ID: 980945662

View in Genome Browser
Species Human (GRCh38)
Location 4:139318020-139318042
Sequence TATAATATTCAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980945662 Original CRISPR TATAATATTCAGAAAGTGGA TGG Intronic
900039903 1:451271-451293 CATAATGGTCAGATAGTGGAGGG + Exonic
900061335 1:686247-686269 CATAATGGTCAGATAGTGGAGGG + Exonic
904099391 1:28010716-28010738 CATCATATTCAGAAAGCAGAGGG - Intronic
904979541 1:34485731-34485753 TATAAAAGAAAGAAAGTGGATGG + Intergenic
905065506 1:35177772-35177794 TAGAATTTTTAAAAAGTGGATGG - Intronic
905715835 1:40149078-40149100 AATAATATTTTAAAAGTGGAAGG + Intergenic
906050278 1:42865563-42865585 TATAATAGACTGAAAGTGAAGGG + Intergenic
908142045 1:61195489-61195511 GATAATATACAGACAGAGGAGGG - Intronic
908197806 1:61762362-61762384 TATAATATTCAGAAATAAAAAGG - Intronic
908305442 1:62809881-62809903 TATAATATACACAAATTTGAAGG + Intronic
909584624 1:77275700-77275722 TGTAATTTTCAGAAATTGGAAGG - Intergenic
909833472 1:80223598-80223620 TATAGTATCCAGAATGCGGATGG - Intergenic
910136959 1:83983731-83983753 TATAATATCCAGAATCTGAAAGG + Intronic
912159550 1:106965108-106965130 AAAAATATTCAGAAGGTAGAAGG - Intergenic
917122776 1:171659044-171659066 CATAATATTTAGAAATTAGATGG - Intergenic
918558891 1:185840392-185840414 TAGAATTTTTAGAAAGTGGGAGG + Intronic
918618372 1:186574544-186574566 TATAATAATCAGTAATTGCAAGG + Intergenic
919418231 1:197338223-197338245 TATAAAATATAGAAAGTGTAGGG + Intronic
921676805 1:217985157-217985179 TATAAAACTCAGAATGTGAAGGG + Intergenic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
923239333 1:232065936-232065958 TACGATTTTCATAAAGTGGAAGG + Intergenic
923285830 1:232494186-232494208 TATAATGTTCATAAAGTCCAGGG + Intronic
923439091 1:233998416-233998438 TATAATACTCAGTAAGTGTTGGG - Intronic
1063135272 10:3210812-3210834 TATAATGTTGGGAATGTGGAAGG - Intergenic
1063279807 10:4615535-4615557 TATAAAATTTAGGAAGTGTATGG + Intergenic
1063538980 10:6912949-6912971 GATAATAATAAGAAAGTGCATGG + Intergenic
1064839636 10:19576483-19576505 TATAATATAGAGCAAATGGAAGG + Intronic
1066240442 10:33528794-33528816 TGTCATATTCATAGAGTGGAAGG + Intergenic
1067123714 10:43497376-43497398 TAGAATATTCAGAAACTACACGG - Intergenic
1069141184 10:64827689-64827711 TATAATACTCAAAAACTGGCAGG + Intergenic
1069181540 10:65366489-65366511 AATAATATACAGAAAGTAAATGG + Intergenic
1069765155 10:70851281-70851303 CCTAATATTCTCAAAGTGGAGGG + Intronic
1069779533 10:70946025-70946047 AGTAATATTCACCAAGTGGAGGG + Intergenic
1070501269 10:77074907-77074929 TATATTGTTCTGAAAGTGAAGGG - Intronic
1071156658 10:82697575-82697597 TAAAATATTCAGAGTCTGGATGG + Intronic
1072507510 10:96083512-96083534 TATAAGATTCAGAGACTGGGTGG + Intergenic
1073639410 10:105235375-105235397 GATAAAATTCACAAAGTGAAGGG + Intronic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1077757007 11:5042187-5042209 TAAAATATTCAGTAAATGGCCGG - Intergenic
1078063625 11:8063623-8063645 TATAATAGCAAGAAATTGGAAGG - Intronic
1078792560 11:14559201-14559223 TTTATAATTCAGAAATTGGAAGG + Intronic
1080064732 11:27998443-27998465 TAAAATTTTCAGAAAGAGGTAGG + Intergenic
1080142444 11:28938792-28938814 TATAATATTGAGATTGTGCAGGG - Intergenic
1080353061 11:31407441-31407463 TATAATATTCACAAGGTGGATGG + Intronic
1080566461 11:33513903-33513925 TTTAATTTTCAGACAGTAGAGGG - Intergenic
1080580315 11:33637065-33637087 CAGAAAATTCAGCAAGTGGAAGG + Intronic
1081090155 11:38854778-38854800 GATGACATTAAGAAAGTGGAAGG - Intergenic
1081292001 11:41337798-41337820 TCTAATATTCAGAATTTAGAAGG + Intronic
1081835803 11:46152840-46152862 TCTAATATTCAGAATCTGTAAGG - Intergenic
1082221073 11:49637922-49637944 TAAAATATTAACAAAGTGTATGG + Intergenic
