ID: 980958661

View in Genome Browser
Species Human (GRCh38)
Location 4:139453748-139453770
Sequence CTGAGAGGAAGGAGGTACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 0, 3: 43, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980958661_980958669 14 Left 980958661 4:139453748-139453770 CCGTGGTACCTCCTTCCTCTCAG 0: 1
1: 1
2: 0
3: 43
4: 325
Right 980958669 4:139453785-139453807 CCGCCCCCGGAGTGATTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 23
980958661_980958674 27 Left 980958661 4:139453748-139453770 CCGTGGTACCTCCTTCCTCTCAG 0: 1
1: 1
2: 0
3: 43
4: 325
Right 980958674 4:139453798-139453820 GATTGCGCGGCTTCCTCCAGAGG 0: 1
1: 1
2: 0
3: 4
4: 42
980958661_980958675 28 Left 980958661 4:139453748-139453770 CCGTGGTACCTCCTTCCTCTCAG 0: 1
1: 1
2: 0
3: 43
4: 325
Right 980958675 4:139453799-139453821 ATTGCGCGGCTTCCTCCAGAGGG 0: 1
1: 1
2: 0
3: 2
4: 44
980958661_980958665 1 Left 980958661 4:139453748-139453770 CCGTGGTACCTCCTTCCTCTCAG 0: 1
1: 1
2: 0
3: 43
4: 325
Right 980958665 4:139453772-139453794 TGTCTGTCTCTCCCCGCCCCCGG 0: 1
1: 0
2: 5
3: 35
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980958661 Original CRISPR CTGAGAGGAAGGAGGTACCA CGG (reversed) Intronic
900161855 1:1227655-1227677 CTGAGTGCAAGTAGGTTCCAGGG + Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900656672 1:3762144-3762166 CAGAGATGAAGCAGGAACCAGGG + Intronic
900658077 1:3770020-3770042 CTGAGAGAAAGGAGGGTCCTGGG - Intronic
900766381 1:4508763-4508785 GAGAGAGGCAGGAGGTCCCAGGG - Intergenic
901136578 1:7000583-7000605 CTGAGAGGGAGCAGGTGCCTTGG + Intronic
901836379 1:11926383-11926405 CCGAGAAGAAGGAGGAAGCAGGG - Exonic
902192834 1:14775583-14775605 CTGAGAGGAAGGTGGCTCCGAGG + Intronic
902692645 1:18119540-18119562 CTGACAGGAAGAAAGTAACAAGG + Intronic
904192968 1:28761813-28761835 CTTGTAGGCAGGAGGTACCATGG + Intronic
905514588 1:38552922-38552944 CTGAGATCAAGGTGGCACCATGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906056660 1:42923413-42923435 CTGAGAGAAATGAGGAACCCAGG + Intergenic
906384000 1:45351686-45351708 CTGGGAGCACGGAGGTTCCAAGG + Intronic
906415923 1:45621522-45621544 CTGAGAGGAGGGAGGTTGAAAGG - Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
908739966 1:67317469-67317491 CAGAGAGATATGAGGTACCAAGG - Intronic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
909111122 1:71478829-71478851 CTGAGATGAAGCTGATACCATGG + Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910713930 1:90209622-90209644 CTGACAGGGAGTAGGTGCCAGGG + Intergenic
911730167 1:101284138-101284160 CTGTGAGGAAGGAGGTGCCTCGG + Intergenic
912697743 1:111854380-111854402 CTGAGAAGATGGAGGCATCAGGG + Intronic
915545169 1:156592890-156592912 CAGAGTGGAAGGAGGGACCAGGG - Intronic
915708633 1:157871637-157871659 CTCACAGGAAGGAGGTTCTAAGG - Intronic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
917406695 1:174714230-174714252 CTTAGAGGAAGTAGCTAGCAAGG - Intronic
917610098 1:176680956-176680978 CTGAGTGGATGGTGGTGCCAAGG + Intronic
918092213 1:181307369-181307391 CTGATAGGAAGGAGGTAAGCTGG + Intergenic
920210069 1:204321501-204321523 CTGAGATGCAGGAGGAAGCATGG - Intronic
920339583 1:205267598-205267620 CTGAGAGGAACCAGGCACCAGGG + Intronic
920852226 1:209635871-209635893 CTGAGAGGAGGCAGGGCCCAGGG - Intronic
