ID: 980959017

View in Genome Browser
Species Human (GRCh38)
Location 4:139455940-139455962
Sequence AAACTGGGTCTCACATCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980959010_980959017 -2 Left 980959010 4:139455919-139455941 CCCAAGACTGTCCAGGTTTTAAA 0: 1
1: 1
2: 9
3: 32
4: 293
Right 980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
980959008_980959017 7 Left 980959008 4:139455910-139455932 CCAACTTTGCCCAAGACTGTCCA 0: 1
1: 0
2: 2
3: 35
4: 211
Right 980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
980959007_980959017 21 Left 980959007 4:139455896-139455918 CCTTACTAGGGTGACCAACTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
980959011_980959017 -3 Left 980959011 4:139455920-139455942 CCAAGACTGTCCAGGTTTTAAAA 0: 1
1: 2
2: 7
3: 50
4: 338
Right 980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980959017 Original CRISPR AAACTGGGTCTCACATCCCG GGG Intronic
904019022 1:27448044-27448066 AGACTGGCTCACACACCCCGCGG + Intronic
905082916 1:35340774-35340796 AAACTGGGCCTCACAGCAGGAGG - Intronic
905335056 1:37239297-37239319 AAGCTGGGCCTGACATCCCTAGG - Intergenic
912315288 1:108662235-108662257 AGACGGGGTCTCACACTCCGGGG - Intergenic
919763857 1:201114340-201114362 AAAGTCGGGCTCGCATCCCGGGG + Exonic
920146722 1:203867742-203867764 AAACTGGGTCACACAGCAAGAGG - Intronic
921608153 1:217179049-217179071 CAACTGGGTGTCAGATCCCTTGG - Intergenic
923080359 1:230647434-230647456 AAACTGGGGCCCACATCTCCAGG - Intronic
923674222 1:236065662-236065684 AAACGGGGTCTCACCCTCCGAGG + Intergenic
1074509454 10:114099474-114099496 AAACTGGGTCTGACCTCTCAGGG + Intergenic
1076200661 10:128555065-128555087 AAAGTGGGTCTCACCTCTCATGG - Intergenic
1076894588 10:133303637-133303659 ACACTGGTTCTCAGAGCCCGCGG + Intronic
1077187949 11:1243812-1243834 ACACTGGGGCTCACAGCCCATGG - Exonic
1077188375 11:1245483-1245505 ACACTGGGGCTCACAGCCCATGG - Exonic
1077188906 11:1247583-1247605 ACACTGGGGCTCACAGCCCGTGG - Exonic
1077189331 11:1249254-1249276 ACACTGGGGCTCACAGCCCGTGG - Exonic
1084170291 11:67397621-67397643 GAACTGGGTCTCTCAGCCCTGGG + Exonic
1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG + Intronic
1098660564 12:73087920-73087942 ATACTGGGCATCACATCCCTAGG + Intergenic
1103240957 12:119413012-119413034 AGAGTGGTTGTCACATCCCGGGG + Intronic
1106424568 13:29613678-29613700 AAACTGGTTCTCATATCCACAGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1124386285 15:29210418-29210440 GAACTGGGTCTCACAGCAGGAGG + Intronic
1127198862 15:56621437-56621459 AAATTGGGGATCACCTCCCGAGG - Intergenic
1130859673 15:87875194-87875216 ACACTGGAGCTCACCTCCCGGGG - Intronic
1131872445 15:96776344-96776366 AAACAGGCTCTCACTCCCCGGGG - Intergenic
1132146027 15:99430446-99430468 CAACTGGGGCTCACTTCCAGGGG - Intergenic
1143638765 17:8182983-8183005 AAACTGGTTCTTAGATCCAGTGG + Intergenic
1145272697 17:21413186-21413208 AAGCTGGGTCACACAGACCGGGG + Intronic
1145310905 17:21700649-21700671 AAGCTGGGTCACACAGACCGGGG + Intronic
1150150824 17:62807966-62807988 AAACCGGGCCTGACATCCGGTGG - Intronic
1151240004 17:72750171-72750193 CAAGAGGGTCTCACATCCCCAGG + Intronic