1084538311 11:69771439-69771461 ATTAAAATTCAGAAAGTCGACGG + Exonic
1085500120 11:77013298-77013320 TATAGTATTCAGAAAATAAAAGG + Intronic
1085839276 11:79992486-79992508 TATAATTTTCATAGAGTGAAAGG - Intergenic
1085888255 11:80546162-80546184 CATAGAATTCAGAAACTGGATGG + Intergenic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1086604182 11:88675327-88675349 TTTAATATTGAGTAAATGGACGG + Intronic
1086627970 11:88981199-88981221 TAAAATATTAACAAAGTGTATGG - Intronic
1086760203 11:90620399-90620421 AATATAATTCAGAATGTGGAAGG + Intergenic
1086858208 11:91892343-91892365 GATAATATACAGACAGGGGAGGG - Intergenic
1087112122 11:94481970-94481992 AATGATATTCAGAAAGAGAAAGG + Intronic
1087217651 11:95511312-95511334 TGTAGAATTCAGAAGGTGGAAGG - Intergenic
1087706389 11:101497453-101497475 TATAATATTCAAAAAATGCTTGG - Intronic
1087943295 11:104127302-104127324 TATAATAATCAGAAGGTCGATGG - Intronic
1088237394 11:107740737-107740759 TATAGAATTCAGAATCTGGATGG - Intergenic
1088431158 11:109760435-109760457 TTTAATATTCAGAATCTAGAAGG - Intergenic
1091414822 12:272591-272613 TATAGTATTCACAGTGTGGATGG - Intergenic
1091862608 12:3799742-3799764 TATAATGTTAAGAAAGTTGCAGG - Intronic
1093531190 12:20166242-20166264 TATAATATTCAGAGGCTGTAGGG - Intergenic
1095120685 12:38414629-38414651 TATAAAATTTAGAAATTCGAGGG - Intergenic
1095247277 12:39937572-39937594 TATATAATTCAGAAAAAGGAAGG + Intronic
1095504180 12:42875370-42875392 AATCATATTCATAAATTGGAAGG - Intergenic
1098387788 12:69936846-69936868 TATAATTTTCACCAAGTGAAAGG + Intronic
1098815316 12:75153804-75153826 TTTATTATTCACTAAGTGGAAGG + Intronic
1099206663 12:79736421-79736443 TATAAGAGTCAAAAATTGGAGGG + Intergenic
1099253101 12:80282825-80282847 CATAATATCCAGAAAGTCAAGGG - Intronic
1099896572 12:88655064-88655086 TATAATTTTGGGATAGTGGAAGG + Intergenic
1101047119 12:100820017-100820039 TATAATATGCAGAAAGGTCAAGG - Intronic
1104193689 12:126509507-126509529 TATAAAATTAATAAGGTGGAAGG + Intergenic
1104626645 12:130361691-130361713 TATATGATTGAGAAACTGGAAGG - Intronic
1104888923 12:132130217-132130239 GAAAATATTCAAAGAGTGGATGG + Intronic
1105454716 13:20529677-20529699 GACAATATTAAGAAAATGGAAGG + Intergenic
1105968954 13:25410240-25410262 TTCAATAATCAGAAACTGGAGGG - Intronic
1107238696 13:38205322-38205344 TATAAAATTCAGAAATTGTGTGG - Intergenic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1108111130 13:47073887-47073909 TATAAAATTCAGAATCTGGATGG + Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109611584 13:64772203-64772225 TCTAATATTCAGAATTTGCAAGG - Intergenic
1109752798 13:66718623-66718645 GATAATATCTAGAAAGTGTATGG + Intronic
1110156608 13:72324319-72324341 GACAATATTCAGAAAGTTGGAGG - Intergenic
1110360335 13:74617340-74617362 AATCAGATTCAGAAAGTGCAGGG + Intergenic
1110395249 13:75022766-75022788 TATAATATTGAGAAAAGAGATGG + Intergenic
1110833441 13:80057616-80057638 TATAATATTTACAAAGTGGCAGG - Intergenic
1111024111 13:82496453-82496475 TATTATAATCAGAAAGTCTATGG - Intergenic
1111382460 13:87477021-87477043 TATTATTTTCTGAAAGTTGAAGG + Intergenic
1111427366 13:88104460-88104482 TACAGTCTTCAGAACGTGGAGGG - Intergenic
1111784392 13:92769141-92769163 TACAATATTCACATAGTGGGTGG - Intronic
1112944950 13:104916917-104916939 TACACAATTCAGAAAGTAGAAGG - Intergenic
1114771411 14:25431346-25431368 TATCGTATTCATAAACTGGACGG + Intergenic
1115040992 14:28927256-28927278 TACAATGTTCATAAATTGGAAGG - Intergenic
1115495900 14:34004291-34004313 TATAAAATTTGGGAAGTGGAGGG + Intronic
1115860499 14:37680940-37680962 TATCATGTTCAGAAAGTGCATGG + Intronic
1116148719 14:41109468-41109490 TATAAAATTCAGTAGATGGATGG - Intergenic
