ID: 980963558

View in Genome Browser
Species Human (GRCh38)
Location 4:139499654-139499676
Sequence GTTTTTAAGGGTACTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1569
Summary {0: 1, 1: 12, 2: 185, 3: 466, 4: 905}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980963558_980963563 -3 Left 980963558 4:139499654-139499676 CCCACCAAAGTACCCTTAAAAAC 0: 1
1: 12
2: 185
3: 466
4: 905
Right 980963563 4:139499674-139499696 AACCCCAGCCTCTAAATTCTTGG No data
980963558_980963564 -2 Left 980963558 4:139499654-139499676 CCCACCAAAGTACCCTTAAAAAC 0: 1
1: 12
2: 185
3: 466
4: 905
Right 980963564 4:139499675-139499697 ACCCCAGCCTCTAAATTCTTGGG 0: 1
1: 1
2: 14
3: 71
4: 395
980963558_980963568 2 Left 980963558 4:139499654-139499676 CCCACCAAAGTACCCTTAAAAAC 0: 1
1: 12
2: 185
3: 466
4: 905
Right 980963568 4:139499679-139499701 CAGCCTCTAAATTCTTGGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980963558 Original CRISPR GTTTTTAAGGGTACTTTGGT GGG (reversed) Intronic
900567174 1:3339257-3339279 GTCTTTGATGGTACTGTGGTGGG - Intronic
900847409 1:5114935-5114957 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
901290895 1:8123557-8123579 GTTTTTAAAGATAATTTGGTGGG + Intergenic
901383709 1:8892714-8892736 GTTTTTGAGGATAATTTGGTGGG - Intergenic
901413021 1:9098237-9098259 GTTTTTAAAGATAATTTGGTGGG - Intergenic
901461012 1:9391888-9391910 GTTTTTAAGGATAACTTGGTGGG - Intergenic
901479280 1:9513479-9513501 GTTTTTAAGAATAACTTGGTGGG - Intergenic
901495975 1:9622189-9622211 GTTTTTAAAGATAGTTTGGTGGG - Intergenic
901702211 1:11051499-11051521 GTTTTTAAGGATAACCTGGTGGG + Intergenic
902637823 1:17746500-17746522 GTTTTTAAGGATAACTTGTTGGG - Intergenic
903039874 1:20521308-20521330 GTTTTAAAGGATAACTTGGTGGG - Intergenic
903099090 1:21012555-21012577 TTTTACAAAGGTACTTTGGTCGG - Intronic
903514296 1:23900260-23900282 GTTTTTAAGGACAGTTTGTTTGG - Intronic
903514388 1:23900868-23900890 GATTTTAAGGACAATTTGGTTGG - Intronic
904303330 1:29570399-29570421 GTTTTTAAGGATAACTTGGTGGG + Intergenic
904531521 1:31172869-31172891 GTTTTTAAGGATAATTTAGTGGG - Intergenic
904733639 1:32613578-32613600 GTTTTTAAGGACAACTTGGTGGG - Intronic
905494655 1:38375322-38375344 GCTTTTAAGGATTGTTTGGTGGG + Intergenic
905499725 1:38426897-38426919 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
906019782 1:42617580-42617602 GTTTTTAAGGAAAATTTGGTGGG + Intronic
906390559 1:45411694-45411716 GTTTTTATGGACAATTTGGTGGG - Intronic
906454407 1:45981382-45981404 TTTTTTAAGGATAGTTTGGTGGG + Intronic
906486370 1:46238513-46238535 GTTTTTAAAGATAATTTGGTAGG + Intergenic
907120928 1:52007337-52007359 ATTTTTAAGGATAATTTGGAGGG + Intergenic
907133703 1:52119615-52119637 GTTTTTAAAGATAATTTGGCGGG - Intergenic
907254244 1:53166383-53166405 GTTTGTAAGTGTTGTTTGGTGGG + Intergenic
907510071 1:54951307-54951329 GTTTTTAAAGATAATTTGGCAGG + Intergenic
908056936 1:60297918-60297940 GTTTTTAAGAGTACTGTGGTCGG - Intergenic
908069311 1:60440889-60440911 GTTTTTAAGGACAACTTGGTGGG - Intergenic
908227048 1:62066783-62066805 GTTTTTATGGACAGTTTGGTGGG + Intronic
908240342 1:62183929-62183951 GTTTTTAAGGATAACTTGGTGGG + Intergenic
908241511 1:62192880-62192902 GTTTTTAAGGACAACTTGGTGGG + Intergenic
908271230 1:62424582-62424604 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
908546103 1:65163788-65163810 GTTTTTAAAGATAATTTGGTGGG + Intronic
908554410 1:65243281-65243303 GTTTTTAAGAAAAATTTGGTGGG - Intergenic
908761670 1:67518428-67518450 GTTTTTAAGGACAACTTGGTGGG - Intergenic
910309636 1:85808883-85808905 GTTTTTATGGACAATTTGGTGGG + Intronic
910604507 1:89068326-89068348 GTTTCTGAGGATAATTTGGTGGG + Intergenic
910631459 1:89359355-89359377 GTCTTTAAAGATACTTTTGTAGG + Intergenic
910689700 1:89953482-89953504 GTTTTTATGGATAATTTGGTGGG - Intergenic
910794479 1:91084386-91084408 GTTTTTAAGGATAACTTGGTGGG - Intergenic
910795186 1:91090817-91090839 GTTTTTAAGGATAACTTGGTGGG - Intergenic
910796538 1:91103009-91103031 GTTTTTGAGGATAACTTGGTGGG + Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911331124 1:96526729-96526751 GTTTTTAAAGATAATTTGGCAGG - Intergenic
911696027 1:100891477-100891499 GTTTTTAAGGATAATCTGTTGGG + Intronic
911797942 1:102097751-102097773 GTTTGTAAAGATAATTTGGTGGG - Intergenic
911798140 1:102099754-102099776 CTTTTTAGGGATAATTTGGTGGG - Intergenic
911841563 1:102688601-102688623 TTTTTTAAGAGTGATTTGGTGGG - Intergenic
912014640 1:105017682-105017704 GTTTTTAAGGACAACTTGGTGGG + Intergenic
912020841 1:105107608-105107630 GATTTTAAGGATAATTTTGTGGG - Intergenic
912146378 1:106799066-106799088 GGTTTTATGGATAATTTGGTGGG + Intergenic
912346709 1:108969589-108969611 GTTTTTAAGGATAATTTGGTGGG - Intergenic
912461095 1:109832114-109832136 GTTTTTAAGGATAACTTGGTGGG - Intergenic
912537179 1:110383395-110383417 GTTTTTAAGGATAATTTGGTGGG + Intronic
912583688 1:110742518-110742540 GTTTTTAAAGATAATTTGGCGGG + Intergenic
912824543 1:112893796-112893818 GTTTTTGAGGATAATTTGGTGGG + Intergenic
912988443 1:114458580-114458602 TTTTTAAAGGATAGTTTGGTGGG - Intronic
913066299 1:115258578-115258600 GTTTTTATGGATAATCTGGTGGG - Intergenic
913126914 1:115799556-115799578 GTTTTAAAGGATAGTTTGGTGGG - Intergenic
913289874 1:117262162-117262184 GTTTTTAAAGATAATTTGGCAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914377639 1:147086276-147086298 GTTTTCAAGGATAATTTGGTGGG + Intergenic
914409314 1:147410220-147410242 GTTTTTAAAGATAATTTGGTAGG - Intergenic
914511066 1:148332458-148332480 TTTTTTAAGGATAGTTTGGCAGG - Intergenic
914511503 1:148336293-148336315 GTTTTTAGGGATAATTTGGTGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914930022 1:151922683-151922705 TTTTTTAGGGATAATTTGGTGGG + Intergenic
915012400 1:152699510-152699532 ACTTTTAAGGATGCTTTGGTAGG + Intergenic
915640919 1:157225419-157225441 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
916041960 1:160969272-160969294 TTTTTCAAAGGTAGTTTGGTGGG - Intergenic
916124249 1:161555255-161555277 GTTTTTAAGGACAACTTGGTTGG + Intergenic
916126030 1:161572170-161572192 TTTTTCATGGGTACTTTGGTGGG - Intergenic
916134130 1:161636614-161636636 GTTTTTAAGGACAACTTGGTTGG + Intronic
916135946 1:161654017-161654039 TTTTTCATGGGTACTTTGGTGGG - Intronic
916260653 1:162838944-162838966 TTTTTCAAGGATAGTTTGGTGGG - Intronic
916576511 1:166071816-166071838 CTGTGTAAGGGTACTTTGGGAGG - Intronic
916688305 1:167167660-167167682 GTTTTTAAGGACAACTTGGTGGG + Intergenic
916895956 1:169162134-169162156 GTTTTTATGGACAATTTGGTGGG - Intronic
916912417 1:169365226-169365248 GTTTTCAAGGATAATTTTGTGGG - Intronic
916918433 1:169437067-169437089 GTTTTTAAGGACAATTTGGTGGG + Intronic
916961747 1:169895893-169895915 GTTTTTAAAGACAATTTGGTGGG - Intergenic
916980724 1:170134059-170134081 GATTTTAATAGTACTTTGGCAGG - Intergenic
917472113 1:175334727-175334749 GTTTTTATGGATAATTTGGTGGG - Intronic
917557294 1:176102956-176102978 GATTTTTAGGATAATTTGGTGGG - Intronic
917805616 1:178610886-178610908 GTTTTTAAGGATAACTTGGTAGG + Intergenic
918019909 1:180677362-180677384 GTTTATAAGGATAATTTGGTGGG + Intronic
918452553 1:184673525-184673547 ATTTTTAAGGATAATTTGGTGGG - Intergenic
918567730 1:185952194-185952216 CTTTTTAAGGGTAAATTGCTGGG + Intronic
918597508 1:186308789-186308811 GGTTTTTTGGGTGCTTTGGTTGG - Exonic
918621566 1:186611539-186611561 GTTTTTATGGATAATTTGGTGGG - Intergenic
918623671 1:186633848-186633870 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
918719952 1:187840177-187840199 GTTTTCAAGTATAATTTGGTGGG - Intergenic
919468750 1:197952972-197952994 GTTTTTAAGGATAATTTGGTGGG - Intergenic
919540832 1:198843341-198843363 GTTTTTATGGATAATTTGGCAGG + Intergenic
919771947 1:201167302-201167324 TTTTTCAAAGGTAGTTTGGTGGG + Intronic
920331110 1:205209156-205209178 GGTTTTCAAGGCACTTTGGTTGG - Intronic
920927864 1:210359607-210359629 TTTTTTAAGGATAATTTGGCAGG - Intronic
921403864 1:214757510-214757532 GTTTTTATGGATAATTTGGTGGG + Intergenic
921420974 1:214947944-214947966 ATTTTAAAGGATAATTTGGTGGG + Intergenic
921522149 1:216168924-216168946 GTTTTTAAGAGTAATTTGGCTGG - Intronic
921686926 1:218100412-218100434 GATTTTGAGGGTGTTTTGGTGGG - Intergenic
921771261 1:219042414-219042436 GTTTTTATGGATAATTTGGTGGG - Intergenic
921883096 1:220276061-220276083 ATTTTTAAGGATAACTTGGTGGG - Intergenic
922107081 1:222521843-222521865 GTTTTTATGGATAGTTTGGTGGG - Intergenic
922160412 1:223075553-223075575 GTTTTTAAGGATAATTTGGTGGG + Intergenic
922389080 1:225120135-225120157 GTTTTTAAGGATAATTTGGCAGG + Intronic
923130693 1:231072189-231072211 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
923483720 1:234408752-234408774 GTTTTTAAGGATAATTTGGTGGG - Intronic
923702814 1:236316163-236316185 GTTTTTGAGGATAATTTGGTGGG - Intergenic
923709050 1:236370539-236370561 GTTTTTAAGGATGACTTGGTGGG + Intronic
923840042 1:237660831-237660853 GTTTTTAAAGATTCTTTGATTGG - Exonic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924140940 1:241022661-241022683 GTTTTTAAGGATAATTTGGTGGG - Intronic
924288429 1:242512104-242512126 GCCTTTAAGAGTATTTTGGTGGG + Intronic
924483750 1:244460503-244460525 GTTTTTAAGGATAACTTGGTGGG - Intronic
924512111 1:244736239-244736261 GTTTTTAAGGATAATTTGGTGGG + Intergenic
924512626 1:244740347-244740369 GTTTTTAAGGATAATTTGGTGGG - Intergenic
924807834 1:247375355-247375377 GGTTTTAAGGACAATTTGGTGGG - Intergenic
924809034 1:247384857-247384879 GTTTTTAAGGATAACTTGGTCGG + Intergenic
924809367 1:247387783-247387805 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
1062804473 10:407020-407042 GTTTTTAAGGATAACTTGGCGGG - Intronic
1063038845 10:2316410-2316432 GTTGTAAAGGATAATTTGGTGGG - Intergenic
1063155039 10:3371601-3371623 GCTTTTAAGGATAGTTTGGTGGG + Intergenic
1063195816 10:3741756-3741778 GTTTTTGAAGATAATTTGGTGGG + Intergenic
1063482793 10:6391137-6391159 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1063513832 10:6674085-6674107 GTTTTAAAGGGTTATTTGTTTGG + Intergenic
1064767002 10:18685218-18685240 GGTTTTAAAGATAATTTGGTAGG - Intergenic
1064804871 10:19119440-19119462 GTTTTTAAGGATAACTTGGTGGG + Intronic
1064858469 10:19797895-19797917 GTTTTTATGGATAATTTGGTGGG - Intergenic
1064941304 10:20739011-20739033 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1065007750 10:21395340-21395362 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1065207896 10:23374539-23374561 GTTTTTATGGACAATTTGGTGGG + Intergenic
1065217060 10:23459342-23459364 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1065799929 10:29342800-29342822 GTTTTCAAGGATAGTTTGGTGGG - Intergenic