923433930 1:233950576-233950598 GAAAGAGGAAGGAGGTACGAAGG - Intronic
1064312114 10:14220859-14220881 CTCAGAGGCAGGTGGTATCAGGG + Intronic
1067438122 10:46292972-46292994 CTGAGATGAAGGAGGGATGACGG + Intronic
1067460536 10:46454980-46455002 CACTGAGGAAGGAGGTAGCAGGG + Intergenic
1067626656 10:47929623-47929645 CACTGAGGAAGGAGGTAGCAGGG - Intergenic
1068358566 10:55945026-55945048 CTGAGAGGAATGAGGTCACGTGG + Intergenic
1069770535 10:70896406-70896428 CTGAAAGGTAGGAGGTACAGTGG - Intergenic
1070542120 10:77423562-77423584 TGGAGAGGAAGGAGACACCAGGG + Intronic
1071449061 10:85777268-85777290 CTGGGAGAAAGGAGGGCCCAGGG - Intronic
1071527980 10:86369016-86369038 TGGAGAGGAAGGAGGCACCCAGG - Intergenic
1071734779 10:88286178-88286200 ATGTGAGGAAGAAGGAACCATGG - Intronic
1072088959 10:92108242-92108264 CTGGGAGCAAGGAAGCACCATGG + Intronic
1072914186 10:99527067-99527089 CAGAGAGGAAGGGGCTACGAGGG + Intergenic
1073233393 10:101992174-101992196 GGGAGAGGAATGAGGTAGCATGG + Intronic
1073348664 10:102803234-102803256 CTGAGAGCAAGGAAGGGCCAGGG + Intronic
1073483317 10:103800583-103800605 GTGATTGGAAGGAGGGACCAGGG - Intronic
1073560210 10:104489782-104489804 CACAGAGGAAGGAGGGCCCAGGG + Intergenic
1073600336 10:104840198-104840220 CTGAGAGGAAGGAGAAACTAAGG + Intronic
1073624539 10:105083440-105083462 TTGAGAGGGAAGAGGTGCCAGGG + Intronic
1073755110 10:106572973-106572995 CTGATAGGAAGGAGGTGCATGGG + Intergenic
1074774919 10:116760492-116760514 CTGGGAGCAAGGAGATTCCAGGG - Intergenic
1074776796 10:116773125-116773147 GTGGGAGGAAGGAGGGCCCAGGG - Intergenic
1074997131 10:118767247-118767269 CTTAGAGGAAGAGGGTACCTGGG + Intergenic
1076461334 10:130649472-130649494 CTGGGTGGATGGAGGTATCATGG - Intergenic
1076481811 10:130789645-130789667 CTGAGGGGAAGTAGGACCCACGG - Intergenic
1076631296 10:131853602-131853624 TGGAGAGGAAGGTGGGACCAGGG - Intergenic
1076721409 10:132395014-132395036 CAGAGGGGCAGGAGGTACCATGG + Intergenic
1076768867 10:132652031-132652053 GGGAGAGGGAGGAGGGACCAAGG - Intronic
1076768877 10:132652054-132652076 CTGGTAGGGAGGAGGGACCAAGG - Intronic
1076988607 11:257293-257315 CTGAGAGGAGGGAGCTGGCAGGG + Intergenic
1078621554 11:12913232-12913254 CTGGGGGGTAGGAGGTACCGTGG - Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1082833634 11:57637645-57637667 CAGAGAGGAAGGCGGCAGCAAGG - Intergenic
1083454497 11:62769669-62769691 CTGAGTGGAGGCAGGAACCAGGG - Intergenic
1084652152 11:70495633-70495655 CTGTCAGGAAGCAGGTCCCAGGG - Intronic
1084717086 11:70880823-70880845 CTGAGAGGATAGAGCTCCCAGGG + Intronic
1085228331 11:74942871-74942893 CTGAGAGGAAGGAGACAGCAAGG + Intronic
1085445782 11:76599733-76599755 CAGAGAGGAGGCAGGTGCCAAGG + Intergenic
1086094656 11:83038220-83038242 CTGAGAGGTAGGACATACCAAGG - Intronic
1086106926 11:83156991-83157013 CGGAGAAGAAGGCGGTGCCAGGG + Exonic
1091025282 11:132136053-132136075 CTGAGAGGAAGGGGTCCCCAGGG - Intronic
1091099564 11:132858327-132858349 CAAAGAGGAAGGAGGCACCCTGG - Intronic
1092079967 12:5707745-5707767 TTCAGAGGAAGGAGAGACCAGGG - Intronic
1092829748 12:12432268-12432290 AAAAGAGGAAGGAGGCACCATGG - Intronic
1093556992 12:20488156-20488178 CTGGGAGGAAGAAGGTAAAAAGG - Intronic
1094487012 12:30933480-30933502 CTGAGAGGAAGGAGCTGGAAGGG - Intronic
1095921833 12:47539529-47539551 CTGAGGAAAGGGAGGTACCAAGG + Intergenic
