ID: 980957082

View in Genome Browser
Species Human (GRCh38)
Location 4:139440357-139440379
Sequence CACTTCAACCAGAAGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980957077_980957082 2 Left 980957077 4:139440332-139440354 CCAGCTCTTTAATTCTCCTGGAA No data
Right 980957082 4:139440357-139440379 CACTTCAACCAGAAGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980957082 Original CRISPR CACTTCAACCAGAAGGTGAG GGG Intergenic
No off target data available for this crispr