1065901324 10:30210671-30210693 GGTTTTAAGGATGATTTGGTGGG + Intergenic
1067104344 10:43355991-43356013 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1067399929 10:45962312-45962334 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1067469246 10:46524061-46524083 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1067823409 10:49550650-49550672 ATTTTTAAGGATAGTTTGGTGGG + Intergenic
1067868259 10:49931611-49931633 GTTTTTAAGGATAATTTGGTGGG - Intronic
1067895290 10:50173019-50173041 GTTTTTAAAGATTATTTGGTGGG + Intergenic
1067953695 10:50768959-50768981 GTTTTTAAAGATAATTTGGTGGG - Intronic
1068090281 10:52425015-52425037 GTTTTTAAGGATTACTTGGTAGG + Intergenic
1068151735 10:53140885-53140907 GTTTTTAAGGATAGTTTGGCAGG - Intergenic
1068276124 10:54799580-54799602 ATGTTTAAGGGTAATTTGGGGGG + Intronic
1068522884 10:58096358-58096380 TTTTTCAAGGATAGTTTGGTAGG - Intergenic
1068526674 10:58138286-58138308 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1068964339 10:62896570-62896592 GTCTTTTAGGATACTCTGGTGGG + Intronic
1068985776 10:63106468-63106490 GTTTTTAAGGACAAGTTGGTGGG - Intergenic
1069136549 10:64773418-64773440 GTTTTTAAGGTTAATTTGGTGGG + Intergenic
1069196708 10:65560116-65560138 GTTTTTAAAGATAATTTCGTGGG + Intergenic
1069219074 10:65860618-65860640 ATTTTCAAGGTTACTTCGGTAGG + Intergenic
1069323680 10:67204819-67204841 TTTTTCAAGGATAGTTTGGTGGG + Intronic
1069542246 10:69303860-69303882 AGTTTTAAGGATAATTTGGTGGG + Intronic
1069936458 10:71920829-71920851 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1070016797 10:72541626-72541648 GTTTTTATGGATAGTTTGGTGGG - Intronic
1070406168 10:76098820-76098842 GTGTTTAAGGACAATTTGGTGGG + Intronic
1070510546 10:77156927-77156949 GTTTTTCAGGATGGTTTGGTGGG - Intronic
1071186696 10:83054395-83054417 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1071217513 10:83425400-83425422 GTTTTCAAGAATAGTTTGGTAGG + Intergenic
1071219363 10:83445664-83445686 GTTTTTATGGACAATTTGGTGGG - Intergenic
1071275580 10:84051408-84051430 GTTTTTAAAGATAATTTGGCGGG - Intergenic
1071424311 10:85533051-85533073 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1071551451 10:86569281-86569303 GTTTTTAAGGACAATTTGGTGGG + Intergenic
1071589155 10:86855298-86855320 GTTTTGAAGGAGACTTTGATTGG - Intronic
1071936084 10:90531815-90531837 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1071959820 10:90799245-90799267 GTTTTTAAGGAAAATTTGGTGGG - Intronic
1072118467 10:92385740-92385762 ATTTTTAAGAGTACTTTGGTGGG + Intergenic
1072120591 10:92402451-92402473 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1072121338 10:92407792-92407814 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1072275681 10:93820466-93820488 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1072279512 10:93853061-93853083 GTTTTTAAGGCTAATTTGGTGGG - Intergenic
1072584851 10:96772521-96772543 GTTTTTATGGCAAATTTGGTGGG - Intergenic
1072767423 10:98106852-98106874 TTTTTTAAGGACACTTTGGAGGG - Intergenic
1072770370 10:98132876-98132898 GTTTTTATGGACATTTTGGTGGG + Intergenic
1072970409 10:100012307-100012329 GTTTTTAAAGATAATTTGGCTGG + Intergenic
1072973409 10:100037191-100037213 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1073931385 10:108580578-108580600 GTTTTTAAGAATAGTTTGGTGGG - Intergenic
1074011831 10:109490001-109490023 GTTTTTATGGACAATTTGGTGGG - Intergenic
1074515856 10:114168678-114168700 TTTTTTAAGGATAATTTGGTGGG - Intronic
1074972923 10:118556172-118556194 ATTTTTAAGGGTATTTTTGCTGG + Intergenic
1075883531 10:125876211-125876233 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1075975724 10:126692406-126692428 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1076099690 10:127766184-127766206 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1076100862 10:127776957-127776979 GTTTTTAAGAATATCTTGGTAGG + Intergenic
1076653386 10:132005303-132005325 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1076823685 10:132956412-132956434 GTCTTTAAGGATAATTTGATGGG - Intergenic
1076901934 10:133343639-133343661 ATTTTAAAGGATAATTTGGTGGG + Intronic
1077085164 11:746596-746618 GTATTTAAGAATAATTTGGTGGG - Intergenic
1077335921 11:2004314-2004336 GTTTTTAAGGATCATTTGGTGGG - Intergenic
1077790019 11:5429193-5429215 TTTTTCAAGGGTAGTTTGGTGGG - Intronic
1077879708 11:6339346-6339368 GTTTTTAAGGACAATTTGGCAGG + Intergenic
1077885414 11:6383870-6383892 GTTTTTTAGGATAATTTGGTGGG - Intergenic
1077938267 11:6813325-6813347 GTTCTAAAGGGTGTTTTGGTGGG + Intergenic
1078098842 11:8317223-8317245 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1078410070 11:11107339-11107361 GTTTTTAAGAATAATTTGGTGGG - Intergenic
1078751141 11:14164763-14164785 GATTTTAAGGATAACTTGGTGGG + Intronic
1078752420 11:14177344-14177366 GTTTTTAAGGATAGCTTGGTGGG + Intronic
1078834243 11:15011790-15011812 GTTTTTAAGGATAATTTGGTGGG + Intronic
1078835688 11:15027025-15027047 GTTTTTAAGGATAATTTGGTGGG + Intronic
1079061595 11:17253415-17253437 GTTTTTAAGGATAACTTGGCAGG + Intronic
1079132951 11:17760108-17760130 ATTTTTAAGGGTTCTGTGGTAGG - Intronic
1079232235 11:18658763-18658785 ATTTTTAAGAATAATTTGGTGGG - Intergenic
1079233391 11:18669353-18669375 GTTTTTAAGGTTAATTTGGTGGG + Intergenic
1079493255 11:21012656-21012678 GTTTTTAAAGATAGTCTGGTGGG + Intronic
1079499170 11:21083157-21083179 GTTTTTATGGGGCCATTGGTAGG + Intronic
1079696779 11:23491600-23491622 GTTTTTAGGGATAATTTGGCAGG - Intergenic
1079725282 11:23872755-23872777 TTTTTCAAGGATAGTTTGGTAGG - Intergenic
1079884792 11:25973485-25973507 GATTTTAAGGATAATTTGGTAGG - Intergenic
1079891251 11:26055792-26055814 GTTTTTAAGAATAATTTGGTGGG - Intergenic
1080028748 11:27638579-27638601 GTTTTCAAGGATAATTTGGTGGG + Intergenic
1080075353 11:28141145-28141167 GTTTTTAGCGGTAATTTGGTGGG + Intronic
1080219297 11:29881626-29881648 GTTTTTAAGGGTGGTTTAGTGGG - Intergenic
1080224658 11:29947263-29947285 GTTTTTAAGGATAATTTGACAGG + Intergenic
1080250392 11:30227167-30227189 GGTTTTATGGATAATTTGGTGGG + Intergenic
1080703445 11:34666008-34666030 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1080821212 11:35808341-35808363 TTCTTTTAGGGTACTTTTGTTGG - Exonic
1080990866 11:37533162-37533184 CTTTTTAAGGATAATTTGGTAGG + Intergenic
1081028490 11:38046779-38046801 GTTTTTAAAGATAGTTTGGCAGG + Intergenic
1081185074 11:40032475-40032497 GTTTTTAAGGATAGTTTGGAGGG + Intergenic
1081530869 11:43958441-43958463 GTCTTTCAGGATAATTTGGTGGG - Intergenic
1082051802 11:47776531-47776553 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1082126698 11:48440607-48440629 GATTTTAAGGGTACATGGGCAGG + Intergenic
1083401845 11:62428887-62428909 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1084181259 11:67447630-67447652 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1084249323 11:67884166-67884188 GTTTTTAAGATTAATTTTGTAGG + Intergenic
1084405849 11:68972723-68972745 GTTTTTAAAGATCATTTGGTGGG + Intergenic
1084414538 11:69023729-69023751 GTTTCTAGGGGTACAATGGTGGG - Intergenic
1084800951 11:71543549-71543571 GTTTTTAAGGGCAACTTGGTGGG + Intronic
1085416766 11:76323683-76323705 GTTTTGAAGGATAACTTGGTGGG - Intergenic
1085489986 11:76906512-76906534 ATTTTCAAGGATAATTTGGTGGG - Intronic
1085505638 11:77057105-77057127 TTTTTTAAGAATAATTTGGTGGG + Intergenic
1085579575 11:77638525-77638547 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1085580351 11:77644675-77644697 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1086068040 11:82767430-82767452 GTTTTTAAGGACAGCTTGGTGGG - Intergenic
1086133545 11:83424135-83424157 GTTTTTAAGGATAAGTTGGCAGG - Intergenic
1086157532 11:83684056-83684078 GTTTTTATGGGTTTTGTGGTAGG - Intronic
1086312836 11:85554994-85555016 TTTTTCAAGGATACTTTGGTGGG - Intronic
1086407604 11:86512010-86512032 GATTTTATGGATAATTTGGTGGG - Intronic
1086508970 11:87535199-87535221 CTTTTTAAAGGAGCTTTGGTGGG - Intergenic
1086575441 11:88334923-88334945 TTTTTTAAGGTTAGTTTTGTTGG - Exonic
1086576044 11:88340046-88340068 GTTTTCAAAGATAATTTGGTGGG + Intergenic
1087050526 11:93882280-93882302 GTTTTTAAGGATAATTTGGGGGG - Intergenic
1087090248 11:94262845-94262867 GTTTTTAGTTGTACTTTGGTAGG + Intergenic
1087886946 11:103492910-103492932 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1087887077 11:103493861-103493883 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1087931852 11:103987078-103987100 GTTTTTAAGGATAATTTGTTTGG - Intronic
1087971956 11:104494935-104494957 GTTCTTAAGGATAATTTGGTAGG - Intergenic
1087975174 11:104536216-104536238 GATTTTAAGGGTACTGAGCTTGG - Intergenic
1088221754 11:107577287-107577309 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1088312124 11:108471092-108471114 GTTTTTAAGGACAATTTGGTGGG + Intergenic
1088756394 11:112888807-112888829 CATTTTAGGGATACTTTGGTGGG + Intergenic
1088801821 11:113313882-113313904 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1089084895 11:115808650-115808672 CTTTTCAAGGATAGTTTGGTGGG + Intergenic
1089389702 11:118092348-118092370 GTTTTTAAGGATAACTTGGTGGG + Intronic
1089833140 11:121346666-121346688 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1090288410 11:125520159-125520181 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1090872015 11:130757402-130757424 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
1091069735 11:132551757-132551779 GTTTTTAAGGATAATTTGGTGGG - Intronic
1091077945 11:132638806-132638828 GTTTTAAAGGATAGTTTGGTGGG - Intronic
1091333369 11:134748647-134748669 GTTTTTCTGGGTAAGTTGGTGGG + Intergenic
1202818905 11_KI270721v1_random:59496-59518 GTTTTTAAGGATCATTTGGTGGG - Intergenic
1092275627 12:7058910-7058932 GTTCTTAAGGAGAATTTGGTGGG - Intronic
1092476201 12:8821013-8821035 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1092477569 12:8832060-8832082 GTTTTTAAAGATAATTTGGCAGG + Intronic
1092893456 12:12991015-12991037 GTTTTTAAAGATAATTTGGCAGG - Intronic
1093101036 12:15029699-15029721 GTTTTTAAAGATAATTTGGTTGG + Intergenic
1093101807 12:15037391-15037413 GTTTTTAAAGCTAATTTGGCAGG + Intergenic
1093181788 12:15975208-15975230 GTTTTTAAGGACAACTTGGTGGG + Intronic
1093297604 12:17410494-17410516 CCTTTTAAGGGCACTCTGGTTGG - Intergenic
1093616724 12:21234110-21234132 GTTTTTAAAGATAATTTGGTGGG + Intronic
1093700357 12:22213190-22213212 GTTTTTAAGGATAATTTGGTGGG - Intronic
1093800298 12:23364326-23364348 GTTTTTATGGACAATTTGGTGGG - Intergenic
1094212137 12:27903998-27904020 GTTTTTAAGGATAATTTGGCAGG + Intergenic
