ID: 980956505

View in Genome Browser
Species Human (GRCh38)
Location 4:139434025-139434047
Sequence AGGGAGATCGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980956505_980956510 12 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956510 4:139434060-139434082 GAGTCTCTCTGTGTGCCACGTGG No data
980956505_980956517 30 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956517 4:139434078-139434100 CGTGGCCACTGCTGGGGGCTGGG No data
980956505_980956514 25 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956514 4:139434073-139434095 TGCCACGTGGCCACTGCTGGGGG No data
980956505_980956513 24 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956513 4:139434072-139434094 GTGCCACGTGGCCACTGCTGGGG No data
980956505_980956516 29 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956516 4:139434077-139434099 ACGTGGCCACTGCTGGGGGCTGG No data
980956505_980956511 22 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956511 4:139434070-139434092 GTGTGCCACGTGGCCACTGCTGG No data
980956505_980956512 23 Left 980956505 4:139434025-139434047 CCCACAATCACTGCGATCTCCCT No data
Right 980956512 4:139434071-139434093 TGTGCCACGTGGCCACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980956505 Original CRISPR AGGGAGATCGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr