ID: 980957082 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:139440357-139440379 |
| Sequence | CACTTCAACCAGAAGGTGAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 980957077_980957082 | 2 | Left | 980957077 | 4:139440332-139440354 | CCAGCTCTTTAATTCTCCTGGAA | No data | ||
| Right | 980957082 | 4:139440357-139440379 | CACTTCAACCAGAAGGTGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 980957082 | Original CRISPR | CACTTCAACCAGAAGGTGAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||