1094366769 12:29691387-29691409 GTTTTTAAGGATAATCTGGCGGG - Intronic
1094430952 12:30368645-30368667 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1094482906 12:30899120-30899142 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1094582720 12:31749230-31749252 GTTTTTAAGGATGATTTGGCAGG + Intergenic
1094603490 12:31931036-31931058 GTTTTTAAGGATAAATTGGTGGG - Intergenic
1094741187 12:33290995-33291017 GTTTTTACGGACAATTTGGTGGG - Intergenic
1094743292 12:33314192-33314214 GTGTTTAAGGGTACTTTGGTGGG + Intergenic
1095215627 12:39544114-39544136 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1095267760 12:40180290-40180312 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
1095360799 12:41336702-41336724 GTTTTTAAAGATAATTTGGTGGG + Intronic
1095422414 12:42039238-42039260 GTTTTTATGGATAATTTGGCAGG + Intergenic
1095479814 12:42623210-42623232 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1095887565 12:47205113-47205135 GTTTTTAAGGATAATTTGATGGG + Intronic
1095887673 12:47205959-47205981 GTTTTTAAGGACAATTTGGTGGG + Intronic
1095898181 12:47301543-47301565 GTTTTTAAACATAATTTGGTGGG + Intergenic
1096121719 12:49092965-49092987 GTTTTCCAGGTTACTTTGTTAGG - Intronic
1096835977 12:54351646-54351668 GTTTTTAAAGGCATTTTTGTGGG - Intronic
1097136096 12:56857072-56857094 GTTTTTAAGGAGAGTTTGGTGGG + Intergenic
1097339589 12:58422281-58422303 GTTTTTAAGGATAATTTGGCAGG + Intergenic
1098282784 12:68878604-68878626 GTTTTTAAGGATAATTTTGTGGG - Intronic
1098289537 12:68944818-68944840 ATTTTTAAAGATAGTTTGGTGGG + Intronic
1098291940 12:68964788-68964810 TTTCTTAAGGATACCTTGGTGGG - Intronic
1098295446 12:68999521-68999543 GATTTTAAGGATAATTTGGTGGG - Intergenic
1098615116 12:72513442-72513464 GTTTTTATGGATTCTTTCGTGGG + Intronic
1098729264 12:74012037-74012059 GTTTTTAAAGATAATTTGGCGGG - Intergenic
1099112204 12:78575397-78575419 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1099120998 12:78689056-78689078 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1099799553 12:87440485-87440507 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100262255 12:92943362-92943384 TTTTTTAAGGATAGTTTGGTGGG - Intergenic
1100293446 12:93238269-93238291 GCTTTTAAGGGCAACTTGGTGGG + Intergenic
1100294573 12:93248814-93248836 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1100407401 12:94283606-94283628 GTTTTTAAGGACAACTTGGTGGG + Intronic
1100705656 12:97197574-97197596 GTTTTTATGAATAATTTGGTGGG - Intergenic
1100964671 12:99999499-99999521 ATTTTTAAGAATAATTTGGTAGG + Intergenic
1101504936 12:105337452-105337474 TTTCTTAAGGGGACTCTGGTAGG + Intronic
1101912617 12:108871809-108871831 GTTTTTAAGGGTAATTTGGTGGG - Intronic
1102075363 12:110055695-110055717 GTTTTTAAGGATAACTTGGTGGG + Intronic
1102190268 12:110982500-110982522 ATTTTTAAGGGCATGTTGGTAGG + Intergenic
1102192844 12:111002018-111002040 GTTTTTAAGGATAATTTGTTGGG + Intergenic
1102740762 12:115205574-115205596 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1102963023 12:117105828-117105850 TTTTTAAAGGATACTTTGGTGGG - Intergenic
1103133697 12:118489687-118489709 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1103215640 12:119199555-119199577 GTTTTTAAAGATAGTTTGGTGGG + Intronic
1103243080 12:119431269-119431291 GTTTTTAAGGATAATTTGGAGGG + Intronic
1103305044 12:119957439-119957461 CTTTTCAAGGATAGTTTGGTTGG + Intergenic
1103539686 12:121657512-121657534 GTTTTTAAGGATAACTTGGTGGG - Intronic
1103539761 12:121658063-121658085 GTTTTTAAGGATAACTTGGTGGG - Intronic
1103681418 12:122697015-122697037 GTTTTTAAGGCTAATTTGGTGGG + Intergenic
1103683148 12:122710447-122710469 GTTTTTAAGGCTAATTTGGCAGG + Intergenic
1103868165 12:124070447-124070469 GTTTTTAAGGATAACTTGGTGGG + Intronic
1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG + Intergenic
1104265729 12:127231105-127231127 GTTTTTAAGGATAACTTCGTGGG - Intergenic
1104320363 12:127745128-127745150 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1104355629 12:128082699-128082721 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1104364941 12:128168249-128168271 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1104541560 12:129670586-129670608 GTTTTTAAGGATAACTTGGTGGG - Intronic
1104563780 12:129862032-129862054 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1104784788 12:131442639-131442661 GGTTTTAAAGATAGTTTGGTGGG - Intergenic
1104808680 12:131606277-131606299 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1104852733 12:131885194-131885216 GTTTTTAAGGATAACTTGGTTGG + Intergenic
1105348778 13:19597962-19597984 GTTTTTAGGGATAATTTGGTGGG - Intergenic
1105755039 13:23456197-23456219 GCTTTTAAGGGTACTTTGGCAGG + Intergenic
1105792097 13:23811852-23811874 GTTTTTAAAGATACTTTGTCAGG - Intronic
1106005961 13:25770484-25770506 GTTTTTAAGGATAACTTGGTGGG - Intronic
1106164515 13:27231115-27231137 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1106229263 13:27809193-27809215 ATATTTAAGGATAATTTGGTAGG - Intergenic
1106439538 13:29753904-29753926 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1106459956 13:29959944-29959966 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1106461346 13:29973143-29973165 GTTCTTAAGGATAATTTGGTGGG - Intergenic
1106590527 13:31094673-31094695 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1106739357 13:32622990-32623012 GTTTTTAAGGGTGGTTTGGCAGG + Intronic
1107021594 13:35757756-35757778 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1107167497 13:37299588-37299610 CTTTTAAAGGATAATTTGGTGGG + Intergenic
1107299487 13:38950080-38950102 TCTTTTAAGGATAATTTGGTAGG + Intergenic
1107335394 13:39349273-39349295 TTTTTTGAGGCTACTTTGATTGG - Intronic
1107426264 13:40296213-40296235 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1107427335 13:40306955-40306977 GTTTTCAAGGATAGTTTAGTGGG + Intergenic
1107481169 13:40787512-40787534 GTTTTTAGGGATAATTTGGTGGG - Intergenic
1107518182 13:41152314-41152336 GGTTTTAAGGATAATTTGGTGGG + Intergenic
1107664522 13:42675089-42675111 GGTTTTAAGAATAATTTGGTGGG + Intergenic
1107868584 13:44727111-44727133 GTTTTTAAGGGTAATTTGGTGGG - Intergenic
1107868674 13:44727860-44727882 ATTTTTAAGGATAACTTGGTGGG - Intergenic
1107949148 13:45446262-45446284 GTTTTTAAGGATAACTTGGCAGG + Intergenic
1108155393 13:47579013-47579035 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1108315767 13:49235773-49235795 GTTTTTATGGATAATTTGGTGGG + Intergenic
1108476734 13:50826904-50826926 GTTTTAAATGATAGTTTGGTAGG - Intronic
1108507325 13:51124248-51124270 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1108786374 13:53907427-53907449 GTTGTTAAGGGAAGTTTGTTTGG - Intergenic
1109292674 13:60495776-60495798 GTTTTTAAGGACAAGTTGGTGGG + Intronic
1109300358 13:60584551-60584573 GTTTCTAATGATAATTTGGTGGG - Intergenic
1109300920 13:60589285-60589307 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1109524780 13:63561646-63561668 TTATTTAGGGGTACATTGGTTGG - Intergenic
1109690505 13:65881829-65881851 GTTCTTAAGGATAATTTGGGTGG + Intergenic
1110103221 13:71635472-71635494 GTTTTTAAGGCAACTTTGTTTGG - Intronic
1110380824 13:74848491-74848513 GTTTTTATGGATAATTTCGTGGG - Intergenic
1110911967 13:80976681-80976703 GTTTTAAAAGATAGTTTGGTGGG - Intergenic
1110978011 13:81864625-81864647 GTCTTTAAGGATAATTTGGTAGG - Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111164935 13:84446879-84446901 GTTTTTAAAGACAATTTGGTGGG - Intergenic
1111190109 13:84795783-84795805 GATTTTAAGGATAATTTGGTAGG - Intergenic
1111456239 13:88487649-88487671 GTTTTTATGAATAATTTGGTGGG - Intergenic
1111476969 13:88762238-88762260 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1111529425 13:89517846-89517868 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1111565019 13:90002876-90002898 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1111607603 13:90561218-90561240 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1112019261 13:95357560-95357582 GTTTTTAAAGATAATTTGCTGGG + Intergenic
1112020827 13:95369636-95369658 GTTTTTAAGGGTTTTAGGGTGGG + Intergenic
1112161667 13:96874562-96874584 GTTTTTCAGGTTACCTGGGTGGG - Intergenic
1112260507 13:97873910-97873932 GTTTTTAAGACCAATTTGGTGGG + Intergenic
1112299925 13:98220526-98220548 GAATTTAAGGCTACTTTGCTTGG + Intronic
1112338619 13:98534812-98534834 ATTTTTAAGGATAATTTGGTGGG - Intronic
1112592548 13:100776867-100776889 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1113103747 13:106750168-106750190 TTTTTTAAGGATAGTTTGGTGGG + Intergenic
1113701082 13:112388794-112388816 GTTTTTAAAGATAACTTGGTGGG + Intronic
1114281661 14:21198093-21198115 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1114343664 14:21771988-21772010 GTTTTTATGGATAATTTGGTGGG - Intergenic
1114422230 14:22594032-22594054 GTTTTTAAGGACAACTTGGTTGG + Intergenic
1114446691 14:22794086-22794108 GTTTTTAAGGATAACTTGGTGGG - Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1114977870 14:28124199-28124221 ATTTTTAAGGATAATTTTGTTGG - Intergenic
1115169005 14:30481685-30481707 GTTTTTGAGGATAATTTTGTGGG - Intergenic
1115349025 14:32373281-32373303 GTTTTTAAGGATAACTTGGTGGG + Intronic
1115534240 14:34357752-34357774 GTTTTTAAAGATAATTTGGCGGG + Intronic
1115617668 14:35111854-35111876 TTTTTCAAGGATAGTTTGGTAGG - Intronic
1115704811 14:35988033-35988055 ATTTTTAAGGATAATTTGGTGGG - Intergenic
1116099953 14:40421117-40421139 GTTTTCATGGGTATTTTGTTTGG + Intergenic
1116200394 14:41786589-41786611 GTTTTTAAGATTTCTTTGCTTGG + Intronic
1116703345 14:48266267-48266289 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
1116848078 14:49883102-49883124 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1117181182 14:53193465-53193487 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1117305958 14:54473259-54473281 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1117447918 14:55822328-55822350 GTTTTTAAGGATAATTTGGGGGG + Intergenic
1117632485 14:57708321-57708343 GTTTTTAAAGATAATTTGGTGGG - Intronic
1117817245 14:59611015-59611037 GTTTTTAAGGATAACTTTGTGGG - Intronic
1117818033 14:59618491-59618513 GTTTTTAAGGATAACTTTGTGGG - Intronic
1118088258 14:62443171-62443193 ATTTTTAAGGATAATTTTGTGGG - Intergenic
1118088505 14:62445984-62446006 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1118208559 14:63745976-63745998 GTTTTTATGGACAATTTGGTGGG + Intergenic
1118354096 14:64997425-64997447 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1118620576 14:67610787-67610809 TTTTTTAAGGGTACTTTGGTAGG - Intergenic