1159529559 18:69638260-69638282 AAACTGTGGCTCACAGCCTGTGG - Intronic
1159630499 18:70744092-70744114 AACCTGGGTTTCACACCCCCAGG - Intergenic
1161205632 19:3039834-3039856 ACACTGGGTCTCACAGCCTCTGG - Intronic
1162147648 19:8622580-8622602 AATCTGGGTCTCAGATTCTGTGG - Intergenic
1162920077 19:13895830-13895852 AAACTGGGACTCACAGCCACCGG + Intronic
1164730466 19:30500296-30500318 AATGTGGGTCTCACAACCCTGGG + Intronic
1164730524 19:30500688-30500710 AATGTGGGTCTCACAACCCCAGG + Intronic
1165093385 19:33397834-33397856 GAGCTGGGTCTCCCATCCCGTGG - Intronic
1165141423 19:33702555-33702577 AAACTGGGTCTCCCATTATGTGG + Intronic
935715260 2:105933747-105933769 CTACTGGGTCTCACCTCCTGGGG + Intergenic
936790057 2:116140678-116140700 AGACTTGGTCTCATACCCCGTGG - Intergenic
948686651 2:239674595-239674617 CACCTGGGTCTCACGTGCCGGGG - Intergenic
1180142318 21:45900028-45900050 AAACTGGGCCTTACTTCCCCCGG - Intronic
953789485 3:45936586-45936608 ACACAGGGTCTCACATCCTGGGG + Intronic
956731072 3:72197316-72197338 ACACTGGTTCTCACTTCCCTGGG - Intergenic
965671854 3:171155890-171155912 AAACCGGGTTTCAGATCCAGGGG - Intronic
965962482 3:174444625-174444647 ACATTGAGTCTCACCTCCCGTGG + Intronic
968660932 4:1798393-1798415 CAAGTGGGTCTCACAGGCCGGGG - Intronic
971403471 4:26298284-26298306 CAATTGAGTCTCACATCCTGTGG + Intronic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG + Intronic
984884959 4:184441961-184441983 AAACTGGGGTTCACATCAAGAGG + Intronic
991196424 5:63939352-63939374 AAACTGGTTCACACATTCAGTGG + Intergenic
995305386 5:110640971-110640993 AAATTGGGTCTCAAAACCCTGGG - Exonic
995922866 5:117334495-117334517 GAACTGGGTCTCACAGCAGGAGG - Intergenic
1004776518 6:18852098-18852120 AAACTGGGCCTCACTTCCACTGG + Intergenic
1006449500 6:34098021-34098043 AAGCTGGGTCACACAGCCCTGGG - Intronic
1007053301 6:38855784-38855806 AAACTGGGTCGCACAGCAGGAGG + Intronic
1013365067 6:109430963-109430985 CAAGTGTGTCTCACAGCCCGTGG - Intronic
1016985337 6:149890662-149890684 GAACTGGGTGTAACATCCCAGGG + Intronic
1018633609 6:165841580-165841602 AGGCTGTGTCTCCCATCCCGGGG + Intronic
1020385151 7:7592837-7592859 AAACTGGGTCACACAGCAGGAGG - Intronic
1021989511 7:26128570-26128592 AGACAGGGTCTCACATCCTCTGG - Intergenic
1024872787 7:53985018-53985040 ACACTGGCTCTCACATCCTCAGG - Intergenic
1025160474 7:56654962-56654984 GCACTGGGTCTCACACCCCAGGG - Intergenic
1029631614 7:101754855-101754877 ATATCGGGTCTCACATCGCGAGG - Intergenic
1043012179 8:74894585-74894607 AAAGTGGGTCACACATCCAGAGG - Intergenic
1046129963 8:109954696-109954718 AAACTGGTTCTCTCATTCCCAGG + Intergenic
1049304579 8:141894232-141894254 ATAATGGGTCTCACATTCCCGGG - Intergenic
1049635232 8:143684619-143684641 ACGCTGGGTCTCACAGCCCTGGG - Intronic
1057964657 9:99491356-99491378 AAACTGGGTCTCACCTGAGGTGG + Intergenic
1061650267 9:132042148-132042170 AAACTGAGTCCCAGATCCTGTGG - Intronic
1061837809 9:133341092-133341114 AGGCCGGGTCTCCCATCCCGAGG - Exonic
1062640313 9:137515313-137515335 AGCCTGGGTCTCAGATGCCGAGG + Intronic
1186996426 X:15128468-15128490 AAACTGGGTCTCACTTGGAGAGG - Intergenic
1188205340 X:27349450-27349472 AAATTGTGTCTTACATACCGGGG - Intergenic