1116472668 14:45304574-45304596 TATAGAATTCAGAATCTGGATGG - Intergenic
1118158475 14:63264889-63264911 TATAATATTCAGAATCTATAAGG - Intronic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1118662252 14:68027801-68027823 TATAAAATTCAGAATCTAGATGG - Intronic
1120611549 14:86647133-86647155 TCTAAAATTCAGAATCTGGATGG + Intergenic
1120795877 14:88632337-88632359 TATATTATTGAGAATGTAGAGGG - Intronic
1122726321 14:103756384-103756406 TAAAATATTCTGAAACTGGCCGG - Intronic
1123883825 15:24702776-24702798 TCTAATATTCAGAATGTATAAGG - Intergenic
1123960253 15:25391069-25391091 TACAATATTCAAGAAGTGGAAGG + Intronic
1124169026 15:27355692-27355714 CATAATATACAAAAAGTGGGGGG + Intronic
1126287339 15:47028058-47028080 TATAGAATTCAGAATCTGGATGG + Intergenic
1126803028 15:52318127-52318149 TAGAATATTCACCAAGAGGAGGG - Intronic
1131952739 15:97698690-97698712 AATAATATACATAAAGTGTATGG + Intergenic
1132442004 15:101876348-101876370 CATAATGGTCAGATAGTGGAGGG - Intergenic
1132520360 16:384524-384546 AATAATTTTCAGAAGGTTGAGGG - Intronic
1134619948 16:15680277-15680299 TACTATATTCAGAATGTGGGGGG + Intronic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135295943 16:21279202-21279224 GATAATATACATAAAGTGCATGG - Intronic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1136526231 16:30833069-30833091 TAAAAAATACAGAAAGTGGCCGG + Intergenic
1137399624 16:48142650-48142672 TATAATATAAAGAATGGGGAAGG - Intronic
1138235772 16:55381205-55381227 AAAGTTATTCAGAAAGTGGATGG + Intergenic
1139061382 16:63257063-63257085 TATAAAACTGAGAAACTGGAAGG - Intergenic
1139316541 16:66075666-66075688 GATAATATTTAGTAAGTGTAAGG - Intergenic
1139897775 16:70301478-70301500 TTTAATATTCAGAAAATTTATGG + Intronic
1140313998 16:73876056-73876078 TAAAAAATTCAGACACTGGACGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1143069380 17:4277794-4277816 AAAAATACTCAGAAAGTGCATGG + Intronic
1144416380 17:15051311-15051333 TATAATATTCAGAGATTTTAAGG + Intergenic
1144590982 17:16523590-16523612 GAAAATATTCTGAAGGTGGAGGG - Intergenic
1144937109 17:18908681-18908703 CTCAATATTCAGGAAGTGGATGG - Intronic
1145845419 17:28034342-28034364 TATAATGTGCAGGAAGTGGGAGG - Intergenic
1148068908 17:44894874-44894896 TTTAGTATTAAAAAAGTGGAGGG - Intronic
1150253297 17:63721864-63721886 TACAATATCCACAAAGTAGAAGG - Intronic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1151216168 17:72577826-72577848 TTTACTATTCATTAAGTGGAAGG - Intergenic
1154084405 18:11289023-11289045 TATAATAATTAGAAAGGAGATGG + Intergenic
1155410077 18:25534220-25534242 TAGATTATTCAGAGAATGGAGGG + Intergenic
1155763142 18:29591006-29591028 TCTAATATTCAGAATGTACAAGG + Intergenic
1155781220 18:29838532-29838554 TAAAATATTCAGGTAGTGCAGGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1155899296 18:31368261-31368283 TCTAATATTCAGAATCTGTAAGG + Intergenic
1156426403 18:37018416-37018438 TATAATAGTCAGAAGGTTCAAGG - Intronic
1156937815 18:42732364-42732386 TGGAATATTTAAAAAGTGGATGG + Intergenic
1157045478 18:44098352-44098374 CATAAAATTCAGAATCTGGATGG - Intergenic
1158043637 18:53128670-53128692 TATTCAACTCAGAAAGTGGAAGG + Intronic
1158990882 18:62867224-62867246 CATAATATTTAGAAAGAGAAAGG - Intronic
1160642929 19:156810-156832 CATAATGGTCAGATAGTGGAGGG + Intergenic
1162368713 19:10265869-10265891 AATAAAATTTAAAAAGTGGAGGG - Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1168209843 19:54882319-54882341 TATAGAATTCAGAATCTGGATGG - Intronic
1168456807 19:56518238-56518260 GATAATATTCAGAAAATGTTGGG + Intronic
925504017 2:4540272-4540294 TAAAATATTCAGAACATTGATGG - Intergenic
925633571 2:5920037-5920059 TATAATAGTTAGAAAGTAAATGG + Intergenic