1118937832 14:70303805-70303827 GTTTTTAAAATTAATTTGGTGGG - Intergenic
1118948022 14:70406806-70406828 GTTTTTAAGGATAATTTGTCAGG - Intronic
1119127860 14:72144934-72144956 GTTTTTAAAGATAATTTGGCAGG + Intronic
1119366788 14:74099674-74099696 GTTTTTAAGGATAATTTGGTGGG + Intronic
1119418453 14:74492156-74492178 GTTTTTAAGGATAATTTGGCGGG - Intronic
1120056491 14:79930221-79930243 GTTTTTAAGGATAATTTTGTGGG - Intergenic
1120225519 14:81787077-81787099 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1120268056 14:82276352-82276374 GTTTTTAAGGATAATTTGATGGG + Intergenic
1120401760 14:84041366-84041388 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1120970583 14:90203798-90203820 GTTTTTAAGGATAACTTGGCGGG + Intergenic
1120978391 14:90269598-90269620 GTGTTTAAGTGTGCTTTGGGAGG + Exonic
1120998286 14:90433481-90433503 GTTTTTAAGAATAACTTGGTGGG - Intergenic
1121138045 14:91516251-91516273 GTTTTTATGGACAATTTGGTGGG - Intergenic
1121496840 14:94398121-94398143 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1122654892 14:103251512-103251534 TTTTTTAAAGATAGTTTGGTGGG - Intergenic
1122655600 14:103257357-103257379 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1123138636 14:106054138-106054160 TTTTTTAAGGATAGCTTGGTGGG - Intergenic
1123842991 15:24268300-24268322 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1123858029 15:24434372-24434394 GTTTTAAAGGATAATTTGGTGGG - Intergenic
1123862659 15:24484834-24484856 GTTTTAAAGGATAATTTGGTGGG - Intergenic
1123899017 15:24857862-24857884 GTTTCTAAGAATAATTTGGTGGG + Intronic
1124025105 15:25958689-25958711 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1124417841 15:29488827-29488849 TTTTTCAAGGGTATTTTTGTAGG - Intronic
1124438846 15:29672743-29672765 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1124936149 15:34173006-34173028 ATTTTTAAGAGTATTTTTGTTGG - Intronic
1125021815 15:34993527-34993549 GTTTTTAAGGATAATTTGGTTGG + Intergenic
1125029468 15:35061751-35061773 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1125041311 15:35190355-35190377 GTTTTTAAGGATAAGTTGGTGGG + Intergenic
1125261825 15:37834633-37834655 GTTTTGAAGGTTAATTTAGTTGG - Intergenic
1125342546 15:38689110-38689132 TTTTTTAAGGATAATTTGGTGGG - Intergenic
1125454802 15:39846137-39846159 GTTTTAAATGGTACCTTAGTGGG - Intronic
1125631451 15:41151010-41151032 GTTTCTAAGGATAACTTGGTGGG - Intergenic
1125690666 15:41593630-41593652 GTTTTTAAGGATAACTTGGTCGG + Intergenic
1125845012 15:42843990-42844012 GTTTTTAAGGATAGTTTGGTGGG - Intronic
1126073066 15:44882849-44882871 GTTTTTAATGATAATTTGGAGGG + Intergenic
1126087170 15:45021593-45021615 GTTTTTAAGGATAGTTTGATGGG - Intergenic
1126128811 15:45320875-45320897 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1126314289 15:47352726-47352748 GTTTTTAATGGTAGTTTTGAGGG + Intronic
1126400553 15:48264682-48264704 GTTTTCATGGATGCTTTGGTTGG - Intronic
1126568274 15:50123586-50123608 GTTTTTAAGGATAATTTTGTGGG - Intronic
1126717999 15:51542559-51542581 ATAATTAAGAGTACTTTGGTTGG - Intronic
1127041990 15:54987567-54987589 GTTTTTATGAATAATTTGGTGGG + Intergenic
1127086116 15:55426027-55426049 GTTTTTAAGGACAACTTGGTGGG + Intronic
1127129376 15:55846085-55846107 ATTTTTAAGGATAATTTTGTGGG - Intronic
1127369662 15:58327001-58327023 TTTATTAAGCTTACTTTGGTGGG + Intronic
1127506111 15:59599514-59599536 GTTTTTAAGGATAATTTGGTGGG + Intronic
1127506552 15:59603587-59603609 ATTTTTAAAGGTATTTTGGTGGG - Intronic
1127506657 15:59604391-59604413 TTTTTCAAGGATAGTTTGGTAGG + Intronic
1127950178 15:63797579-63797601 GTTTTCAAGGATAGTTTGATGGG - Intronic
1127983016 15:64047793-64047815 GTGTTTAGGGATAGTTTGGTGGG - Intronic
1128350936 15:66887972-66887994 GTTTTCAAGGATAACTTGGTGGG + Intergenic
1128351760 15:66895467-66895489 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1128464965 15:67902809-67902831 GTTTTTAAGGTTCATTTGGTGGG - Intergenic
1128640231 15:69330688-69330710 GTTTTTAAGGATAACTTGGTTGG - Intronic
1128802694 15:70506928-70506950 GTTTTTAAGAATAATTTAGTGGG - Intergenic
1129339725 15:74877565-74877587 GTTTTTAAAGATAATTTGGCCGG - Intergenic
1129378456 15:75150309-75150331 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1129441146 15:75581591-75581613 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1129909790 15:79217133-79217155 GTTTTGAAGTATACTTTTGTAGG + Intergenic
1129926785 15:79371561-79371583 GTTTTTAAGGATACTTTGGTGGG + Intronic
1130195960 15:81780559-81780581 GTGTTTGAGGCTAATTTGGTGGG - Intergenic
1130657468 15:85801896-85801918 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1130740606 15:86595798-86595820 GTTTTTATGGATAATTTGATGGG + Intronic
1130837187 15:87662828-87662850 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1130837869 15:87669383-87669405 GTTTTTATGGATAACTTGGTGGG - Intergenic
1130998691 15:88920833-88920855 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1130999696 15:88929942-88929964 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1131414146 15:92237432-92237454 GTTTTTAAGAATAATTTGGTGGG - Intergenic
1131577961 15:93611114-93611136 GTTTTTAAGGATAATTTGGTAGG - Intergenic
1131698293 15:94904103-94904125 ATTTTTCAGGATAATTTGGTGGG + Intergenic
1132276003 15:100564488-100564510 GTTTTTAAGGATAATTTGGTGGG - Intronic
1132834208 16:1944471-1944493 GTTTTTAAGGATAACTTGGCGGG - Exonic
1132991129 16:2794857-2794879 GTTTTTATGGACAATTTGGTGGG - Intergenic
1133524309 16:6589385-6589407 GTTTTTCAGGATTATTTGGTGGG + Intronic
1133680607 16:8116384-8116406 GTTTTTAAGGATAATTCAGTGGG - Intergenic
1133763936 16:8822112-8822134 GTTTTTAAGGATAACTTGCTGGG + Intronic
1133764809 16:8830440-8830462 GTTTTTAAGGATAACTTGGTGGG + Intronic
1133900835 16:9972923-9972945 GTTTTTAAGGATAATTTGGTGGG + Intronic
1133943037 16:10326326-10326348 GTTTTTAAGGATAATTGGATGGG + Intergenic
1133945207 16:10342156-10342178 GTTTTAATGGATAATTTGGTGGG - Intronic
1133948509 16:10369818-10369840 TTTTTAAAGGATAGTTTGGTGGG + Intronic
1134392662 16:13833803-13833825 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1134740621 16:16540489-16540511 GTTTTTAGAGATAATTTGGTGGG - Intergenic
1134926881 16:18171683-18171705 GTTTTTAGAGATAATTTGGTGGG + Intergenic
1135170605 16:20180083-20180105 GTTTTTATGGACAGTTTGGTGGG + Intergenic
1135469041 16:22712782-22712804 TTTTTAAAGGGTGATTTGGTGGG + Intergenic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1135671296 16:24377788-24377810 GTTTTTATAAGTAATTTGGTGGG - Intergenic
1135788495 16:25372136-25372158 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1135809767 16:25576577-25576599 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1135963805 16:27019494-27019516 ATTTTTAAGGGTAGTTTGGCAGG - Intergenic
1135965752 16:27033553-27033575 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1136598640 16:31269055-31269077 GTTTTTGAGGATAACTTGGTAGG + Intronic
1137240404 16:46650990-46651012 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1137380140 16:47990746-47990768 GTTTTTTAAGATAGTTTGGTGGG + Intergenic
1137452535 16:48590306-48590328 GTTTTTAAAGATAATTTGGCAGG - Intronic
1138006513 16:53342600-53342622 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1138016019 16:53429412-53429434 TTTTTTAAGGATAATTTGCTGGG - Intergenic
1138059005 16:53869145-53869167 CTTTTAAAGGGTAGTTTTGTAGG + Intronic
1138605255 16:58084628-58084650 GTTCTTAAGGATAACTTGGTGGG - Intergenic
1138626935 16:58259967-58259989 CTTTTTAAGGTTACTGTGGTAGG + Intronic
1138823012 16:60284421-60284443 GTTTTTAGAGGTACTCAGGTGGG + Intergenic
1138825062 16:60309041-60309063 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1138926063 16:61592740-61592762 GTTTTTAAGGGTGCTTTAATAGG - Intergenic
1139014850 16:62677613-62677635 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1139066725 16:63324623-63324645 CTTTTTAATGGTAGTTTGGTAGG - Intergenic
1139084930 16:63573154-63573176 GTATTTACAGGTACTATGGTGGG + Intergenic
1139385228 16:66564187-66564209 TTTCTTAAGTGTACTTTGGCAGG + Intronic
1139605659 16:68016431-68016453 GTTTTTAAAGATAATTTGGTGGG + Intronic
1140466464 16:75187216-75187238 TTTTTTAAGGATAATTTGGTGGG + Intergenic
1140616927 16:76676340-76676362 GTTATTAAGGATAATTTGGTGGG + Intergenic
1140642304 16:76990375-76990397 GTTTTTATGGATACCTTGGTGGG + Intergenic
1141016736 16:80457928-80457950 TTTTTTAAGGATAATTTCGTGGG + Intergenic
1141335696 16:83153166-83153188 GTTTTTAAAGACAATTTGGTGGG + Intronic
1141753041 16:85972203-85972225 GTTTTTAAGGACAATTTGGTGGG - Intergenic
1141917470 16:87109572-87109594 GTTCTTAAAGATAATTTGGTGGG + Intronic
1203141563 16_KI270728v1_random:1770652-1770674 AGTTTTAAGGATAATTTGGTGGG + Intergenic
1142633359 17:1240702-1240724 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1142951045 17:3480356-3480378 ATTTTTAAGGATAATTTGGTGGG + Intronic
1143222255 17:5272463-5272485 ATTTTTAAGGATAACTTGGTGGG - Intergenic
1143274316 17:5698902-5698924 GTTTTTAAGGATAAGTTGGTGGG - Intergenic
1143605456 17:7982285-7982307 GTTTTTAAGGACAATTTGGTGGG + Intergenic
1143605620 17:7983673-7983695 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1143668658 17:8381210-8381232 TTTTTTAAGGATAATTTGGCAGG - Intronic
1143804760 17:9417104-9417126 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1143985696 17:10911937-10911959 GTTTTTATGGGCAATTTGGCAGG + Intergenic
1144551354 17:16243931-16243953 GTTTTTAAGCATAATGTGGTGGG + Intronic
1144556163 17:16284745-16284767 GTTTTTAAGGACAACTTGGTAGG - Intronic
1144631826 17:16877417-16877439 GTTTGGAAGGATAATTTGGTAGG - Intergenic
1144825599 17:18104046-18104068 GGTTTTGAGGGTACCCTGGTGGG + Intronic
1145324991 17:21815446-21815468 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1145754051 17:27377250-27377272 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1145833186 17:27934098-27934120 GTTTTTAAGGATAACTTGATGGG + Intergenic
1146359368 17:32161178-32161200 TTTTTCAAGGATAGTTTGGTGGG + Intronic
1146502307 17:33374483-33374505 GTTTTTACGGATAATTTGGTGGG - Intronic
1146809063 17:35889047-35889069 TTTTTTAAAGGTAGTTTGGCGGG + Intergenic
1146851207 17:36223197-36223219 GTTTTTAATGCTTCCTTGGTTGG - Intronic
1147230522 17:39014699-39014721 GTTTTCAAGGATAATTTGGTGGG - Intergenic
1147235756 17:39056204-39056226 TTTTTTAAGGATAGTTTGGCAGG - Intergenic
1147282891 17:39377354-39377376 GTTTTTAAGGACAGCTTGGTGGG - Intronic
