ID: 980957077

View in Genome Browser
Species Human (GRCh38)
Location 4:139440332-139440354
Sequence TTCCAGGAGAATTAAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980957077_980957079 -5 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957079 4:139440350-139440372 TGGAAGTCACTTCAACCAGAAGG 0: 2
1: 8
2: 16
3: 40
4: 180
980957077_980957085 29 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957085 4:139440384-139440406 CAACAATGGAAGTGCAACAATGG No data
980957077_980957082 2 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957082 4:139440357-139440379 CACTTCAACCAGAAGGTGAGGGG No data
980957077_980957084 15 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957084 4:139440370-139440392 AGGTGAGGGGCTTGCAACAATGG No data
980957077_980957080 0 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957080 4:139440355-139440377 GTCACTTCAACCAGAAGGTGAGG No data
980957077_980957081 1 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957081 4:139440356-139440378 TCACTTCAACCAGAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980957077 Original CRISPR TTCCAGGAGAATTAAAGAGC TGG (reversed) Intergenic
No off target data available for this crispr