1097164060 12:57073050-57073072 CTGAGAAGAAGGAAGAACTAAGG + Intronic
1097990301 12:65825761-65825783 CCGGGAGGAAGGAGGTGCCGGGG + Intronic
1098381064 12:69870027-69870049 CTGAGAGGAAGGAGTTTAGAAGG + Intronic
1098824426 12:75275616-75275638 CTGAGAGATATGAGGTATCAGGG + Intergenic
1099004884 12:77224393-77224415 CAGAGAAAAAGGAGGAACCAGGG - Intergenic
1099274438 12:80557275-80557297 CTGGGAGGAAGGACGTTCAAGGG - Intronic
1100808179 12:98309891-98309913 CTGACTGGAAGGAGGCACAAGGG + Intergenic
1101641392 12:106587593-106587615 CGGAGAGGAGGGAGGGAGCAAGG - Intronic
1102443149 12:112978812-112978834 CTGGGAGGCAGGAGATTCCACGG + Intronic
1103018535 12:117514921-117514943 CTTAGAGGTAGGAGGTAGCAAGG - Intronic
1103974114 12:124690817-124690839 CTGTGAGGAAGGGATTACCACGG - Intergenic
1104121829 12:125807282-125807304 CTGATAGGATGGTGTTACCATGG + Intergenic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104420144 12:128628195-128628217 CTGTGAGGAAGGGGCTCCCAGGG - Intronic
1106748293 13:32728535-32728557 CAGAAAGGAAGGAGTTACAAAGG - Intronic
1107072867 13:36290866-36290888 CTGAGAGGCACGATGGACCAGGG + Intronic
1107423771 13:40273499-40273521 CTGAGAGGAAGGAAATAAGATGG + Intergenic
1108679712 13:52769198-52769220 CAGAGAGGAAGAAGGAACGAAGG - Intergenic
1109097767 13:58140850-58140872 CAGAAAGGAAGGAGGCACAAAGG - Intergenic
1109448233 13:62473656-62473678 CTGAAAGGAAGGAGATTTCAGGG - Intergenic
1110065998 13:71106080-71106102 CTGAGAGGAAGGAGCTTCCCAGG + Intergenic
1111337776 13:86845894-86845916 CTGAGAGCAACAAGGAACCAGGG + Intergenic
1112143295 13:96670530-96670552 TGGAGAGAAAGGAGGTTCCAGGG + Intronic
1112797741 13:103075327-103075349 CTGACAGGAAAGAGGGGCCAGGG + Intergenic
1114334339 14:21672257-21672279 GTGATAGGAAGGAAGTAGCAAGG - Intergenic
1115307995 14:31951717-31951739 CTGAGATGAAGGTGGGACCCTGG - Intergenic
1116284417 14:42953561-42953583 CTGAGAGTAAGAAGGAACCCTGG + Intergenic
1117344971 14:54822843-54822865 ATGAGGGGAAGGAGGGTCCAGGG - Intergenic
1119155336 14:72404950-72404972 GTGAGAGGAAGGGGGAACCCTGG + Intronic
1120176998 14:81304946-81304968 GTGATAGGAAGGGGGTACAAAGG - Intronic
1120502051 14:85309241-85309263 CTGAGAGGAAAGAGAGCCCATGG + Intergenic
1121086038 14:91146825-91146847 TTCAGAGCAAGTAGGTACCATGG + Intronic
1121892210 14:97604837-97604859 CTGAGAAACAGGAGGTAGCAGGG + Intergenic
1122896300 14:104759050-104759072 CTGAGAGGAAGGTGCTGGCAGGG + Intronic
1123799631 15:23806447-23806469 GTGAGGCGTAGGAGGTACCAAGG + Intergenic
1123993307 15:25700990-25701012 GTGAGAGGAAGGGGGTGCCCCGG + Intronic
1125481855 15:40086655-40086677 CAGAGAGAAAGGAGGGAACAAGG + Intergenic
1126066401 15:44829445-44829467 CTGAGATGAAGGATACACCATGG + Intergenic
1126676549 15:51163687-51163709 CTGAGATCAAGGAGGTTCAAAGG - Intergenic
1127343945 15:58075056-58075078 CTGAGAGGAAGGACGTGATAAGG - Intronic
1127733319 15:61819699-61819721 CTGAGAGGAAGGATGGAGAAGGG - Intergenic
1128283498 15:66416870-66416892 CAGAAGGAAAGGAGGTACCATGG - Intronic
1128606841 15:69042858-69042880 CTGAGAAGAAGGAGGCAACTTGG - Intronic
1128705691 15:69836167-69836189 TGGAGAGGAAGGAGGTTCCTGGG + Intergenic
1129606324 15:77026822-77026844 CTGCCAGGAAGGAGGGACCCCGG + Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1130045606 15:80442246-80442268 CTGGGAGGAACGAAGTACGATGG - Intronic