1147363874 17:39947696-39947718 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1148061188 17:44837553-44837575 TTTTTTAAGGATAATTTGGCGGG - Intergenic
1148221838 17:45868456-45868478 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1148648706 17:49234227-49234249 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1148965842 17:51435386-51435408 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1149103750 17:52937338-52937360 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1149215568 17:54349896-54349918 GTTTTTAAGGATAATTTGTAGGG - Intergenic
1149477280 17:56973734-56973756 GTTTTTAAGGATAATTTGGTTGG + Intergenic
1150973159 17:70053534-70053556 GTTTTTAAGGATAGTTTGTCGGG + Intronic
1151000543 17:70370400-70370422 GTTTTTATGGATAATTTGGTGGG + Intergenic
1151103124 17:71578517-71578539 GATTTTAAGGGTGGTTAGGTGGG - Intergenic
1151597218 17:75085901-75085923 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1151751128 17:76038440-76038462 AATTTTAAGGATAATTTGGTGGG - Intergenic
1151926356 17:77200423-77200445 GTTGTGAAGGGAACTTTGGGAGG - Intronic
1152494641 17:80662430-80662452 GTTTTTATGGATAATTTGGTGGG + Intronic
1152675534 17:81638609-81638631 GGTTTTAAGGATAATTTGGTGGG + Intronic
1152824593 17:82456695-82456717 GTTTTTATGGACAATTTGGTGGG - Intergenic
1153154412 18:2132558-2132580 GTTTTCAAGGGTAGTTTGACAGG + Intergenic
1153198842 18:2629309-2629331 GTTTTTAGGGGTTCAGTGGTTGG + Intergenic
1153282280 18:3425701-3425723 TTTTTCAAGGATAGTTTGGTAGG - Intronic
1153898222 18:9588914-9588936 GTTCTTGAGGGTACTTAGGAAGG + Intronic
1154090957 18:11362757-11362779 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1154366134 18:13710787-13710809 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1154400345 18:14031069-14031091 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1155282437 18:24253595-24253617 GATTTTAAGGATAATTTGGCTGG + Intronic
1155357143 18:24964278-24964300 TTTTTCAAGGATAGTTTGGTAGG + Intergenic
1155574220 18:27227584-27227606 TTTTTCAAAGATACTTTGGTAGG + Intergenic
1155669442 18:28351055-28351077 GTGTTTAAGGATAATTTGGCGGG - Intergenic
1155697073 18:28696993-28697015 GTTTTTAAGAGTAAATTGCTGGG + Intergenic
1155938455 18:31778455-31778477 GTTTGTAAGTATAATTTGGTGGG - Intergenic
1156300154 18:35829277-35829299 GTTTTTAAGCATAATTTGGTAGG + Intergenic
1156300378 18:35831237-35831259 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1156301590 18:35841087-35841109 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1156315789 18:35967596-35967618 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1156593974 18:38524880-38524902 TTCTTTAGGGGTGCTTTGGTTGG - Intergenic
1156815483 18:41305935-41305957 TATTTTAAGGATAATTTGGTGGG - Intergenic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1156817128 18:41325010-41325032 GTTTTTATGGACAATTTGGTGGG + Intergenic
1156902845 18:42321412-42321434 GATTTTAAGGATAATTTGGTGGG - Intergenic
1157038307 18:44005052-44005074 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1157167928 18:45375519-45375541 GTTTTTAAGGACAACTTGGTGGG - Intronic
1157214921 18:45774768-45774790 GGCTTGAAGTGTACTTTGGTGGG - Intergenic
1157217013 18:45792637-45792659 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1157235208 18:45959002-45959024 GTTTTTAAGGATAACTTGGTGGG - Intronic
1157349904 18:46875020-46875042 CTTTTTAGAGGTAATTTGGTGGG - Intronic
1157368179 18:47085662-47085684 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1157766320 18:50299659-50299681 GTTTTTAAGGATAAATTGGTGGG + Intergenic
1157814545 18:50721360-50721382 GTTTGCAGGGGCACTTTGGTGGG - Intronic
1157921186 18:51714032-51714054 ATTTTTAAGGATAATTTGTTGGG + Intergenic
1158005626 18:52669062-52669084 GTTTTTAAGGATGACTTGGTGGG + Intronic
1158743071 18:60165725-60165747 TTTTTTAAGGATAATTTGGTAGG - Intergenic
1158743094 18:60165859-60165881 TTTTTTAAGGATAATTTGGTGGG - Intergenic
1158780049 18:60637838-60637860 GTTTTCAAGTATAATTTGGTAGG + Intergenic
1158863056 18:61611913-61611935 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159086777 18:63801593-63801615 GTTTTCAAGGATAGTTTGGTGGG + Intronic
1159112625 18:64076837-64076859 GGATTTAAGGATAATTTGGTGGG - Intergenic
1159113034 18:64082378-64082400 TTTTTTAAGGATAATTTGGCAGG - Intergenic
1159165041 18:64687944-64687966 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1159298314 18:66525445-66525467 GTTTTTAGTGGCACTTTGGGAGG + Intronic
1159580476 18:70229948-70229970 GTTTTTAAAGACAATTTGGTAGG + Intergenic
1159655259 18:71025170-71025192 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1159851756 18:73533800-73533822 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1161840311 19:6676190-6676212 GGTTTTAAAGATAGTTTGGTGGG - Intergenic
1162639132 19:11994077-11994099 GTATTTCAGGGTCCTTAGGTAGG + Intergenic
1162848515 19:13412864-13412886 GATTTGAAGACTACTTTGGTAGG + Intronic
1163065946 19:14795438-14795460 GTTTTAAAGAATAATTTGGTGGG + Intronic
1163196717 19:15726964-15726986 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1164188920 19:22897767-22897789 GATTTTAAGAATAATTTGGTGGG - Intergenic
1164543377 19:29139319-29139341 GTTTTTATGGGTTCTTTGCTGGG - Intergenic
1164785695 19:30928618-30928640 GTTTTTAAGGATAATTATGTTGG - Intergenic
1164968778 19:32512037-32512059 GTTTTGAAGGGTAGTTTTGCTGG - Intergenic
1165122444 19:33569024-33569046 GTTTTTAAGGGTAACTTGGTGGG - Intergenic
1165294877 19:34918533-34918555 TTTTTCAAAGATACTTTGGTGGG - Intergenic
1165300742 19:34966980-34967002 GTTTTCAGGGATAATTTGGTGGG - Intergenic
1165579280 19:36848439-36848461 GTTTTTTAGGAGACATTGGTGGG + Intronic
1166621888 19:44308724-44308746 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1166820789 19:45578513-45578535 GTTTTTAAGGATAACTTGGTGGG - Intronic
1166821391 19:45582556-45582578 GTTTTTAAGGATAACTTGATGGG + Intronic
1167206684 19:48107156-48107178 TTTTTTAAGGAAACTTTGGTGGG + Intronic
1167256932 19:48436212-48436234 GTTTTTAAAGATAATTTGGCGGG + Intronic
1167389843 19:49187765-49187787 GCTTTTAAAGATAATTTGGTGGG + Intronic
1167839189 19:52100037-52100059 GTTTTTAAGGATAATTTGATGGG - Intergenic
1167843701 19:52142381-52142403 GTTTTTAAGGATAATTTGATAGG - Intergenic
1168019615 19:53599680-53599702 GTTTTTAAAGTTATTTTGGCTGG + Exonic
1168227367 19:55005441-55005463 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1168481720 19:56725533-56725555 TTTTTCAAGGCTAGTTTGGTGGG - Intergenic
1168709311 19:58489450-58489472 GTTTTTAAGGACAACTTGGTGGG - Intronic
925204273 2:1993069-1993091 GTTTTTAAGGATAACTTGGTGGG - Intronic
925980292 2:9171124-9171146 GTTTTTAAGGATAATTTGGTGGG - Intergenic
925993586 2:9273594-9273616 GTTTTTAAGGATAATTTGGTGGG + Intronic
926488746 2:13497348-13497370 GTATTTAAGAGTTCTTTTGTTGG + Intergenic
926752293 2:16207686-16207708 GTTTTTAAGGTTAATTTAGTGGG + Intergenic
926889565 2:17627514-17627536 GTTTTTAAGGATAATTTGGTGGG + Intronic
926905529 2:17801818-17801840 GTTGTTACGGATAATTTGGTGGG - Intergenic
927687599 2:25182671-25182693 GTTTTTAAGGATAATTTGGTGGG + Intergenic
928671969 2:33611513-33611535 GTTTAAAAGGATAATTTGGTGGG - Intergenic
929007058 2:37406030-37406052 GTTATTAAGTGTCCTTTAGTAGG + Intergenic
929111974 2:38412543-38412565 GTTTTTAAAGATAATTTGGTGGG - Intergenic
929171913 2:38940830-38940852 TTTTTTAAGGATAATTTGGTGGG + Intronic
929321094 2:40544372-40544394 GTTTTAAAAGATAATTTGGTGGG + Intronic
929361898 2:41101762-41101784 GTTTTTAAGGATAATTTGACAGG - Intergenic
929650521 2:43676276-43676298 TTTTTTAAGGGTATGTTGCTTGG - Intronic
930065825 2:47326860-47326882 GTTTTTAAAGATAATTTGGCGGG + Intergenic
930113297 2:47697245-47697267 GTTTTTAAGGATAGTTTGGCAGG - Intronic
930113517 2:47698982-47699004 GTTTTTAAGGATTATTTGGCAGG - Intronic
930245783 2:48982130-48982152 GCCTTTAAGGCTTCTTTGGTGGG - Intronic
930322741 2:49876810-49876832 TTTCTTAAGGATAATTTGGTGGG + Intergenic
930322962 2:49878578-49878600 GTTTTTAAGGACAACTTGGTGGG - Intergenic
930707062 2:54515247-54515269 GTTTTTAAGGATAATTTGCTGGG - Intronic
930755088 2:54965562-54965584 GTTGTTAAGGATAATTTGGTGGG + Intronic
930757281 2:54989098-54989120 GCTCTTAAGGGTACTTCTGTAGG + Intronic
930839315 2:55827509-55827531 GTTTTTAAGGATAATTTGGTGGG + Intergenic
930983079 2:57551371-57551393 GTTTTAATGGATAATTTGGTGGG - Intergenic
931598354 2:63975686-63975708 GTTTTTAAGGACAACTTGGTGGG - Intronic
931608283 2:64073882-64073904 TTTTTCAAGGATACTTTGGAGGG + Intergenic
931928698 2:67104582-67104604 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
932079328 2:68697437-68697459 GTTTTTAAGAATAATTTGGTGGG + Intronic
932201378 2:69830875-69830897 GTTTTTAAAGGTTATTTGGTAGG + Intronic
933014867 2:77112710-77112732 TTCTTTCAAGGTACTTTGGTAGG - Intronic
933045356 2:77528663-77528685 GTTTTTAAGGATAATTTTGTGGG + Intronic
933073256 2:77889281-77889303 GTTTTTAAGGATAATTTGGAGGG - Intergenic
933416361 2:81991542-81991564 GTTTTTAAAGATAATTTGGTGGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934670573 2:96209713-96209735 GTGTTTAAGGATAATTTGGTGGG - Intergenic
934670991 2:96212701-96212723 GTTTTAAAGGAGACTTTGGTGGG - Intergenic
934700637 2:96437014-96437036 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
934701106 2:96440877-96440899 GTTTTTGAGTATAATTTGGTGGG - Intergenic
934924007 2:98368746-98368768 GTTTTTAAGGATAATTTGTTGGG + Intronic
935156156 2:100485410-100485432 GATTTTATGGATAATTTGGTGGG + Intergenic
935162516 2:100541520-100541542 CTTTTTAAGAATAATTTGGTGGG + Intergenic
935742125 2:106159025-106159047 GTTTTTAAGGGTAGTTTGGTGGG - Intronic
935759646 2:106309398-106309420 GTTTTTGAGTCTACTGTGGTAGG + Intergenic
936034124 2:109096997-109097019 GTTTTTATGTATAATTTGGTGGG - Intergenic
936447651 2:112608333-112608355 GTTTTTAAGAATAATTTGGTGGG - Intergenic
936466633 2:112757850-112757872 TTTTTTCAGGGTTCTTTGGAGGG - Intronic
936626414 2:114153954-114153976 GTTTTTAAGGAAAATTTGATGGG - Intergenic
936828707 2:116613140-116613162 GAGTTTAAGGGTAATTTGGACGG - Intergenic
936891025 2:117370501-117370523 GTTTTCAAGGATAATTTGGTGGG + Intergenic
937113893 2:119389615-119389637 GTTTTTAAGGATAATTTGGTGGG + Intergenic
937414294 2:121702141-121702163 GCTTTTAAAGATAATTTGGTGGG - Intergenic
937520415 2:122707069-122707091 TTTTTTAAGGACAGTTTGGTGGG - Intergenic
937544451 2:122999952-122999974 GTTTTTAAAGACAGTTTGGTGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938700277 2:133871898-133871920 GTTTTTAAGGATAATTTGATGGG + Intergenic
938786772 2:134636974-134636996 GTTTTTAAGGATAATGTGGTGGG - Intronic
938973392 2:136452621-136452643 TTTTTTAAGGGTAATTTGGTGGG + Intergenic