925654947 2:6136671-6136693 TATACTTTGGAGAAAGTGGAAGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
928459962 2:31462809-31462831 TATAATATTTAGAAAGTTAGAGG - Intergenic
930156083 2:48109015-48109037 TATAAGATTAAGAAATTAGAAGG - Intergenic
930214072 2:48674877-48674899 TAAAATATTCACTAAGTAGAAGG - Intronic
930401886 2:50900494-50900516 TAAAATATTTAGAAAACGGAAGG + Intronic
930533471 2:52618378-52618400 TATAAAATTCAAATAGAGGAAGG + Intergenic
930930770 2:56879298-56879320 TCTAATATTCAGAATCTGTAAGG + Intergenic
931031606 2:58181256-58181278 GATAAATTTCAGAAAATGGATGG + Intronic
931053459 2:58440451-58440473 TATAAAATGCAGAAAGTTTATGG + Intergenic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933479420 2:82836713-82836735 AATAATATTCAGAAAATGCAAGG - Intergenic
933919971 2:87035683-87035705 TATAATATTCATTGAGTTGATGG - Intergenic
934003024 2:87734211-87734233 TATAATATTCATTGAGTTGATGG + Intergenic
934120547 2:88834126-88834148 TAAAATATTCAAACAGTGCAAGG - Intergenic
935230664 2:101093070-101093092 TTTACTATTCATTAAGTGGAAGG - Intronic
935837614 2:107072617-107072639 TATAAAAGTCAGGAAGTGGCAGG + Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936916783 2:117648071-117648093 TACAAGGTTCAGAAAGCGGAAGG + Intergenic
936981727 2:118270965-118270987 GATAATATTCATAAAGTGCCTGG + Intergenic
937058495 2:118961596-118961618 TCTAATATTCAGAATCTGCAAGG - Intronic
939339122 2:140870267-140870289 TATAATTTCCAGAAAGGTGAAGG - Intronic
939344215 2:140941968-140941990 CATAGAATTCAGAAACTGGATGG + Intronic
939532121 2:143376149-143376171 TTTAGTATTCTAAAAGTGGAAGG + Intronic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940585031 2:155636936-155636958 AATAATAATCAGAAAGTAGCTGG - Intergenic
941277392 2:163507175-163507197 TATAACATGCATAAAGTGTATGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941491668 2:166149710-166149732 TATCAAATTCAGAACGTGGTGGG + Intergenic
941543223 2:166813240-166813262 AATACTATTCAGAAAATGAACGG - Intergenic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
942427193 2:175872457-175872479 TATAACATTTAGAAACTAGATGG - Intergenic
943010251 2:182439341-182439363 TATAAAATTATGAACGTGGATGG + Intronic
943166538 2:184333907-184333929 TATATCATCCAGAAAGTAGAAGG + Intergenic
943968158 2:194366110-194366132 GATAATAATCAGAAAGAAGAAGG + Intergenic
944031220 2:195237009-195237031 TATAATATTCTGGAAGTGGTTGG - Intergenic
944341818 2:198610359-198610381 TAAGATGTTCAGAAATTGGAGGG - Intergenic
944403902 2:199360709-199360731 TGTAATTATCAGAAAGAGGATGG - Intronic
945467716 2:210188799-210188821 TATAAGATTAACACAGTGGAAGG - Exonic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
945766774 2:213990608-213990630 TTTACTATTCATTAAGTGGAAGG + Intronic
946645253 2:221826379-221826401 TATAATGGTGGGAAAGTGGATGG - Intergenic
1170263061 20:14433740-14433762 TTTAATATTCTGCAAGTGGCTGG + Intronic
1171195566 20:23195350-23195372 TAGAAAATTCAGAAAGTTGCAGG + Intergenic
1173697619 20:45033151-45033173 TCTAATATTCAGAATCTGTAAGG - Intronic
1177247388 21:18546035-18546057 TAAATTATTCAGAAAGAGGCAGG + Intergenic
1177464333 21:21456255-21456277 TATAATAGTAACAAAGTGGCTGG + Intronic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1177595466 21:23234984-23235006 TATAATATTAATAAACTGAATGG + Intergenic
1178180985 21:30161331-30161353 GATAATATTTAGACAGTTGATGG - Intergenic
1178215223 21:30589210-30589232 AATAATATTTAATAAGTGGATGG + Intergenic
1178215358 21:30591351-30591373 AATAATATTTAATAAGTGGATGG - Intergenic
1179082790 21:38188760-38188782 TATAATTTTCTGAAAATTGAAGG - Intronic
1179303423 21:40133449-40133471 CATAATTTTCAAGAAGTGGAAGG + Intronic
