ID: 980940771

View in Genome Browser
Species Human (GRCh38)
Location 4:139272074-139272096
Sequence GCCTACACCTCAACTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980940766_980940771 22 Left 980940766 4:139272029-139272051 CCTATCACATGGCCTAGTCTCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940767_980940771 10 Left 980940767 4:139272041-139272063 CCTAGTCTCAATCTCTGTTTTTT 0: 1
1: 0
2: 9
3: 86
4: 990
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940764_980940771 27 Left 980940764 4:139272024-139272046 CCCAGCCTATCACATGGCCTAGT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46
980940765_980940771 26 Left 980940765 4:139272025-139272047 CCAGCCTATCACATGGCCTAGTC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980940771 Original CRISPR GCCTACACCTCAACTAGAGT GGG Intronic
907074456 1:51565781-51565803 GCCTACACCTCAACTCAGGCTGG + Intergenic
913345222 1:117802530-117802552 GCCAAGACCTCAACTTGAGAGGG - Intergenic
917332146 1:173892235-173892257 ACCAAGACCTCAAATAGAGTGGG - Exonic
1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG + Intronic
1066003389 10:31125342-31125364 GGCCACACCTCAAGTAGGGTTGG - Intergenic
1080809506 11:35689188-35689210 GCCTACACCTCAACCATGGCAGG - Intronic
1096511609 12:52132882-52132904 GCCAACCCCTCATCTAGCGTTGG - Intergenic
1097945017 12:65357988-65358010 GCCTACACTTAAAAAAGAGTAGG + Intronic
1098334774 12:69391809-69391831 GCCAACTCCTCAAGTAGAATGGG - Intergenic
1100582762 12:95950705-95950727 GCAGACACCACAACTAGAGATGG - Intronic
1117649688 14:57890289-57890311 ACCTACACTTCAGCTAGATTTGG - Intronic
1123406603 15:20023194-20023216 GCCTACACCTCCACCATAGATGG - Intergenic
1123515933 15:21029842-21029864 GCCTACACCTCCACCATAGATGG - Intergenic
1130446785 15:84009685-84009707 TGCTACATTTCAACTAGAGTTGG + Intronic
1140157175 16:72443118-72443140 GCATATACATCAGCTAGAGTTGG - Intergenic
1140453362 16:75089480-75089502 GCCTACACTTTAACTAAAGCAGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1149080261 17:52647877-52647899 GCCTAAGCCTGACCTAGAGTAGG - Intergenic
1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG + Intergenic
1155253469 18:23973155-23973177 GCCTTCACCCCAACAAGATTAGG + Intergenic
935315271 2:101827273-101827295 GCCTACATGTCATCTAGAATGGG + Intronic
937661475 2:124434670-124434692 CCCTACACCTCAATTTGGGTAGG + Exonic
942634237 2:177985254-177985276 GTCTACATGTCAAATAGAGTTGG + Intronic
947783171 2:232789100-232789122 CCCTACATCTAAACTAAAGTTGG - Intronic
1170628075 20:18044659-18044681 GCCTGCACCCCCACTAGACTCGG - Intronic
1172786102 20:37469818-37469840 GCTTACACCCCAAGTAGGGTGGG - Intergenic
949332995 3:2943055-2943077 GTATACACCTCATCTAGATTGGG - Intronic
951244900 3:20329883-20329905 ACCTACATTTCACCTAGAGTAGG + Intergenic
952248408 3:31623816-31623838 GACTACACTTGGACTAGAGTAGG - Exonic
966553352 3:181230216-181230238 CCTGACACCTCAACCAGAGTAGG - Intergenic
978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG + Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
995536805 5:113144684-113144706 GCCTGCACCTCAACAACAGCTGG + Intronic
997773308 5:136574508-136574530 GACTATGCTTCAACTAGAGTTGG + Intergenic
1002605901 5:180382547-180382569 GCCAACACCACAACTAGAAGGGG + Intergenic
1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG + Intronic
1008857624 6:56110950-56110972 GTCTACACCCCACCTTGAGTAGG + Intronic
1015572011 6:134631591-134631613 ACCTAGACATAAACTAGAGTTGG - Intergenic
1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG + Intergenic
1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG + Intronic
1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG + Intronic
1046313812 8:112474280-112474302 GCCAACCCCCGAACTAGAGTGGG + Intronic
1048632483 8:136259191-136259213 GGCAACACCTAAACTAGTGTTGG - Intergenic
1058302971 9:103398950-103398972 GCCAACAACTCAACTGGGGTGGG + Intergenic
1060570429 9:124633846-124633868 GCCTATACCTCAGAGAGAGTTGG + Intronic
1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG + Intergenic
1192162296 X:68797528-68797550 ACCCACACCTCAGCTAGAATGGG + Intergenic
1193080173 X:77398936-77398958 GCAAACATCTCAATTAGAGTAGG + Intergenic
1198816748 X:140599657-140599679 GCCTACACCACAAATAGAGTAGG - Intergenic