1130090982 15:80821195-80821217 CTCAGAGGAATGAGGGAGCAGGG + Intronic
1132161377 15:99546267-99546289 CTGAGAGGAAAGAGGAACAGAGG - Intergenic
1132495980 16:263630-263652 CTGAGATGAAGGAAGCACCCAGG - Intronic
1133342476 16:5045589-5045611 CTGAGAGGCATGAGCTGCCAGGG - Intronic
1137408542 16:48208691-48208713 CCGAGAGGAAGGAGATCACAAGG + Intronic
1140526471 16:75627144-75627166 CTGAGGGAAATGAGATACCATGG - Intergenic
1141503901 16:84462421-84462443 CAGGGAGGAAGGAGGGAGCAAGG + Intronic
1142348220 16:89567740-89567762 ACGAGAGGAAGGAGGTAACGGGG - Intergenic
1142985749 17:3694630-3694652 CTGAGACGAGGGTGGTAGCATGG - Intronic
1143185598 17:5008189-5008211 CTGAAAGGAAGGAAGGAGCAGGG + Intronic
1144629991 17:16866387-16866409 TTGACAGGAAGGAGGCACCAGGG + Intergenic
1144651387 17:17009420-17009442 TTGACGGGAAGGAGGCACCAGGG - Intergenic
1145207315 17:20991452-20991474 CGGGGAGGAAGGACGTGCCAGGG + Intergenic
1146769229 17:35553335-35553357 CTGAGAACAAGGATGTATCAGGG + Exonic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148489015 17:48011532-48011554 CGAAGAGGAAGGAGGGACGACGG + Intergenic
1148725726 17:49788698-49788720 CTGAGAGGCAGGAGGCACTAGGG + Exonic
1149640684 17:58200464-58200486 CAGTCAGAAAGGAGGTACCAGGG - Intronic
1149683448 17:58521211-58521233 CTGAGGGCAAGGAGATACCCTGG + Intronic
1152594015 17:81229479-81229501 GAAAGAGGAAGGAGGAACCAGGG + Intronic
1152739947 17:82014468-82014490 CTGGGAGGGAGGTGGCACCACGG - Intronic
1153547537 18:6224026-6224048 CTGGGTGGAAGGAGAAACCAAGG + Intronic
1155344976 18:24848892-24848914 ATGAGAGGAAGGGAGGACCAAGG - Intergenic
1157784082 18:50466653-50466675 CTAAGAGGAAGGACATTCCAAGG + Intergenic
1158203968 18:54970416-54970438 CTGAGAGTCAGGAGATAACATGG + Intergenic
1158267978 18:55681231-55681253 CTGAGAGGAAAGAGGTGCACCGG + Intergenic
1158905990 18:62012379-62012401 ATGACAGGAGGGAGCTACCAAGG + Intergenic
1160075208 18:75667874-75667896 CTGAGAGGCAGGAGCCAGCATGG - Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1161465593 19:4428604-4428626 ATGGGAGAAAGGAGGCACCATGG - Intronic
1161918556 19:7249186-7249208 CTGAAAGGAAAGAGGTTCCCAGG - Intronic
1163160051 19:15458793-15458815 CTAAAAGCAAGGAGGTGCCATGG - Intronic
1165320837 19:35084258-35084280 CTGAGAGGAGTGAGGGACTAGGG - Intergenic
1166295737 19:41888400-41888422 AGGTGAGGAAGGAGGTACCAGGG - Intronic
1166825407 19:45606020-45606042 CTGAGAGGAAGGGGGTAATGTGG - Intergenic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1168125087 19:54278533-54278555 CTGAGATGAAGGGTGTGCCACGG + Exonic
1168164009 19:54534168-54534190 CTGTGAGGAATCAGGTACCCAGG + Intronic
927487157 2:23496468-23496490 GGGAGAGGGAGGAGGTACCAGGG - Intronic
928159416 2:28908159-28908181 TTTAGAGGGAGGAGGTACTAGGG + Intronic
928301832 2:30131993-30132015 CTGAGTGGAAGGAGCTCACATGG - Intergenic
929897135 2:45971165-45971187 CTGGGAGAAAGGAGGAATCAGGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930722292 2:54649132-54649154 CTGAGAGGGAGGTGGTCGCAGGG + Exonic
932092310 2:68817426-68817448 ATGAGAGCAAGGAGGCACCATGG + Intronic
933284815 2:80374569-80374591 CTGAGATGAAGGAGTCAACAGGG + Intronic
934156626 2:89207195-89207217 CTGAAAGAAAGGAGGGGCCAAGG - Intergenic
934210689 2:89975556-89975578 CTGAAAGAAAGGAGGGGCCAAGG + Intergenic
934616590 2:95775072-95775094 CAGAGAGGAAGGAGGCTCAAGGG - Intergenic