1182867422 22:33616204-33616226 CATAATAGTCAAGAAGTGGATGG + Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1184356432 22:43983321-43983343 TCAATTTTTCAGAAAGTGGATGG + Intronic
1184909651 22:47521149-47521171 GATATAATTCAGAAAGTGAAAGG + Intergenic
1184963280 22:47947338-47947360 TTTAGTATTCAGCATGTGGAAGG + Intergenic
951219903 3:20057874-20057896 TATAATATTTAGCAAAGGGAGGG + Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956520046 3:70094086-70094108 TATAAAATTCAGATTGTGCACGG + Intergenic
956585753 3:70862773-70862795 TATAAAATACAGAAGATGGAAGG - Intergenic
957615279 3:82518559-82518581 TATAAGAATAAGAAACTGGATGG - Intergenic
959259754 3:104062098-104062120 TATATTATTCAGATGGTGGTGGG + Intergenic
959356083 3:105330317-105330339 TATAATATATATAAGGTGGATGG + Intergenic
959493642 3:107022579-107022601 TATAATCTTCATAGAGTAGATGG + Intergenic
959851529 3:111093834-111093856 TTAAATATTTAGATAGTGGATGG + Intronic
962817256 3:139013011-139013033 TAAAATAAAAAGAAAGTGGAGGG - Intronic
964220277 3:154335875-154335897 TATAATTTTCTGAAAGAGAAAGG - Intergenic
964808007 3:160632647-160632669 TATAAGAGTCAGAATGTAGAAGG - Intergenic
965042205 3:163523404-163523426 TGTTATATTCAGAAAGAGCAGGG + Intergenic
965776104 3:172233069-172233091 TAAATTATTCAGAAAGTTAATGG - Intronic
967344773 3:188442505-188442527 TCTGATATTTAGATAGTGGATGG + Intronic
967378513 3:188831846-188831868 TAGCATACTCAGAAAATGGAGGG - Intronic
968010971 3:195275153-195275175 TTTAATATCCAAAAAATGGAGGG + Exonic
970215154 4:13751204-13751226 TATGATATTTAGAAAGAGTAGGG + Intergenic
970515406 4:16824720-16824742 TAAATTCTTCAGAAATTGGATGG - Intronic
970969522 4:21965441-21965463 TGTAATATTCAGAAGCTGCACGG + Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
971903162 4:32689846-32689868 TATAAATTTCACAAAGTGGTTGG - Intergenic
971946723 4:33287856-33287878 TAAATTATTCAGAAACTGGGGGG + Intergenic
971964358 4:33533109-33533131 TATAACCTTCAGAAAGTGTGTGG - Intergenic
972091734 4:35294970-35294992 TATAATATTTATAAGGTGTATGG - Intergenic
972259120 4:37390437-37390459 TAAAATATTCAGAAAGTCACTGG + Intronic
973034544 4:45390061-45390083 CATAAAATTCAGAATCTGGATGG - Intergenic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
974413629 4:61575559-61575581 TATGAAATTCACAAAGTAGATGG - Intronic
974920200 4:68229779-68229801 TTAAATGTTCAGAAACTGGATGG - Intronic
974920788 4:68236807-68236829 TATATCATCCAGAAAGTGAAGGG - Intronic
974973883 4:68866038-68866060 TATAATTATGAGAAAGTGAAGGG - Intergenic
975007925 4:69313532-69313554 TATAATTCTGAGAAAGTGAAGGG - Intronic
975224389 4:71854273-71854295 TATAGTCTTCAGAATGTAGATGG + Intergenic
975302300 4:72804553-72804575 AATAATATTCATAAATTGAAAGG + Intergenic
975422943 4:74190644-74190666 AATAATATTGGGAAAGTGGTAGG + Intronic
975563890 4:75733696-75733718 TCTAATATTCAGAATCTGTAAGG - Intronic
976276070 4:83279755-83279777 TACAATATTCAGAAGGTGCCAGG - Intronic
977099855 4:92796935-92796957 GATATTTTTCAAAAAGTGGAAGG + Intronic
977860808 4:101957598-101957620 GGAAATATTCAAAAAGTGGAAGG - Intronic
977967543 4:103170391-103170413 TCAAATATTCAGAAAGTGGGAGG + Intronic
978642892 4:110892380-110892402 TATAATATCCAGAATCTAGAAGG + Intergenic
978911763 4:114071582-114071604 TATAGAATTCAGGATGTGGATGG + Intergenic
979056219 4:115998371-115998393 GGTAATATTAAGAAAGTTGAGGG + Intergenic
979834593 4:125348384-125348406 TGTAAACTTCAGAAAGTTGAAGG + Intronic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980088261 4:128415168-128415190 TATAGAATTCAGAATATGGATGG - Intergenic
980335027 4:131461029-131461051 TATAAAATTTGGAGAGTGGAGGG + Intergenic
980392483 4:132164753-132164775 TCTAATATTCAGAATTTGTAAGG - Intergenic
