806 AAAAAAAAGAAATTGAAATTGGG + Intergenic
1041511892 8:58661751-58661773 AAAAAAAAAACATTGAGTCTGGG + Intergenic
1041555686 8:59152325-59152347 AAAAAGAAGAAATTGAGTCTTGG - Intergenic
1042315821 8:67424785-67424807 AAAAAACAGAAAAAGAGGCTAGG - Intronic
1042550978 8:69993919-69993941 AAAAAACAAAAATTAAGACCGGG - Intergenic
1042552123 8:70003425-70003447 AAAAAAAAAAAATTGAGGCTGGG - Intergenic
1042602302 8:70510801-70510823 AAAAAAGAGAGAGAGAGACGAGG - Intergenic
1042810093 8:72815592-72815614 AACAAACAGGGACCGAGACTAGG + Intronic
1042934170 8:74042217-74042239 AACTAACAGAATTTGAGACTGGG + Intergenic
1043357708 8:79432594-79432616 AAAAAAAAGAACTTGAGACCTGG - Intergenic
1043359075 8:79449625-79449647 AAAAAACATAGATTGACAATAGG - Intergenic
1043453608 8:80392634-80392656 AAAAAAAAGACATTCAGAGTGGG + Intergenic
1043694102 8:83198118-83198140 AAAGAACTGAGATTGAATCTTGG - Intergenic
1043822047 8:84878795-84878817 AAAAAACAGAAATGGAAAATAGG + Intronic
1044163455 8:88949526-88949548 TAGAAACATATATTGAGACTGGG - Intergenic
1044327849 8:90880537-90880559 AAAAAAAAAAGATTGTGACAGGG + Intronic
1045116744 8:98991000-98991022 AAAAAAAAAAAATTGAGACAGGG - Intergenic
1045306158 8:100958171-100958193 AAAAAAAAGAGAGAGAGACAGGG - Intergenic
1045683524 8:104688020-104688042 AGAAAACAGACATTGGGAATTGG - Intronic
1045698869 8:104842717-104842739 CAAAAACAAAAATTGACACTAGG - Intronic
1045850613 8:106693412-106693434 AAAAAAAAAAGATTCTGACTAGG - Intronic
1046283403 8:112063202-112063224 AAAAAACAGAGTTTGAATTTGGG - Intergenic
1046309600 8:112416811-112416833 AAAAAACTGAGACTTAGACTGGG + Intronic
1046367535 8:113255226-113255248 TAAAACTAGACATTGAGACTAGG + Intronic
1046409473 8:113820589-113820611 CAAAAACAGAAATTGACATTTGG + Intergenic
1046704357 8:117434180-117434202 AAAAAAGTCAGATTGAGAATGGG + Intergenic
1047018000 8:120744111-120744133 AAAAAAAAAAAATTGAGACAGGG - Intronic
1048116858 8:131532931-131532953 AATAAAGACATATTGAGACTGGG - Intergenic
1048470821 8:134702651-134702673 AAAAAAAAGAAATAGAGATTTGG - Intronic
1048533279 8:135270301-135270323 AAATCACAGCGATTGAGAGTGGG + Intergenic
1048631879 8:136252139-136252161 AAAAAGGAGAGACTGAGACATGG + Intergenic
1049142824 8:140972558-140972580 TAAAAACAGTAATTGAGGCTGGG - Intronic
1049366581 8:142240044-142240066 AAAAGACAGGGATTGACACATGG + Intronic
1050020461 9:1279428-1279450 AAAAAAGAGAGAGAGAGACATGG - Intergenic
1050429099 9:5543691-5543713 GAAAAAAAGACACTGAGACTTGG - Intronic
1051037556 9:12766893-12766915 AAAAATCAGAGACGGAGAATGGG + Intergenic
1051227342 9:14914710-14914732 AAAAAACAGAAATTGGGAGAAGG + Intergenic
1051228848 9:14932235-14932257 TAAAAACATACATTGAGGCTGGG - Intergenic
1051916219 9:22211058-22211080 GAAAAACTGAGATTTAAACTCGG + Intergenic
1051920849 9:22261394-22261416 AAAAAAAAAAACTTGAGACTAGG - Intergenic
1052646544 9:31243012-31243034 AAAAAGGAGACATTGAGACAAGG + Intergenic
1052685691 9:31752677-31752699 AAAAAAAAAAGATGGAGGCTGGG - Intergenic