934644302 2:96049487-96049509 CAGAGAGGAAGGAGGCTCAAGGG + Intergenic
934650120 2:96085836-96085858 CAGAGAGGCAGGAGGGACCAAGG + Intergenic
934837717 2:97605577-97605599 CAGAGAGGAAGGAGGCTCAAGGG + Intergenic
934910726 2:98251917-98251939 CTGAGAGGAAAGAAGAACCAAGG + Intronic
935108884 2:100073441-100073463 CTGAGAGGAAGGTGTTGGCAAGG - Intronic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935604791 2:104959644-104959666 ATGAGATGAAGCAGGTACCTTGG + Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
937249577 2:120515073-120515095 CTGGGAAGAAGGTGGTGCCAGGG - Intergenic
937687987 2:124720124-124720146 CTGGGATGATGGAGGGACCAAGG - Intronic
938108609 2:128549850-128549872 CTGGCAGGCAGGAGGGACCATGG - Intergenic
938217408 2:129531907-129531929 ATTAGAGGGAGGAGGTTCCAAGG + Intergenic
938749457 2:134314745-134314767 CTGAGGAGAAGGACGTTCCAGGG + Intronic
941562021 2:167058562-167058584 CTGAGAGGAAGGACTTGTCAAGG - Intronic
943059944 2:183031864-183031886 CTGAGAGCAAATAAGTACCATGG + Intronic
943732556 2:191318212-191318234 CTGAGAGGCAGGGAGTTCCAGGG + Intronic
945148592 2:206764519-206764541 AGGAGAGGAGGTAGGTACCATGG + Intronic
946393569 2:219431298-219431320 CAGAGAGGATGGAGGGAGCAAGG - Intergenic
947708544 2:232295534-232295556 CTGACAGGAAGAAGGCACTATGG - Intronic
947968561 2:234302631-234302653 ATGAGAGGGAAGAGGTGCCAGGG - Intergenic
1169357277 20:4917754-4917776 CTTAGAGGATGGGGGTAGCATGG - Intronic
1169460490 20:5790202-5790224 CTGGGAGGAAGAAGGTCCCTGGG - Intronic
1172197112 20:33099550-33099572 CAGAGAGCAAGGAGGTAAAAGGG - Intronic
1172498976 20:35411658-35411680 CTGAGGGGAAGCAGGTACATGGG + Intronic
1173619160 20:44423528-44423550 GTGATAGGAAGCAGGAACCAGGG + Intronic
1174816494 20:53691688-53691710 CGAGGAGGAAGGAGGTATCACGG + Intergenic
1176055150 20:63141350-63141372 CTGAGAGGAGAGAGGTGCCAGGG + Intergenic
1178340195 21:31779443-31779465 CTGAGAGAATGGAGGAGCCAGGG - Intergenic
1178953813 21:37006366-37006388 ACCAGAGGATGGAGGTACCAGGG - Intronic
1179589392 21:42396237-42396259 CTGAGAGGGCGGAGGAAGCAGGG + Exonic
1179861278 21:44190634-44190656 CTGAGAAGAAGTAGTTACCCAGG + Intergenic
1180002781 21:45002643-45002665 CCGAGAGGATGGTGGTTCCATGG - Intergenic
1180072676 21:45444167-45444189 TCGGGAGGCAGGAGGTACCATGG - Intronic
1180890980 22:19288840-19288862 CAGAGAGGAAGGAGAAACCCTGG + Intronic
1182309253 22:29393055-29393077 CAGAGTGGTAGGAAGTACCAGGG + Intronic
1183178939 22:36245479-36245501 GTGAGAGGAGGGAGGCACCAAGG + Intergenic
1183316074 22:37137537-37137559 AGGACAGGAAGGAGGAACCAAGG + Intronic
1183645548 22:39124091-39124113 CTGAGAGGGAGGAGGCACAGAGG - Intronic
1183942689 22:41304903-41304925 CTGAGAGGAAGGTGGTGCAGAGG - Intronic
1184409420 22:44317999-44318021 CTGAGAGGGAGCAGGGACCGAGG + Intergenic
1184519253 22:44982819-44982841 CTGTCAGGAAGGAGGCACCTGGG + Intronic
1184797938 22:46742548-46742570 CAGAGAGGCTGGAGGAACCAGGG + Intergenic
1184805894 22:46794675-46794697 CTGGGAGGCAGCAGGTGCCACGG + Intronic
949893408 3:8750337-8750359 CTGAGAGGCAAGAGATTCCAAGG + Intronic
950074419 3:10177276-10177298 CTGAGAGGAATGAGATGCCCAGG + Intronic
950186497 3:10948697-10948719 GGGAGAGGAAGGAGGCCCCAGGG + Intergenic
951057357 3:18163238-18163260 CTGGCTGGAAGGATGTACCAAGG + Intronic
