ID: 980957729

View in Genome Browser
Species Human (GRCh38)
Location 4:139445887-139445909
Sequence AGTTATCTGCAGAAGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980957729_980957734 22 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957734 4:139445932-139445954 TTTGGCCTGTTACTGGGCTTTGG No data
980957729_980957730 4 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957730 4:139445914-139445936 TCCTTCTGAGAGACAGCTTTTGG No data
980957729_980957735 25 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957735 4:139445935-139445957 GGCCTGTTACTGGGCTTTGGCGG 0: 144
1: 161
2: 86
3: 68
4: 218
980957729_980957732 15 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG No data
980957729_980957733 16 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957733 4:139445926-139445948 ACAGCTTTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980957729 Original CRISPR AGTTATCTGCAGAAGATGTC AGG (reversed) Intergenic
No off target data available for this crispr