1052933521 9:34074969-34074991 AAAAAAAAAAGAATGAGGCTGGG - Intergenic
1052933571 9:34075292-34075314 AAAAAAGAAAGAATGAGGCTGGG - Intergenic
1053065515 9:35066133-35066155 AAAGAAAAGAAAATGAGACTAGG + Intronic
1053390191 9:37729400-37729422 AAAAAAAAAAGATAGAGACTGGG + Intronic
1054776327 9:69127058-69127080 AAAAAAGAGAGAGAGAGACAGGG - Intronic
1055709117 9:79039240-79039262 ACAAGAGAGAGATAGAGACTGGG - Intergenic
1056528170 9:87463317-87463339 AAAAAAAGCAGATGGAGACTAGG + Intergenic
1056544775 9:87604567-87604589 AAAAACGAGGGATTGAGACCAGG - Intronic
1056748184 9:89323396-89323418 AAGAGACAGAGATAGAGCCTTGG + Intronic
1056892391 9:90507542-90507564 AGAAAACTGAGATTCAGAATGGG + Intergenic
1057061736 9:92010095-92010117 AAAATACAAAAATTGAGGCTGGG + Intergenic
1057074489 9:92130208-92130230 AAAAAACAGCCATTGAGGCAAGG - Intergenic
1057084805 9:92199396-92199418 AAAAAACAGCCATTGAGGCAAGG + Intergenic
1057558221 9:96106031-96106053 AAAAAAAAAAAATTGAGACAGGG + Intergenic
1057790780 9:98123481-98123503 AAAAAAAAGAGAGAGAGAATAGG - Exonic
1057816488 9:98299728-98299750 CAGAAAAAGAAATTGAGACTGGG - Intronic
1058023846 9:100118502-100118524 AAAAAACAAAAATTGGGGCTGGG - Intronic
1058053812 9:100430337-100430359 AAAAAAGAGAGATTGAAAATGGG + Intronic
1058664330 9:107296552-107296574 AAAAAAAAGAGAGAGAGACAAGG - Intronic
1058773706 9:108264030-108264052 AAGAGACAGACATTGAGACTGGG + Intergenic
1059857113 9:118412008-118412030 AAAAAACAGTGATTATAACTTGG - Intergenic
1059872414 9:118592761-118592783 AAAAAGCAGAGCCTGAGACACGG + Intergenic
1060175376 9:121493734-121493756 AAAAAAAAGAGAGTGAGTCTAGG - Intergenic
1060418464 9:123450054-123450076 AAAAAAGGGAGATTCAGGCTGGG + Intronic
1060689838 9:125647920-125647942 AAAAAAAAGATATTGGGACTGGG - Intronic
1060837152 9:126764790-126764812 AAAAAGCAAAAATTGAGGCTGGG + Intergenic
1061092655 9:128435290-128435312 AAAACACAAAAATTGAGGCTGGG - Intronic
1062632216 9:137468346-137468368 AAAAAACAGACAATGAAAGTGGG + Intronic
1203696279 Un_GL000214v1:101496-101518 ATAAACCAAAGATTGAGAATGGG - Intergenic
1203366989 Un_KI270442v1:267617-267639 CAAAAAAAGAAAATGAGACTGGG + Intergenic
1203553660 Un_KI270743v1:186567-186589 ATAAACCAAAGATTGAGAGTGGG + Intergenic
1203639994 Un_KI270751v1:2567-2589 ATAAACCAAAGATTGAGAATGGG + Intergenic
1185551980 X:989739-989761 AAAAAAAAAAAATTGAGGCTCGG - Intergenic
1186188151 X:7041849-7041871 AAAAGAGAGAGAGAGAGACTGGG - Intergenic
1186428228 X:9482318-9482340 AAAAAACAAAGATTAACACTGGG - Intronic
1186597209 X:10996219-10996241 AAAAAACAGTCATGGAGGCTGGG + Intergenic
1187024491 X:15419901-15419923 AAAAAAAAGTGTTTGAGGCTGGG + Intronic
1187399365 X:18946239-18946261 AAAATATAGAGATTGAGACTCGG + Intronic
1187657866 X:21499567-21499589 TCAAAAGAGAGATTGAGTCTGGG + Intronic
1187989174 X:24850907-24850929 AAACACCAGAGATTCAGACCTGG + Intronic
1188103451 X:26119311-26119333 AAAGAACATAAATTTAGACTTGG + Intergenic