951562418 3:23982012-23982034 CTGAGAGGATGGGGAGACCAAGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952113893 3:30156877-30156899 AAGAGATGAAGGAGGTATCAAGG - Intergenic
952377354 3:32778913-32778935 CTGAGATGAAGGAAGTACAGAGG - Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952857154 3:37781821-37781843 CTGAGAGGATGCAGGCATCAGGG + Intronic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
953923140 3:46965925-46965947 CTGGGAGGGAGGAGGTACTGTGG + Intronic
954373885 3:50184284-50184306 CAGAGAGGAAGGAGATGACAGGG + Intronic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
961611706 3:128144829-128144851 ATGGGGGGAAGGAGGGACCAGGG - Intronic
961671406 3:128534312-128534334 CTGAGAGAGAGGAGGAACCAGGG + Intergenic
962051179 3:131817296-131817318 AGGAGAGGAGGGAGTTACCAAGG + Intronic
962244074 3:133776812-133776834 ATCAGAGGAAGGTGGGACCAGGG + Intronic
965123634 3:164595598-164595620 CTAAGAGGAATGAGGTCACATGG + Intergenic
965132143 3:164714811-164714833 TTGACAGGAAGGTGGAACCAGGG + Intergenic
967838176 3:193981703-193981725 CTAAGAGGAAGGAGGAGCCCAGG - Intergenic
968325253 3:197808286-197808308 CTGAGATGAAGGTGTTAGCAGGG - Intronic
968544711 4:1192885-1192907 CCGAGTGGAAGGAGGTGCCAGGG + Intronic
968786237 4:2624077-2624099 CTGAGCGGGAGGAGGAACCTAGG + Intronic
968813314 4:2809638-2809660 CCGTGAGGCAGGAGGTGCCAGGG + Intronic
970109137 4:12617907-12617929 CAGAGAGGAAGGATGTACATGGG + Intergenic
970665649 4:18333489-18333511 CTGAGAGGCAGGAACTCCCAAGG + Intergenic
970957073 4:21825371-21825393 GTGTGAGGAAGCAGTTACCATGG - Intronic
972105779 4:35485014-35485036 CTGAGAGAATGGAAGTACCTGGG + Intergenic
972160873 4:36225674-36225696 TTGAGAGGAAGGAGGCAGGAGGG + Intronic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
976697581 4:87934938-87934960 TTGAGAGGAAGGAAGTATGAAGG - Intergenic
977246672 4:94639529-94639551 ATGAGAGGGAGGAAGGACCAAGG + Intronic
977574611 4:98663014-98663036 CTGAGAGGAAGGCGGCAGGAGGG - Intergenic
979665295 4:123304426-123304448 CACAGAGGAAGGAGGTCGCAAGG + Intronic
980729874 4:136811837-136811859 CAGAGAGGAACGAGGCAGCATGG + Intergenic
980882323 4:138724484-138724506 CTGAGCAGAAGTAGGTAGCAGGG + Intergenic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981730554 4:147892677-147892699 CTCAGAGGAAGGGGGGCCCAAGG + Intronic
984043156 4:174762865-174762887 CTGATTGTGAGGAGGTACCACGG - Intronic
984287891 4:177756980-177757002 CTGTGAGGAAGCAGGTGGCAAGG - Intronic
986504024 5:8430312-8430334 CTGAGAGCACGGGGGTGCCAGGG + Intergenic
988322975 5:29724310-29724332 CTGGAAGGTAGGATGTACCAAGG + Intergenic
988591018 5:32549576-32549598 TTGAGAGGAAGGAGGAATGAGGG - Intronic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989107507 5:37877663-37877685 CTGGGAGGGAAGAGGTTCCAGGG - Intergenic
990458153 5:56008760-56008782 ATGGGTGGAAGGAGCTACCATGG + Intergenic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
992867811 5:80975233-80975255 CTGAGAGGAGGGAGGTTCACTGG - Intronic
997726945 5:136129390-136129412 CTGAGATGAGTGAGGTTCCAAGG - Intergenic
999648653 5:153744069-153744091 CTGAGTTGAAAGAGGCACCAAGG - Intronic
1001442138 5:171751132-171751154 CTAAGAGGAAGGAGGGATCATGG - Intergenic
1002635263 5:180604311-180604333 GTGAGGGGAAGGAGGAAGCAAGG - Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1003757552 6:9138549-9138571 CTCAGAGGAAGAAGCAACCAGGG - Intergenic
