ID: 980957732

View in Genome Browser
Species Human (GRCh38)
Location 4:139445925-139445947
Sequence GACAGCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980957729_980957732 15 Left 980957729 4:139445887-139445909 CCTGACATCTTCTGCAGATAACT No data
Right 980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG No data
980957728_980957732 16 Left 980957728 4:139445886-139445908 CCCTGACATCTTCTGCAGATAAC No data
Right 980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980957732 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr