ID: 980957728

View in Genome Browser
Species Human (GRCh38)
Location 4:139445886-139445908
Sequence GTTATCTGCAGAAGATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980957728_980957732 16 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG No data
980957728_980957734 23 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957734 4:139445932-139445954 TTTGGCCTGTTACTGGGCTTTGG No data
980957728_980957733 17 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957733 4:139445926-139445948 ACAGCTTTTGGCCTGTTACTGGG No data
980957728_980957730 5 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957730 4:139445914-139445936 TCCTTCTGAGAGACAGCTTTTGG No data
980957728_980957735 26 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957735 4:139445935-139445957 GGCCTGTTACTGGGCTTTGGCGG 0: 144
1: 161
2: 86
3: 68
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980957728 Original CRISPR GTTATCTGCAGAAGATGTCA GGG (reversed) Intergenic
No off target data available for this crispr