1004367196 6:15022227-15022249 CTGAGGGGAAGCAGCTGCCATGG + Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006611290 6:35295986-35296008 CTGAAAGGATGGAGGGACCCAGG - Intergenic
1007066109 6:38991768-38991790 CTAGGAGGAGGGAGGTTCCAGGG - Intronic
1008851945 6:56033035-56033057 CACAGAGAAAGGAGGTAACAGGG - Intergenic
1010253455 6:73732156-73732178 CTGAGACTAAGGAGGTTCCCAGG - Intronic
1012242282 6:96887371-96887393 CTGTGAGGAAAAAGGTAACAAGG - Intergenic
1013380101 6:109560058-109560080 CTGAGATGAGGGAGTTATCATGG - Intronic
1013537250 6:111074701-111074723 GAGAGAGGAAGGAGGTAGGATGG + Intergenic
1013950229 6:115771252-115771274 CCAAGAGGAATGAGGTAACATGG + Intergenic
1016447123 6:144145795-144145817 GTGAGAGGGAGGAGAGACCAGGG + Intergenic
1017275793 6:152566446-152566468 GTGAGAGGAAGGAGGTGCAGAGG + Intronic
1019522974 7:1468882-1468904 CTGAGTGGAAGCAGGGCCCAAGG - Intergenic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1021233072 7:18109033-18109055 ATGAAAGGAATAAGGTACCATGG + Intronic
1022311581 7:29201186-29201208 CTGAGAGCAAGGAGGAACCTTGG + Intronic
1023325815 7:39054610-39054632 TTAAGAGGAAGGAGTTACAATGG + Intronic
1024385313 7:48744509-48744531 CTGAGAGTGAGTAGGTACCAGGG + Intergenic
1026980347 7:74523019-74523041 CTCAGATGTAGGAGGTACAAGGG + Intronic
1028694615 7:93694212-93694234 CTGGGAGGAGGAAGATACCAGGG - Intronic
1028889189 7:95967809-95967831 CTGAGGGGAAGCATGAACCAAGG + Intronic
1030412848 7:109203510-109203532 CAGGGAGGAAGGAGGTAAGAAGG + Intergenic
1031920252 7:127595153-127595175 CTGACAGCAAGGAGATACCAGGG + Intronic
1032356465 7:131215737-131215759 CTGTGATGATGGAGATACCATGG + Intronic
1032839060 7:135699606-135699628 ATGAGAGGCAGGAGGCACCATGG + Intronic
1033286894 7:140049202-140049224 CTGAGAGGACTGAGGGAACAAGG + Intronic
1034461338 7:151199601-151199623 TTGGGAGGAAGGAGGGGCCAGGG - Intronic
1035645050 8:1212332-1212354 CTGAGAGGAAGGAGGACCTCTGG - Intergenic
1036475846 8:9092637-9092659 CTGAGAGCAGGAAGGAACCAGGG + Intronic
1036685143 8:10904589-10904611 AGGAGAGCAAGGAGGTGCCACGG + Intronic
1037675710 8:21049253-21049275 AGGAGAGGAAGGAGTTAACAGGG - Intergenic
1038310018 8:26439313-26439335 CTGAGAGGCAGGAGGTGCTTGGG + Intronic
1038596518 8:28890817-28890839 TTGAGAGGAGGGAGGAAGCAGGG + Exonic
1038658495 8:29475837-29475859 CTTAGAGGAAGAAGTCACCAAGG - Intergenic
1038960815 8:32517457-32517479 TTGAGAGGAAGGAGGCCCCGTGG + Intronic
1039978017 8:42383597-42383619 CTTTGAGGAAGGAGGGTCCAGGG - Intergenic
1042182699 8:66107824-66107846 CTGGGAGGAAGGAGGTTGAAAGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1043486270 8:80702015-80702037 CTGACAGGAAGGAGCTAGTAGGG + Intronic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048986550 8:139737998-139738020 TTGAGAGGAAGGACGCAGCAGGG + Intronic
1049317985 8:141979801-141979823 CTGAGAGGACCGAGGGCCCAGGG - Intergenic
1049786237 8:144452161-144452183 CTGAGTGGAAGGAGGGGCCGAGG - Intronic
1050697007 9:8290769-8290791 CTGAGAGAAAGGAGGCTACAGGG + Intergenic
1050725300 9:8642696-8642718 TTGAGGGGAATGAGTTACCATGG + Intronic
1052191128 9:25663764-25663786 ATAAGAGGAATGAGGTACCTAGG + Intergenic
1052282952 9:26753887-26753909 GAGAGAGGGAGGAGGTGCCAGGG + Intergenic
1053364337 9:37511986-37512008 CTGGGAGGAAGGAAGGACCTGGG - Exonic