980538198 4:134158218-134158240 TACAAAATTAAGAAAGTGTATGG - Intergenic
980706059 4:136497158-136497180 TCTAATTTTCAGAAAGTGTCAGG + Intergenic
980907386 4:138961693-138961715 TGTAAGATTCAGAATGGGGAGGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981775239 4:148359664-148359686 TAAAATATGGAGAAAGTGGGAGG - Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982881946 4:160731038-160731060 ATTAATAGTCAGAAACTGGACGG + Intergenic
982963658 4:161874501-161874523 TATAATATTCAGAAATAAAATGG - Intronic
983188091 4:164723841-164723863 TATAAAATCCAGAAAGGTGAGGG - Intergenic
983537646 4:168875518-168875540 TATAATATGCAGGGACTGGAGGG - Intronic
984033208 4:174630924-174630946 TAGATTATTCTGAAATTGGAGGG + Intergenic
984135731 4:175935843-175935865 AATAATAATCAAAAAGTGCAAGG + Intronic
985210279 4:187585677-187585699 AATAATTTTCAGAATATGGAAGG + Intergenic
986373727 5:7108364-7108386 TAGAATATTAATAAAATGGAGGG + Intergenic
986792602 5:11177725-11177747 TATATTATTCAGAATTTAGATGG - Intronic
986890271 5:12295537-12295559 GATAATATTCAGAATATGTAAGG - Intergenic
988781205 5:34523391-34523413 TATAATTCTCTGACAGTGGATGG - Intergenic
989285461 5:39693846-39693868 TTTAATATTCTGAAAGTCTATGG - Intergenic
990614908 5:57497745-57497767 TACAATATTCTGAAATTGGGTGG + Intergenic
991308398 5:65207533-65207555 TATAATATTAAATAAGAGGAGGG + Intronic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
991534581 5:67653509-67653531 TATGATATTCTGAAATTGAAAGG + Intergenic
991588849 5:68227544-68227566 AATAATTTTGGGAAAGTGGAGGG + Intronic
992238556 5:74739004-74739026 TGTAATGGACAGAAAGTGGAAGG - Intronic
993066184 5:83100387-83100409 TATATTATTGTGAAAGTAGAAGG + Intronic
994680528 5:102881003-102881025 TATAATCTTGAGGAAATGGATGG + Intronic
995684878 5:114761501-114761523 TCTAATATCCAGAAATTGCAAGG - Intergenic
996240260 5:121190390-121190412 CATAATATTCAGACAGTAGGAGG + Intergenic
996679753 5:126219149-126219171 TCTAATATCCAGAAACTGTAAGG + Intergenic
996762735 5:127002728-127002750 CAGAACGTTCAGAAAGTGGATGG + Intronic
997021608 5:130008641-130008663 TATAGAATTCAGAATCTGGATGG + Intronic
997881658 5:137597452-137597474 TAAAATGCCCAGAAAGTGGAAGG - Intronic
998448286 5:142215270-142215292 TAAAATATTTAGAAAGAGGCTGG - Intergenic
1001900979 5:175429405-175429427 AATAAAATTCAGTAAATGGATGG + Intergenic
1002733944 5:181367672-181367694 CATAATGGTCAGATAGTGGAGGG - Exonic
1002750599 6:106450-106472 CATAATGGTCAGATAGTGGAGGG + Intergenic
1003634917 6:7823249-7823271 TACAATATTCTGTAAGTGGAAGG - Intronic
1003834654 6:10057924-10057946 TTTAATATTCAGAAAGCAAATGG + Intronic
1004538517 6:16526466-16526488 TAGAATATTCAGTAGGTGGCCGG + Intronic
1005633325 6:27729760-27729782 AATATTATTCAGTAAGTGTATGG - Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007914173 6:45545429-45545451 TATAATCTTCACAAAATGCAAGG - Intronic
1008020964 6:46576520-46576542 TATAGAATTCAGAATCTGGATGG + Intronic
1009048032 6:58251120-58251142 TATAATATCCAGAAAGGGAGAGG + Intergenic
1009456360 6:63861288-63861310 TATAATATTCAGAACTTGCTGGG - Intronic
1009467584 6:63991085-63991107 TATCATATACAGAAAGTAAAGGG + Intronic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1010113045 6:72264892-72264914 TAAGATATTCAGAAAGTAGGAGG - Intronic
1010171934 6:72985307-72985329 TTAAATATTGAGAAAATGGAAGG + Intronic
1010859734 6:80894599-80894621 TTTAATATTCAAAATGTGTAAGG - Intergenic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1011238355 6:85242824-85242846 TAAAATATTCAGAAACAGGTAGG + Intergenic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1012758337 6:103263072-103263094 TATAATAGTCAGTAAGGAGAGGG + Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013043424 6:106459903-106459925 TATAACATTCATAAAGTGGTGGG - Intergenic