939042597 2:137208641-137208663 TTTTTCAAGGATAATTTGGTGGG + Intronic
939131841 2:138244447-138244469 GTTTTTATGGATAATGTGGTAGG + Intergenic
939207648 2:139128323-139128345 GTTGTTAAGGGCAACTTGGTGGG - Intergenic
939255692 2:139742489-139742511 ATTTTTAAGGATAATTTGGTGGG - Intergenic
939265366 2:139865881-139865903 ATTTTTAAGGATAACTTGGTGGG + Intergenic
939265743 2:139870483-139870505 GTTTTTAAGGATAATTTGGTGGG - Intergenic
939726418 2:145726672-145726694 GTTTTTAAAGATAATTTGGCAGG - Intergenic
939740864 2:145903584-145903606 GTTTTAAAGTGTACTTTGGTGGG - Intergenic
939748086 2:146003352-146003374 TTATTTAAGGATAATTTGGTGGG + Intergenic
939844757 2:147229514-147229536 GTTTTTAAAGATAATTTGGCAGG - Intergenic
940075072 2:149732438-149732460 GTTTTTATGGACAATTTGGTGGG + Intergenic
940402018 2:153258289-153258311 GTTTTTAAGGACAACTTGGTGGG - Intergenic
940486851 2:154306599-154306621 GTTTTTAAGGATAATTTGGTGGG + Intronic
940852984 2:158705734-158705756 GTTTTTATGGATAATTTGGTGGG + Intergenic
941163096 2:162057084-162057106 GTTTTTAAGGATGATTTGGCAGG - Intronic
941403154 2:165056572-165056594 GTTTTTATGGACAATTTGGTGGG - Intergenic
941404201 2:165069052-165069074 TTTTTTAAGGATAGTTTGGCAGG + Intergenic
941673668 2:168321618-168321640 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
941877360 2:170447794-170447816 GTTTTGAAGGATACTTTGGTAGG + Intronic
941960183 2:171245715-171245737 GTTTTTATGGATAGTTTGGCAGG - Intergenic
942026178 2:171912939-171912961 GTTTTTAAGGATACCTTGGTGGG + Intronic
942093871 2:172519815-172519837 TTTTTAAAGGATAATTTGGTGGG + Intergenic
942223744 2:173796661-173796683 GTTTTTAAGGATAATTTGGTAGG - Intergenic
942626000 2:177901355-177901377 GTTTTTAAGGATAATTTGGTGGG - Intronic
943758962 2:191587938-191587960 GTTTTTAAGGATAACTTGGTGGG - Intergenic
943862656 2:192888787-192888809 GTTTTTAAAGATAATTTGGTGGG + Intergenic
943983888 2:194594365-194594387 GTTTTTAAGGATAATTTGGTGGG - Intergenic
944054318 2:195507542-195507564 GTTTTTAAGGATAATTTGGTGGG + Intergenic
944314119 2:198267158-198267180 GTTTTTATGGACAGTTTGGTGGG + Intronic
945392378 2:209279719-209279741 GTTTTTAAAGACAATTTGGTGGG - Intergenic
946215571 2:218180843-218180865 GTTTTTAAGGAAAACTTGGTGGG + Intergenic
946663874 2:222029309-222029331 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
946734246 2:222738853-222738875 GTTTTTAAAGACAATTTGGTGGG + Intergenic
946765582 2:223037103-223037125 GTTTTTAAAGATAATTTGGAGGG + Intergenic
947014206 2:225600115-225600137 GTTTTTCAGGATAACTTGGTGGG + Intronic
947028023 2:225760798-225760820 GTTTTCAAGGATAGTTTTGTAGG + Intergenic
947032771 2:225816896-225816918 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
947160412 2:227208577-227208599 GTTTTTAAAGATAGTTTGGCGGG - Intronic
947179832 2:227402070-227402092 ATTTTTAAGGATAACTTGGTGGG + Intergenic
947216299 2:227753235-227753257 GTTTTTAAAGATAATTTGGCGGG - Intergenic
947304675 2:228730933-228730955 ATTTTTAAGAATAATTTGGTGGG - Intergenic
947373131 2:229468600-229468622 GTTTTTAAAGATAATTTGGCGGG - Intronic
947393000 2:229658600-229658622 TTATTTAAGGGTACTTGGGGAGG + Intronic
947456272 2:230256887-230256909 GTTTTTCAGAGTACTCTGATAGG + Intronic
947519168 2:230830511-230830533 ATTTTAAAGGATAATTTGGTGGG + Intergenic
947520023 2:230838435-230838457 GTTTTTAAGGACAACTTGGTGGG - Intergenic
947619655 2:231581564-231581586 GTTTTAAAAGATAATTTGGTGGG - Intergenic
947688648 2:232114127-232114149 GATTTTAAGGATAATTTGGTGGG - Intronic
947802694 2:232941056-232941078 GTTTTTAAGGATAATTTGGTGGG + Intronic
947807971 2:232981693-232981715 GTTTTTAAGGATAATTTGGCAGG - Intronic
947965150 2:234274075-234274097 ATTTTTAAGGGCAACTTGGTGGG - Intergenic
948006691 2:234615358-234615380 GTTTTTAAGGATAACTTGGTGGG - Intergenic
948302375 2:236917423-236917445 GTTTTTAAAGATAATTTGGCAGG + Intergenic
948931346 2:241134416-241134438 GTTTTAAAAGATACTTTGTTAGG - Intronic
1168818306 20:756020-756042 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1168941802 20:1719068-1719090 GTTTTTAAGGGTAAGTTGGTGGG + Intergenic
1168958621 20:1852735-1852757 GTTATTATGGGTAATTTGTTGGG + Intergenic
1169125299 20:3122963-3122985 GTTTTGAAGGGAGTTTTGGTTGG - Intronic
1169410484 20:5365288-5365310 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1169410702 20:5367362-5367384 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1169431475 20:5540056-5540078 GTTTTCAAGTATAGTTTGGTGGG - Intergenic
1169455260 20:5746929-5746951 TTTTTTAAGGATAATTTGGTAGG - Intergenic
1169653301 20:7893723-7893745 GTTTTTAAGGATAATTTGGTGGG - Intronic
1169742932 20:8914887-8914909 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1169835507 20:9873481-9873503 GTTTTCAAGGATAGTTTGGTCGG - Intergenic
1170368091 20:15618908-15618930 GATTTTAAGGATAATTTGGCGGG + Intronic
1170466026 20:16623201-16623223 GTTTTTAAGAATAATTTGGCGGG + Intergenic
1170509093 20:17058538-17058560 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1170936194 20:20811864-20811886 GTTTTTAAGGATAAGTTGGTGGG + Intergenic
1171105814 20:22431181-22431203 GGCTTTAAGGGAGCTTTGGTTGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171398578 20:24857088-24857110 GTTTTCAAGGATGGTTTGGTGGG - Intergenic
1171465927 20:25328022-25328044 GTTTTTAAGGACAACTTGGTGGG - Intronic
1172795811 20:37536564-37536586 GTTTTTAAGGATAGCTTGATAGG - Intergenic
1173584650 20:44173464-44173486 TTTTTTAAGGATAGTTTGGCGGG - Intronic
1173632615 20:44528096-44528118 GTTTTTAAGGTTAACTTGGTGGG - Intergenic
1173632816 20:44529463-44529485 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1173746933 20:45444728-45444750 ATTTTTAAAGATAATTTGGTGGG + Intergenic
1174552388 20:51371413-51371435 TTTTTAAAGGATAATTTGGTGGG + Intergenic
1174754463 20:53143930-53143952 GTTTTTAAGGATAATTTGGTGGG + Intronic
1174803386 20:53584271-53584293 TTTTTTAAGGTTACTTTGCTGGG - Intronic
1174836055 20:53856098-53856120 GTTTTTACGGATAATTTGGTGGG + Intergenic
1174851695 20:54001678-54001700 TTTTTTAAGGTCAGTTTGGTGGG - Intronic
1175049529 20:56141774-56141796 GTTTTTAAGAATAATTTGGCAGG + Intergenic
1176931023 21:14810223-14810245 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1177260367 21:18722031-18722053 CTTTTCAAGGATAGTTTGGTGGG - Intergenic
1177402999 21:20630714-20630736 GTTTTTAAGAATAATTTGGTGGG + Intergenic
1177420559 21:20851710-20851732 TTTTTTAAGGATAATTTGGTGGG + Intergenic
1177700753 21:24636140-24636162 GTTGTTAAGGATAATTTGGTGGG - Intergenic
1177737323 21:25107873-25107895 GTTTTTAAGGCTAGTTTAGTGGG + Intergenic
1177801465 21:25832804-25832826 GTTTTTAAGGATAATTTGGTAGG - Intergenic
1177887302 21:26762165-26762187 GTTTTTATGGACAATTTGGTGGG + Intergenic
1178029851 21:28511934-28511956 GTTTTTATGGGTCCTTGGGAAGG - Intergenic
1178097501 21:29231849-29231871 GTGTTTAAGGATAACTTGGTGGG + Intronic
1178241315 21:30904148-30904170 GTTTTTAAAGATATTTTGGCGGG - Intergenic
1178254648 21:31041111-31041133 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1178312079 21:31537901-31537923 GTTTTTAAGTTTTCTTTGTTTGG - Intronic
1178785566 21:35650089-35650111 GTTTTTAAGAATAACTTGGTGGG - Intronic
1179234799 21:39536168-39536190 ATTTTTAAGGATAACTTGGTGGG + Intergenic
1179417547 21:41210253-41210275 GTTTTTAAGGTTTTTTTGGGGGG - Intronic
1179599517 21:42466765-42466787 GTTTTTATGGACAGTTTGGTGGG - Intergenic
1179640149 21:42742360-42742382 GTTTTTAAGGATAACTTAGTGGG + Intronic
1179672826 21:42961724-42961746 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1179892074 21:44340603-44340625 GTTTTTAAGGATAATTTGGCGGG - Intergenic
1179901882 21:44398510-44398532 TTTTTTAAGGATAATTTGGTGGG + Intronic
1180561284 22:16616358-16616380 TTTTTTAAGGTTACTTTGCTGGG + Intergenic
1181304921 22:21910386-21910408 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1181503620 22:23335511-23335533 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
1181654189 22:24281994-24282016 GTTTTTAAGGACAGCTTGGTAGG + Intronic
1181708615 22:24665745-24665767 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
1182335688 22:29581872-29581894 TTTATTAAGGATAATTTGGTGGG + Intergenic
1182500059 22:30740157-30740179 GTTTTTAAGGATAACTTGGAGGG + Intronic
1183120355 22:35725567-35725589 TTTTTAAAGGATAATTTGGTGGG + Intronic
1183287464 22:36976524-36976546 TTTTTTAAGGGTACTTTGGTGGG - Intergenic
1183534373 22:38388644-38388666 TTTTTTAAGGTTACTTTGCTGGG - Intronic
1184904608 22:47472574-47472596 GTTTTTAAAGATAATTTGGCAGG - Intronic
949335188 3:2967107-2967129 GTTTTTAAGGATAATTTGGTGGG + Intronic
949567720 3:5260448-5260470 GGTTTGAAGAGTACTTTGGTGGG - Intergenic
949571011 3:5293264-5293286 CTTTTTAAAGGTAGTTAGGTTGG + Intergenic
949613410 3:5727761-5727783 GTTTTTAAAGATAATTTGGCGGG + Intergenic
949789947 3:7781920-7781942 GTTTTTAAAGACACATTGGTGGG + Intergenic
949811562 3:8012184-8012206 GTTTTCAAGGATAATTTGGTGGG - Intergenic
949993456 3:9598496-9598518 GGTTTTAAGGATAGTTTGGCAGG + Intergenic
949997568 3:9630537-9630559 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
950511826 3:13433895-13433917 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
950782277 3:15402274-15402296 TTTTTCAAGGATAGTTTGGTGGG + Intronic
951113455 3:18832853-18832875 GTTTTTAAGAATAATTTGGTGGG + Intergenic
951263505 3:20540068-20540090 GTTTTCAAGGATAATTTGGCGGG + Intergenic
951895428 3:27605601-27605623 GTTTTTAAGGATAATTTGGTGGG - Intergenic
952112952 3:30145576-30145598 GTTTTTAAAGATAATTTGGCAGG - Intergenic
952287752 3:31984356-31984378 TTTTTTAAGGATAGTTTGGTGGG + Intronic
952297835 3:32076725-32076747 GTTTTTAAGGATAATTTGGTAGG + Intronic
952308050 3:32162639-32162661 GTAATTAAGGGCACTTTGGGAGG - Intronic
952767310 3:36965486-36965508 GTTTTTAAAGATAATTTGGCAGG + Intergenic
952928868 3:38344305-38344327 GTTTTTAAGAATAATTTGGTGGG + Intergenic
952994059 3:38860167-38860189 GTTTTTAAAGATAATTTGGTGGG - Intronic
953177953 3:40568814-40568836 GTTTCCAAGGATAGTTTGGTGGG + Intronic
953425774 3:42796630-42796652 GTTTTTAAGGATAATTTGGTGGG + Intronic
953437703 3:42892231-42892253 GTTTTTAAGGACAACTTGGTGGG + Intronic
953438893 3:42901137-42901159 GGTTTTAAGGATAATTTGGTGGG + Intronic
953500072 3:43424681-43424703 TTTTTCAAGGATAGTTTGGTGGG - Intronic
953613526 3:44468779-44468801 GTTTTTAAGGATAACTTGGTGGG - Intronic
953683053 3:45053895-45053917 GTTTTTAAGGATAACTTGGTGGG + Intergenic
953746479 3:45577925-45577947 TTTTTGAAGGATAGTTTGGTGGG - Intronic
953990479 3:47479376-47479398 TTTTTCAAGGATAGTTTGGTAGG + Intergenic
954060724 3:48064445-48064467 GTTTTAAAGGATAATTTTGTGGG - Intronic