1053522092 9:38790808-38790830 CTGAGAGGAACCAGGAACCACGG + Intergenic
1054194319 9:62015272-62015294 CTGAGAGGAACCAGGAACCACGG + Intergenic
1054644088 9:67573418-67573440 CTGAGAGGAACCAGGAACCACGG - Intergenic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1055795782 9:79973476-79973498 ATGGGAAGAAGGAGGTAGCAAGG + Intergenic
1055999185 9:82195614-82195636 CTGAGAGTAATGTGGTATCAAGG + Intergenic
1056753569 9:89368463-89368485 CTGGGAGGGAGGAGGGGCCATGG - Intronic
1057014947 9:91643086-91643108 CTAAGAGGAAGGTGCTCCCAGGG + Intronic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057949388 9:99357751-99357773 CTGAGGGGAAGGAGGCTCCAGGG - Intergenic
1058257242 9:102782750-102782772 CTGAGAGGACTGAGGTCACAGGG + Intergenic
1058380181 9:104368954-104368976 CTGAGAGGTAGGAGCTCCCAGGG - Intergenic
1058682428 9:107451877-107451899 CTGAAAGGCAGGTGGAACCAGGG - Intergenic
1059873258 9:118601900-118601922 CAGAGCAGAAGGAGGTGCCATGG - Intergenic
1059999519 9:119945466-119945488 CTGGGAGGAACAAGGGACCAGGG + Intergenic
1060984791 9:127813777-127813799 CCAAGAGGAAGGAGAGACCAAGG - Exonic
1060988959 9:127837448-127837470 CAGAAAGGCTGGAGGTACCAGGG - Intronic
1061357497 9:130117731-130117753 CAGAGAGGAAGCAGGCAACAAGG + Intronic
1061489511 9:130937528-130937550 CTGAGAGGAAGGGACCACCAAGG + Intronic
1062207072 9:135343102-135343124 CTGAGAGGCAGGAGGAAGCTGGG - Intergenic
1062561629 9:137144744-137144766 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561691 9:137144920-137144942 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561711 9:137144977-137144999 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561731 9:137145034-137145056 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561754 9:137145091-137145113 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561776 9:137145148-137145170 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561798 9:137145205-137145227 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561818 9:137145262-137145284 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561838 9:137145319-137145341 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1187154542 X:16711604-16711626 TTGACAGAAAGGAGGTACCAGGG + Exonic
1189299759 X:39944011-39944033 CTGAGTTGAATGAGGTATCAAGG + Intergenic
1189335799 X:40170043-40170065 CTGCGAGGAAGGAGGTCACGAGG + Intronic
1190353376 X:49581998-49582020 ATGAGAGAATGGAGGTGCCAGGG + Intronic
1190354481 X:49591550-49591572 ATGAGAGAATGGAGGTGCCAGGG + Intronic
1190462883 X:50696119-50696141 CTTTGAGGAAGGAGGCAACATGG + Intronic
1190737428 X:53264752-53264774 CAGAGAGGAAGGAGATGTCAAGG - Intronic
1191880824 X:65842443-65842465 CTGATAGGAAGGAGGAAGGAGGG - Intergenic
1192417838 X:71000022-71000044 ATGAAAGGAAGGAGGTAGAAAGG - Intergenic
1194130374 X:90074100-90074122 CTGACAAGAAAGAGGTATCAAGG + Intergenic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1197799011 X:130329514-130329536 ATGAGATCAGGGAGGTACCAGGG - Intergenic
1198325942 X:135573300-135573322 GTGAGAGGAAGGAGGAATGAAGG + Intronic
1199791722 X:151161319-151161341 CTGCCAGGAAGTAGGCACCAAGG - Intergenic
1199800672 X:151248014-151248036 GAGAAAGGAAGGAGGAACCAAGG + Intergenic
1200001044 X:153059909-153059931 ATGACAGGAAGGAAGCACCAGGG + Intronic
1200207135 X:154324589-154324611 CTGACTGGAAGGAGGCACAAGGG + Intronic