1014333500 6:120101585-120101607 TAAAATATGAAGAAAGTAGATGG + Intergenic
1014986700 6:128020186-128020208 TGTAATAATCAGTATGTGGAAGG - Intronic
1015842671 6:137490825-137490847 TTTATTATTTAGAAAGGGGAGGG - Intergenic
1015883864 6:137896432-137896454 TCTAATATTAAGAAATTTGATGG + Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016449069 6:144162491-144162513 TATTTTATCCAGAATGTGGAAGG + Intronic
1016570713 6:145508770-145508792 TATAGAATTCAAAATGTGGATGG + Intronic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1017107904 6:150905335-150905357 TATAATATCAAGAAAAAGGATGG - Intronic
1017652156 6:156593539-156593561 TTTACTATTCATTAAGTGGAAGG - Intergenic
1017712942 6:157186202-157186224 TAGATCCTTCAGAAAGTGGAGGG + Intronic
1019238191 6:170639990-170640012 CATAATGGTCAGATAGTGGAGGG - Intergenic
1020921898 7:14276056-14276078 TTTAATATTCAAAAATTAGATGG + Intronic
1021148496 7:17119758-17119780 TAAAATGTTCAAAAAGTTGAAGG + Intergenic
1021737156 7:23651031-23651053 TGTAATATAAAGAAAGTGGCTGG + Intergenic
1021831940 7:24621854-24621876 TATAATATTGAGTGAGGGGAGGG + Intronic
1022540485 7:31130531-31130553 AAAACTATTCAGAAAGTGGCTGG + Intergenic
1023270771 7:38459953-38459975 AATAATATTCAGAATGTACAAGG + Intronic
1024314654 7:48004275-48004297 TATAATATTCAGTATGTCTAGGG - Intronic
1024842638 7:53604299-53604321 TATAAAATTCAGAATCTGCATGG + Intergenic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1027805694 7:82818866-82818888 TATTATTTTCAGAATGCGGATGG + Intronic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1027981460 7:85229370-85229392 TAAAATATTCAGTTATTGGAGGG - Intergenic
1028217367 7:88150987-88151009 CCTAATATTCATAAAATGGATGG + Exonic
1028980613 7:96964023-96964045 TTTAAAATTAAGTAAGTGGAAGG - Intergenic
1029650910 7:101890715-101890737 AATACAATTCAGAAAATGGAAGG - Intronic
1030887113 7:114951870-114951892 TACATGATTCAGAAAATGGAGGG + Intronic
1031666557 7:124491366-124491388 TATATTACTTAGAAAGTGCATGG + Intergenic
1031735766 7:125359148-125359170 TATAATCTTCTGCCAGTGGAGGG + Intergenic
1033376881 7:140770132-140770154 AATAATAATCAGAAAATGCAAGG - Intronic
1034361862 7:150506396-150506418 TAAAATATTCAGTAAGCGGTGGG - Intergenic
1035509576 8:166617-166639 CATAATGGTCAGATAGTGGAGGG + Exonic
1036053189 8:5223628-5223650 TAGAAAATACAGAAAGTGGCTGG + Intergenic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1037477832 8:19274968-19274990 TATAATAATGAAAAACTGGAAGG + Intergenic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038890352 8:31714232-31714254 TGTAATACCCAGCAAGTGGAAGG + Intronic
1038929751 8:32179680-32179702 TTTAATATTCAGAAAGTGTTTGG + Intronic
1039192988 8:34998260-34998282 TGTAGAATTCAGATAGTGGAAGG - Intergenic
1039382698 8:37100682-37100704 TAAACAATTCAGAATGTGGAAGG + Intergenic
1040381968 8:46881890-46881912 TTTAATATCCACAGAGTGGATGG - Intergenic
1040811876 8:51462326-51462348 CATAAAATTCAGAATCTGGATGG + Intronic
1040888596 8:52291712-52291734 CATAATATTCATATAATGGATGG + Intronic
1041068983 8:54108022-54108044 AATAATATTAATAAAGAGGATGG - Intergenic
1041584631 8:59501007-59501029 TATAGAATTCAGAAAATGGATGG + Intergenic
1041586081 8:59521345-59521367 TCTAATATTCAGAATCTAGAAGG + Intergenic
1042066011 8:64877732-64877754 TATAATATTCATAAGGTCGGTGG + Intergenic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1042779677 8:72476751-72476773 TATAGAATTCAGAATATGGATGG + Intergenic
1043616778 8:82135160-82135182 ACTAATATTCAGAAACTGCAAGG + Intergenic
1043634680 8:82372599-82372621 TGTAATATCCAGAAAGGGAAAGG - Intergenic