954085143 3:48238606-48238628 ATTTTTAAGGATAATTTGGTGGG + Intergenic
954823731 3:53353057-53353079 GTTTTTATGGATAATTTGGTGGG + Intergenic
955489782 3:59470692-59470714 GTTTTTAAGAATAATTTGGTGGG - Intergenic
955655696 3:61242688-61242710 TTTTTTAAGGATAATTTGGTGGG + Intronic
955858209 3:63297712-63297734 GTTTTTATGAATAATTTGGTGGG + Intronic
956042648 3:65161270-65161292 GTTTTCAAGGCTACTATGGCTGG + Intergenic
956369018 3:68537978-68538000 TTTTTCAAGGGTAGTTTGGTGGG + Intronic
956458179 3:69444143-69444165 TTTTTCAAGGATAGTTTGGTGGG - Intronic
956915090 3:73862452-73862474 GTTTTTAAGGACAACTTGGTGGG + Intergenic
957468480 3:80626840-80626862 GATTTTAAGGATAATTTGGCGGG + Intergenic
957725908 3:84067055-84067077 GTTTTTTAGGATAGCTTGGTGGG + Intergenic
957726595 3:84073904-84073926 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
957740787 3:84265687-84265709 GTTTTTAAAGATAATTTGGTGGG + Intergenic
957873620 3:86116702-86116724 CTTTTAAAAGGTACTCTGGTTGG + Intergenic
957892868 3:86382479-86382501 GTTTTCAAGGATAGTTTGGTGGG + Intergenic
958525896 3:95258663-95258685 GTGTTGAAGGATAATTTGGTGGG - Intergenic
958566315 3:95815922-95815944 GTTTTCAAGGATAATTTGGTGGG + Intergenic
958573156 3:95912667-95912689 GTTTTTAAGGTCAACTTGGTGGG + Intergenic
958628342 3:96655591-96655613 GTTTCTAAAGATAATTTGGTGGG - Intergenic
958713349 3:97745823-97745845 ATTTTTAAGGGTAATTTTGATGG + Intronic
958968066 3:100581085-100581107 GTTTTTAAGGACAACTTGGTGGG + Intergenic
959295263 3:104527555-104527577 TTTTTTAAGGATAACTTGGTGGG - Intergenic
959378298 3:105611626-105611648 GTTTTTAAGGATAATTCGGTGGG + Intergenic
959435808 3:106313772-106313794 GATGTTATGGGTACTTTGATAGG + Intergenic
960001518 3:112736510-112736532 GTTTTTAAGGATAACTTGGTTGG + Intergenic
960004718 3:112770314-112770336 GTTTTTTAGGACAATTTGGTGGG - Intronic
960006601 3:112787515-112787537 GTTTTTAAGGACAATTTGGTGGG - Intronic
960609568 3:119543082-119543104 GTTTTTAAGGATAACTAGGTGGG - Intronic
960877220 3:122309267-122309289 GTTTTTAAGGATAATTTGGTGGG - Intergenic
962094167 3:132276561-132276583 GTTTTTAAAGATAATTTGGTCGG + Intronic
963059358 3:141212422-141212444 GTTTTTAAGGATAATTTGGTGGG - Intergenic
963108057 3:141663509-141663531 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
963314252 3:143742274-143742296 TTTTTTAAGGATAACTTGGTGGG - Intronic
963470485 3:145735669-145735691 GTTTTTAAGGTTAATTTGGCAGG + Intergenic
963521565 3:146363845-146363867 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
963717718 3:148822622-148822644 TTTTTTAAGGATAATTTGTTGGG + Intronic
963993117 3:151676471-151676493 GTTTTTAAGGACAACTTGGTGGG - Intergenic
964011667 3:151899174-151899196 GTTTTCAAGGATAGTTTGGTGGG - Intergenic
964111978 3:153097185-153097207 TTTTTTAAGGATAATTTGGTGGG - Intergenic
964312753 3:155411940-155411962 GTTTTTGTGGGCAGTTTGGTAGG + Intronic
964366208 3:155953335-155953357 GTTTTTAAGGATTATTTGGTGGG + Intergenic
964866565 3:161268937-161268959 GTTTTTAAAGATAATTTGGCGGG - Intergenic
964895036 3:161585841-161585863 GGATTTAAGGAGACTTTGGTTGG - Intergenic
964899207 3:161637618-161637640 GTTTTTAAAGATAATTTGGCTGG + Intergenic
964921103 3:161896649-161896671 GTTTCTAAGGATAATTTGGTGGG - Intergenic
964921236 3:161898155-161898177 GTTTTTAAGGATAACTTGGTGGG - Intergenic
965200655 3:165653857-165653879 TTTTTCAAGGATAGTTTGGTTGG - Intergenic
965364222 3:167778394-167778416 GTTTGTAAGGATAATTTGGTGGG + Intronic
965805611 3:172538415-172538437 GCTTTTAAGGATAACTTGGTGGG - Intergenic
966381107 3:179346519-179346541 ATTTTTAAGGACAATTTGGTGGG - Intergenic
966533875 3:181009434-181009456 GTTTTTAAGGATAATTTGGTGGG + Intergenic
966709212 3:182952767-182952789 GATTTAAAAGGTACTTTGGTTGG - Intronic
966757439 3:183384636-183384658 GTTTTTAAGGATAACTTGGTGGG - Intronic
966843792 3:184110527-184110549 GTTTTTAAGGACAACTTGGTGGG - Intergenic
966934844 3:184699411-184699433 GTTTTTAAGGACAACTTGGTAGG + Intergenic
967515389 3:190362461-190362483 GTTTTTAAAGATAATTTGGCAGG - Intronic
967760890 3:193225331-193225353 GTTTTTAAGGATAATATGGTGGG - Intergenic
967915493 3:194575266-194575288 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
967962247 3:194935120-194935142 GTTTCTAAGGATAATTTGGTGGG + Intergenic
968043524 3:195609340-195609362 TTTTTCAAAGGTAATTTGGTAGG - Intergenic
968120733 3:196124005-196124027 GTTTTTAAGGATAATTTGGTGGG - Intergenic
968146465 3:196303230-196303252 GTTTTTAAGGACAGCTTGGTGGG - Intronic
968151898 3:196343570-196343592 GTTTTTAAGGACAGCTTGGTGGG + Intergenic
968163221 3:196443977-196443999 GATTTTTAGGATAATTTGGTTGG + Intergenic
968210468 3:196844528-196844550 GTTTTTAAGGATAATTTGGTGGG + Intergenic
968291013 3:197539814-197539836 GTTTTTAAGGATAATTTGGTGGG - Intronic
968300859 3:197613421-197613443 TTTTTCAAAGGTAATTTGGTAGG + Intergenic
968342713 3:197971006-197971028 TTTTTGAAGGGTACTTTCATTGG + Intronic
968928605 4:3563333-3563355 GTTTTTAAAGATAATTTGGCAGG - Intergenic
970027504 4:11639252-11639274 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
970237540 4:13973759-13973781 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
970440056 4:16072998-16073020 GTTTTTAAGTATAATTTGGTGGG - Intronic
970528908 4:16962352-16962374 GTTTTTAAAGATAATTTCGTGGG + Intergenic
970579355 4:17460719-17460741 GTTTTTAAGGACAACTTGGTGGG + Intronic
970592661 4:17572891-17572913 GTTTTTAAGGATAATTTGGTGGG - Intergenic
970650005 4:18167222-18167244 GTTTTTAAGGACAATTTGGTGGG - Intergenic
970723016 4:19009886-19009908 GTTTTCAAGGATAATTTGGTGGG + Intergenic
970729594 4:19087732-19087754 GTTTTTAAAGATAATTTGGGGGG + Intergenic
971238382 4:24864534-24864556 GTTTTCAAGGATAATTTGGCAGG - Intronic
971642848 4:29157857-29157879 TTTTTCAAGGGTAGTCTGGTGGG + Intergenic
972228691 4:37044960-37044982 GTTTTTAAAGATAATTTGGCAGG + Intergenic
972301460 4:37789223-37789245 GTTTTTAAAGATAAATTGGTGGG + Intergenic
972561681 4:40234356-40234378 GTTTCTAAGGGTGCTCTGGGTGG + Intronic
972568651 4:40291140-40291162 GTTTTGAAGGATAATTTGGTGGG - Intergenic
972743812 4:41913792-41913814 GTTTTTAAGGATAATTTGGTGGG - Intergenic
972819435 4:42682901-42682923 GTCTTTAGGGATAATTTGGTGGG + Intergenic
972942599 4:44215110-44215132 GTTTTAAAAGATAATTTGGTGGG - Intronic
972973866 4:44609950-44609972 TTTTTAAAGGCTAATTTGGTGGG - Intergenic
973248988 4:48041936-48041958 GTTTTTAAGGAAAATTTGGTGGG + Intergenic
973252942 4:48079546-48079568 GTTTTTAAGGACAACTTGGTGGG - Intronic
973779612 4:54276229-54276251 GTTTTTAAGGATGATTTGGTGGG - Intronic
973970874 4:56212691-56212713 TTTTTTGTGTGTACTTTGGTAGG - Intronic
974433941 4:61833446-61833468 GTTTTTAAGGACAACTTGGTGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974560880 4:63515872-63515894 GTTTTCAAGGGTAATTTTTTAGG - Intergenic
974703988 4:65487726-65487748 TTTTTTAAAGATAGTTTGGTGGG - Intronic
975293532 4:72705605-72705627 GTTTTTAAAGATAATTTGGTGGG - Intergenic
976008091 4:80454841-80454863 GTTTTTAAGGATAACATGGTGGG + Intronic
976188681 4:82468470-82468492 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
976278879 4:83307098-83307120 GCTTTTAAGGATAATTTGGCCGG - Intronic
976322069 4:83727489-83727511 GTTTTAATGGATACTTTGGTGGG + Intergenic
977056986 4:92204874-92204896 GTTTTTAAGGATAATTTGGTGGG + Intergenic
977198489 4:94088521-94088543 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
977389013 4:96384012-96384034 GTTTTTAAGGATAATTTGGTGGG + Intergenic
977509976 4:97951173-97951195 GATTTTAAGGACAATTTGGTGGG - Intronic
977610395 4:99024422-99024444 GTTTTTACGGATAATTTGGTTGG + Intronic
977926232 4:102703783-102703805 GTTTTTAAAGATAATCTGGTGGG - Intronic
978032163 4:103948695-103948717 GTTTTTAAAGATAATTTGGTAGG + Intergenic
978307581 4:107348515-107348537 GTTTTTAAGGATAATTTGGTGGG - Intergenic
978319339 4:107477167-107477189 GTTTTTAAGGAGAACTTGGTGGG + Intergenic
978339758 4:107709797-107709819 TTTTTTAAGGATAGTTTGGTTGG - Intronic
978365085 4:107973044-107973066 GTTTTTAAGGGTAAATTGGTAGG - Intergenic
978398538 4:108307868-108307890 GTTTTTAAGGATAATTTGGTGGG + Intergenic
978427404 4:108596684-108596706 GTTTTTATGGTCAATTTGGTGGG - Intergenic
978457360 4:108908780-108908802 GTTTTTAAGGATAATTTGGTGGG + Intronic
978557534 4:109997072-109997094 GTTTTTAAGGACAGCTTGGTGGG + Intronic
978863284 4:113476984-113477006 GTTGTTAAGGATAATTTGGCAGG - Intronic
978882126 4:113718272-113718294 GTTTTTAAGGATAATTTGGTAGG + Intronic
979052989 4:115957772-115957794 GTATTTAAGGGTATTTTTCTGGG + Intergenic
979054102 4:115975338-115975360 GTTTTTAAAGATAATTTGGCAGG + Intergenic
979054676 4:115979550-115979572 CTTTTTAAGAGTACATTGCTGGG + Intergenic
979084930 4:116396204-116396226 GTTTTTAAGGACAACTTGGTGGG + Intergenic
979308133 4:119172354-119172376 CTTTTTAAGGAAAATTTGGTGGG + Intronic
979350955 4:119643991-119644013 GTTTTTATGGATAATTTGGCAGG - Intergenic
979458597 4:120953889-120953911 GTTTTTATGGATAATTTGGTGGG - Intergenic
979484692 4:121257219-121257241 GTTTTTAAGGATAACTTGGTGGG + Intergenic
979719209 4:123879311-123879333 GTTTTTAAGGATAATTTGATGGG - Intergenic
980121447 4:128732189-128732211 GTTTTTAAGGATAATTTGGTGGG + Intergenic
980145737 4:128981655-128981677 GTTTTTAAGGATAATTTGGCGGG - Intronic
980215913 4:129852779-129852801 GTTCTTAAGGGTACTGGGGTAGG + Intergenic
980222069 4:129930320-129930342 GTTTTTAAGGATAATTCGGCGGG - Intergenic
980270447 4:130577154-130577176 AGTTTTAAGGATAATTTGGTGGG - Intergenic
980339964 4:131532175-131532197 GTTTTTAAGGATAATTTGGCAGG - Intergenic
980466723 4:133196274-133196296 GTTTTTAAGGATGATTTGGTGGG + Intronic
980489177 4:133503925-133503947 GTTTTCAAAGGTAGTTTGGTGGG + Intergenic
980516298 4:133867012-133867034 GTTTCTCAGGGCACTTTGGGGGG - Intergenic
980564333 4:134518896-134518918 ATTTTTAAGGGCACTTTGGTGGG - Intergenic
980777426 4:137454469-137454491 GTTTTTAAGGATAATTTTGTTGG - Intergenic
980817530 4:137967542-137967564 GTTTTTGAGGATAATTTGGTGGG + Intergenic
980872684 4:138627413-138627435 GTTTTTAAGGATAATTTGGTAGG - Intergenic
980950416 4:139370115-139370137 TTTTTTAATGGAAGTTTGGTAGG + Intronic
980963558 4:139499654-139499676 GTTTTTAAGGGTACTTTGGTGGG - Intronic
980972307 4:139578256-139578278 GTTTTTAAGGATAATTTGGTGGG + Intronic
980972615 4:139581146-139581168 GTTTTTAAAGATAATTTGGCGGG + Intronic
981305798 4:143245768-143245790 TTTTTTAAGGATAATTTGGTAGG - Intergenic
981447579 4:144857960-144857982 GTTTTAAAGAGTACTTTGTTGGG - Intergenic
981536941 4:145809835-145809857 TTTTTTATGGATAATTTGGTGGG - Intronic
981812590 4:148792800-148792822 GTTTTTCAGGGAAGTGTGGTAGG - Intergenic