1188146794 X:26624354-26624376 AAGAAACAGAGATTATGGCTGGG + Intergenic
1188235920 X:27731090-27731112 AAACAACAGACATTTAGGCTGGG + Intronic
1188453458 X:30334889-30334911 AATCAACAGGGAGTGAGACTTGG - Intergenic
1188454154 X:30343101-30343123 AAAGAACACAGAATGAGAATGGG - Intergenic
1189392022 X:40584352-40584374 AAAAAAAAAAGATAGAGGCTGGG - Intronic
1189544827 X:42031055-42031077 AAAAAACAGATTGTCAGACTGGG - Intergenic
1189922922 X:45921032-45921054 AAAAAACGGAAATTTGGACTGGG - Intergenic
1189929364 X:45991722-45991744 GAAAAAGAAAGATTGAGGCTAGG - Intergenic
1189993221 X:46613904-46613926 TAAAGGCAGAAATTGAGACTTGG + Intronic
1190517443 X:51238539-51238561 AAAAAAAAGAGAGAGAGACAAGG + Intergenic
1192401171 X:70837714-70837736 AAATTATAGAGATGGAGACTAGG + Intronic
1192471278 X:71400917-71400939 GCAAAACTGAGATGGAGACTTGG + Intronic
1194442602 X:93951507-93951529 AAAAAACAAAAATTGACAATTGG - Intergenic
1195002251 X:100653119-100653141 ACAATAGAGAGAATGAGACTGGG + Intronic
1195021266 X:100831185-100831207 ACAAAACAGAGGTAGAGTCTTGG - Intronic
1195205933 X:102600247-102600269 AAAAGACAGAGAGAGAGACGTGG - Exonic
1195256376 X:103094594-103094616 AAAAAATAAAGATTTAGGCTGGG + Intergenic
1195328136 X:103774688-103774710 GAGACAAAGAGATTGAGACTTGG + Intronic
1195773335 X:108375666-108375688 AAAAAAAAAAGATTTAGCCTAGG - Intronic
1195897758 X:109764869-109764891 AAAAAAAAAAGATTTAGGCTGGG + Intergenic
1195982041 X:110589655-110589677 AAGAAAGAGACATTGAGATTAGG + Intergenic
1196649218 X:118151804-118151826 AAGAAAAATAGATTGAGGCTAGG - Intergenic
1196671331 X:118370875-118370897 AAAAAAAAGAGGTTTAGGCTGGG - Intronic
1197427941 X:126321420-126321442 AAAACAAAGTGACTGAGACTGGG - Intergenic
1197843611 X:130776890-130776912 ACAGAAAAGAGTTTGAGACTGGG - Intronic
1198083642 X:133263049-133263071 AAAAAAAAAATATCGAGACTGGG + Intergenic
1198235075 X:134729617-134729639 AATAAAGAGAGATTGAGAGAAGG - Intronic
1198300340 X:135328254-135328276 AAACAACAGAGTTTGTGACTTGG - Intronic
1198625301 X:138565807-138565829 AAAAAACAGAGAGAGAGAGAAGG - Intergenic
1198802878 X:140465385-140465407 TTAAAACAGAGAATGAGCCTTGG - Intergenic
1199393301 X:147306579-147306601 AAAAAAAAAAGTGTGAGACTAGG + Intergenic
1199807389 X:151313845-151313867 AATAAAAAGAGACTTAGACTGGG - Intergenic
1200334354 X:155333980-155334002 AAAACACAGATTTTGAGACTTGG + Intronic
1201071680 Y:10152611-10152633 CAAAAAAAGAAAATGAGACTGGG - Intergenic
1201747715 Y:17397211-17397233 ATATAAAAGAGATTGAGAATAGG - Intergenic
1202299946 Y:23401964-23401986 AAAAGATAGAGATTGAGAAATGG + Intergenic
1202347490 Y:23948106-23948128 AAAAAACATAGCTTCTGACTTGG - Intergenic
1202380755 Y:24275291-24275313 AAAAAAAAGGGATGGGGACTAGG - Intergenic
1202490029 Y:25394834-25394856 AAAAAAAAGGGATGGGGACTAGG + Intergenic
1202523282 Y:25721985-25722007 AAAAAACATAGCTTCTGACTTGG + Intergenic
1202570864 Y:26268634-26268656 AAAAGATAGAGATTGAGAAATGG - Intergenic