1043635002 8:82374667-82374689 CATAATATCCAGAAAGGGGGAGG + Intergenic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1045075795 8:98566434-98566456 CATAATTTTCAGAAAATGTATGG - Intronic
1045171460 8:99674858-99674880 AATAACATTCAAAATGTGGAGGG - Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045584196 8:103513025-103513047 TATAAGATATAGAAAGTGGCAGG + Intronic
1045730309 8:105231312-105231334 TATAAGCTTCAGAAAATGGTAGG + Intronic
1046119907 8:109832802-109832824 TCTAATATTCAGAATGTATAGGG + Intergenic
1047800328 8:128302575-128302597 TATACTATGCAGAAACTGTAGGG + Intergenic
1047827842 8:128596935-128596957 TAAGATATTGGGAAAGTGGATGG + Intergenic
1048110543 8:131463293-131463315 AATAAAACTCAGAAAGTGCAGGG - Intergenic
1048701465 8:137095348-137095370 TCTAATATTCAGAATCTGTAAGG + Intergenic
1048773712 8:137922393-137922415 TGTAAGATGCAGAAAATGGAAGG + Intergenic
1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG + Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052286242 9:26789065-26789087 AATAAACTTCAGAAAGGGGAGGG + Intergenic
1052521668 9:29555721-29555743 TAAAAGATTAAGAAAGAGGAAGG + Intergenic
1056877859 9:90352480-90352502 TCTAATATTCAGAAACTATAAGG + Intergenic
1057057310 9:91973426-91973448 TCTAATATCCAGAAACTGCAAGG + Intergenic
1058093365 9:100830222-100830244 TATAATCTTGAGGGAGTGGAAGG + Intergenic
1058299339 9:103351164-103351186 TATAATAGCCAAAAAATGGAAGG + Intergenic
1058571534 9:106350641-106350663 TATAATATTGAGACAGAGGTGGG + Intergenic
1059602812 9:115799669-115799691 TATATTATACAGAAAGTGCCTGG + Intergenic
1059778973 9:117507112-117507134 CATAAAATTCAGAATCTGGATGG - Intergenic
1060168016 9:121436054-121436076 AATAATATCCTGAAAGTTGAAGG - Intergenic
1061324350 9:129853986-129854008 TAAAATACTCAGAAAGAGCAAGG + Intronic
1062064015 9:134516522-134516544 TATAATTTTCAGAAAGAGCAGGG - Intergenic
1062758397 9:138320282-138320304 CATAATGGTCAGATAGTGGAGGG - Intergenic
1186938726 X:14480242-14480264 TCTAATATTCAGAATCTGTAAGG - Intergenic
1187493066 X:19770912-19770934 TCTAATATTCAGCACGTGTAAGG - Intronic
1188063067 X:25624924-25624946 TGCAATACTCAGAATGTGGATGG + Intergenic
1190552111 X:51594882-51594904 TCTAATATTCAGAGACTGCAAGG - Intergenic
1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG + Intronic
1192756435 X:74050697-74050719 CATAAAATTCAGAATCTGGATGG + Intergenic
1193472748 X:81926675-81926697 TATAGAATTCAGAATCTGGATGG + Intergenic
1193780365 X:85694057-85694079 TCTAATATTCAGAATTTGCAAGG - Intergenic
1193869574 X:86780364-86780386 CATAGTATTCAGAATATGGATGG + Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1193991142 X:88308839-88308861 TCTAATATTCAAAAACTGTAAGG - Intergenic
1194842629 X:98762839-98762861 TCTAATATTCAGAATCTGTAAGG + Intergenic
1195385266 X:104308198-104308220 TTTACTATTCATTAAGTGGAAGG - Intergenic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1195969816 X:110461051-110461073 TATAGGATTCTGAAAGTGGAAGG + Intergenic
1196743733 X:119049044-119049066 AATAAAATTCAGAATGTGTATGG + Intergenic
1197382003 X:125756213-125756235 TTTAATCTTCAGGAAGTGGTGGG - Intergenic
1197582406 X:128299574-128299596 TATAGAATTCAGAATATGGATGG + Intergenic
1197966238 X:132065325-132065347 CTTAATATTCAAAAAATGGAAGG - Intergenic
1197984385 X:132252208-132252230 TATAATATCCAGAATCTGAAAGG + Intergenic
1198014525 X:132595413-132595435 TAAAATATTCAGAAAATGCTGGG + Intergenic
1198232360 X:134703388-134703410 AATAATATTTACAAAGTTGAGGG + Intronic
1198535231 X:137578984-137579006 TACAGTTTTCAGAAAGTAGATGG + Intergenic
1198593182 X:138207205-138207227 TATAATATTTATAAACTGTACGG + Intergenic
1199568940 X:149247556-149247578 TATAGTATCAAGAAAGTGAAGGG - Intergenic
1200673687 Y:6124673-6124695 TATAGATTTCAGACAGTGGATGG - Intergenic