981893372 4:149765986-149766008 ATTTTTAAGGATAATTTGGCGGG - Intergenic
981980439 4:150785104-150785126 GTTTTTCAGGATAATTTGGTGGG + Intronic
982237155 4:153262283-153262305 TTTTTCAAGGGTAGTTTGGTGGG + Intronic
982475109 4:155841037-155841059 GTTTTTAAGGATAATTTGGTGGG - Intronic
983408973 4:167372333-167372355 GATTTTAAGTGTACTTTGTAAGG + Intergenic
983470098 4:168144992-168145014 ATTTTTAAGGATAATTTAGTGGG + Intronic
983496719 4:168450389-168450411 GTTTTTAAGGACAACTTGGTGGG - Intronic
983660102 4:170122598-170122620 GTTTTTAAGGATAATTTGGTGGG - Intergenic
983736476 4:171068715-171068737 ATTTTTAAGGATGATTTGGTGGG - Intergenic
983837540 4:172410716-172410738 TTTTTTAAGTTTACTTTGGTAGG + Intronic
984091547 4:175381180-175381202 GTTTTTAAAGATAATTTGGAGGG - Intergenic
984097845 4:175453586-175453608 GTTTTTAAGGACAACTTGGTGGG + Intergenic
984247971 4:177298088-177298110 GTTTTTAAGGATAATTTGGTAGG - Intergenic
984701949 4:182824241-182824263 GTTTTTAAGGATAACTTGGTGGG - Intergenic
984902804 4:184600055-184600077 GTTTTTAAGGATAATTTGGTGGG - Intergenic
984903888 4:184609357-184609379 GATTTTAGGGATAATTTGGTGGG - Intergenic
985062104 4:186090113-186090135 TTTTTTAAGGATAGTTTGGTGGG - Intergenic
985100345 4:186452275-186452297 ATTTTTATGGATACTTTGGCAGG + Intronic
985216737 4:187661305-187661327 TTTTTCAAGGGTAGTTTGGTGGG - Intergenic
985317200 4:188670923-188670945 GTTTTTAAGGATAACTTGCTGGG + Intergenic
985389930 4:189483359-189483381 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
985753081 5:1693947-1693969 GTTTTCAAGGCTAGTTTGGTAGG - Intergenic
986212183 5:5684350-5684372 GTTTTTAAGGATAACTTGATGGG + Intergenic
986241552 5:5964667-5964689 GTTTTCAAAGATAGTTTGGTGGG - Intergenic
986320233 5:6625193-6625215 GTTTTTAAGGCCATCTTGGTAGG - Intronic
986463441 5:7996790-7996812 GTTTTTAAAGACAATTTGGTGGG + Intergenic
986567192 5:9126656-9126678 GTTTTTGAGGGTACTTTGGCAGG + Intronic
986990226 5:13543825-13543847 GTTTTTAAGGGCAATTTGATGGG - Intergenic
987191446 5:15482778-15482800 GTTTTTATGGACAATTTGGTGGG + Intergenic
987486358 5:18532396-18532418 TTTTTTAAGGATAATTTGGTGGG + Intergenic
987491207 5:18582419-18582441 TTTTTCAAGGATAATTTGGTGGG + Intergenic
987853982 5:23394441-23394463 GTTTTTAAGGATAATTTGGTAGG - Intergenic
988130341 5:27096151-27096173 GTTTTTAAGGATAATTTGGTGGG + Intronic
988419854 5:30992182-30992204 GTTTTTAAGGATAATTTGGTAGG - Intergenic
988680195 5:33477291-33477313 GTTTTTAGGGCTAATTTGGTGGG - Intergenic
988726100 5:33928004-33928026 GTTTTTAAAGATAATTTGGTGGG + Intergenic
988776333 5:34480956-34480978 GTTTTTAAGGACAACTTGGTGGG - Intergenic
988783167 5:34541894-34541916 GTTTTTAAAGATAGTTTGGTGGG + Intergenic
988783309 5:34543150-34543172 GTTTTTAAGGACAACTTGGTGGG + Intergenic
988875320 5:35438881-35438903 ATTTTCAAGGATAGTTTGGTGGG + Intergenic
988983170 5:36591870-36591892 GTTTTTAAGGATAATTTGGTGGG + Intergenic
989010730 5:36869272-36869294 GTTTTTAAGGATAATTTGGTGGG + Intergenic
989145787 5:38248841-38248863 GTTTTTAGGGATAATTTGGTGGG + Intergenic
989387960 5:40871956-40871978 GTTTTTAAGCGTACTTTGGTGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989618370 5:43359966-43359988 GTTTTTATGGATAATTTGGTGGG - Intergenic
990208828 5:53459168-53459190 GTTTTTAAGGACAACTTGGTGGG - Intergenic
990260195 5:54013849-54013871 CTTTTCAAGGGTAGTTTGTTGGG - Intronic
990304873 5:54484145-54484167 CTTTTTTAGGGTTTTTTGGTTGG - Intergenic
990307285 5:54505783-54505805 TTTTTTAAGGATAATTTGCTGGG + Intergenic
990495758 5:56346299-56346321 GTTTTTATGGTCAATTTGGTGGG + Intergenic
990744367 5:58943685-58943707 TTTTTCAAGAGTAATTTGGTGGG + Intergenic
991030401 5:62076499-62076521 GTTTTTAAGGATAATTTGGTGGG - Intergenic
991142053 5:63255794-63255816 GTTTTTAAAGACAATTTGGTGGG - Intergenic
991239922 5:64445770-64445792 GTTTTTAAGGACAGCTTGGTGGG - Intergenic
991370312 5:65911822-65911844 GTTTTTAAGGATGCTATGGCTGG - Intergenic
991410343 5:66339368-66339390 GTTTTCAAGGATAGTTTGGTGGG + Intergenic
991492212 5:67194541-67194563 GTTTTCAAGGATAGTTTGGTGGG - Intronic
991496645 5:67233288-67233310 GTTTTTAAGGATAACTCGGTGGG - Intergenic
991611439 5:68453886-68453908 TTTTTTAAGGATAATTTGATGGG + Intergenic
991657469 5:68918474-68918496 GTTTTGAAGGATAATTTTGTGGG + Intergenic
991674681 5:69079180-69079202 GTTTTTAAGGACAACTTGGTGGG - Intergenic
991692854 5:69242260-69242282 TTTTTCAAGGATAGTTTGGTAGG + Intronic
991997350 5:72401020-72401042 GTTTACAAGGATAATTTGGTGGG - Intergenic
992107403 5:73461326-73461348 GTTTTTAAGGATAACTTGGTGGG - Intergenic
992286613 5:75242119-75242141 GTGTTTAAAGATAATTTGGTGGG + Intergenic
992722858 5:79577951-79577973 GTATTTAAGGATAATTTTGTGGG - Intergenic
992723228 5:79580989-79581011 GTTTTTAAGGATCATTTGGTGGG - Intergenic
992781681 5:80133814-80133836 GTTTTTAAGGATAATTTGGTGGG + Intronic
992959148 5:81941066-81941088 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
993272871 5:85817484-85817506 GTTTTTAAAGATATTTTGGCAGG - Intergenic
993416484 5:87639378-87639400 GTTTTTATGGATAATTTTGTGGG + Intergenic
993421937 5:87713859-87713881 ATTTTTAAGGATAACTTGGTGGG + Intergenic
993647965 5:90482826-90482848 GATTTTAAAGTTAATTTGGTGGG - Intronic
993966463 5:94366105-94366127 GTTTTTAAGGATAATTTGGTAGG - Intronic
994648398 5:102498130-102498152 GTTTTTAAAGATAATTTGGCTGG - Intronic
994778320 5:104062791-104062813 GTTTCTAAGGATAACTTGGTGGG - Intergenic
995075519 5:107978718-107978740 TTTTTCAAGGATAGTTTGGTGGG - Intronic
995200985 5:109425066-109425088 GTTTTTAAGGATAATTTGGTGGG - Intergenic
995797627 5:115958519-115958541 GCTTTTAAGGAGAATTTGGTGGG - Intergenic
996132255 5:119795784-119795806 GTTTTTAAGGACAACTTGGTGGG + Intergenic
996132518 5:119798767-119798789 GTTTTTAAGCATAATTTGGTGGG - Intergenic
996520411 5:124420023-124420045 GTTTTTAGGGCTTTTTTGGTGGG - Intergenic
996787372 5:127255012-127255034 GTTTGTATGGATAATTTGGTGGG + Intergenic
996955506 5:129178642-129178664 GTTTGTAAAGTTAATTTGGTGGG + Intergenic
997005833 5:129815154-129815176 GTTTTTAAGAATAATTTAGTGGG + Intergenic
997158694 5:131584766-131584788 TTTTTTAAGGATAGTTTGGTGGG - Intronic
997301479 5:132809237-132809259 GTTTTTAAGGATAATTTGGTGGG - Intergenic
997497668 5:134343805-134343827 GTTTTTAAGGACAACTTGGTGGG - Intronic
997545314 5:134701301-134701323 GTTTTAAAGGGTATATTTGTTGG + Intronic
997750464 5:136339726-136339748 GTTTTTAAGAATAATTTAGTGGG - Intronic
998684379 5:144506972-144506994 TGTTTTAAGGATAATTTGGTAGG - Intergenic
998996763 5:147874627-147874649 GTTTTTAAGGATAACTTGGTGGG - Intronic
999105489 5:149067344-149067366 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
999405292 5:151301585-151301607 GTTTTTAAAGATAATTTGGTGGG - Intronic
999414363 5:151381802-151381824 GTTTTTAAGGATAACATGGTGGG - Intergenic
999898112 5:156056629-156056651 TTTTTTAAGGATAATTTGGCAGG - Intronic
1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG + Intergenic
1000718610 5:164678699-164678721 CTTTTCAAGGATAGTTTGGTGGG + Intergenic
1000725388 5:164763260-164763282 GTTTTTAAGGATAATTTAGTGGG + Intergenic
1000831815 5:166111262-166111284 GATTTTAAGGATAACTTGGTGGG - Intergenic
1000847865 5:166304090-166304112 GTTTTTATGGATAATTTGGTGGG + Intergenic
1000847947 5:166304835-166304857 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1001566708 5:172704242-172704264 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1001890889 5:175337539-175337561 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1001915901 5:175559814-175559836 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1001921750 5:175606064-175606086 TTTTTTAAGGATGGTTTGGTGGG + Intergenic
1002165559 5:177342703-177342725 GTTTTAAAGGGTTTTTTTGTTGG - Intronic
1003025159 6:2548231-2548253 TTTTTTAAGGATAGTTTGATGGG - Intergenic
1003199790 6:3948870-3948892 TTTTTTAATGGTACTTTGCCAGG + Intergenic
1003267971 6:4583216-4583238 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1003312356 6:4980709-4980731 GTTTTTAAGAATAATTTGGTAGG + Intergenic
1003877287 6:10450043-10450065 GTTTTTAAGGACAAGTTGGTGGG - Intergenic
1004232754 6:13847824-13847846 TTTATTAAGGGTACTTTGGAAGG - Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004359091 6:14955071-14955093 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1004468085 6:15904409-15904431 ATTTTTAAGTATAATTTGGTGGG + Intergenic
1004504323 6:16235725-16235747 TTTTTTAAGGATAATTTGGTGGG + Intergenic
1004906730 6:20243670-20243692 GTTTTTAAGGACAGTTTGGTGGG + Intergenic
1004921627 6:20381439-20381461 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1005034372 6:21542319-21542341 GTTTTTAGGTATAATTTGGTGGG + Intergenic
1005034742 6:21545289-21545311 GTTTTTAAGGAAAATTTGATGGG + Intergenic
1005292928 6:24396880-24396902 GTTTTTATGGACAATTTGGTGGG + Intergenic
1005507274 6:26480544-26480566 GTTTTTATGGACAATTTGGTGGG + Intergenic
1005661761 6:28005335-28005357 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1005709133 6:28486637-28486659 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1005748349 6:28861106-28861128 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1005761083 6:28968934-28968956 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1006329008 6:33376009-33376031 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1006355916 6:33557739-33557761 ATTTTTAAGGATAGTTTGGTGGG + Intergenic
1006695817 6:35929736-35929758 GTTTTTAAGATTATTTTAGTGGG - Intergenic
1007012680 6:38432814-38432836 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1007144901 6:39618813-39618835 GGTTTTAGGGATTCTTTGGTTGG - Intronic
1007276858 6:40680393-40680415 GTCTTTAAAGATAATTTGGTGGG - Intergenic
1007466922 6:42059018-42059040 GTTTTTAAGGATAATGTGGTAGG + Intronic
1007723836 6:43902322-43902344 GTCTTTAAGGGTTCTTTGGTGGG - Intergenic
1008103347 6:47416379-47416401 GTTTTTATGGATAATTTGGTGGG + Intergenic
1008477161 6:51944631-51944653 GTTTTCAAGGGTAGTTTGTTGGG - Intronic
1008504060 6:52211905-52211927 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1008745661 6:54666930-54666952 TTTTTTGAGGCTAGTTTGGTGGG - Intergenic
1008939321 6:57029415-57029437 GTTTTTAAGGATAATTTGGCGGG - Intergenic
1009625807 6:66137979-66138001 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1009717179 6:67412707-67412729 GTTTTTAAGGATAATTTTGCAGG - Intergenic
1009750891 6:67878380-67878402 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1009901547 6:69813076-69813098 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1010064522 6:71666262-71666284 GATTTGATGGGTAATTTGGTTGG + Intergenic
1010201107 6:73282836-73282858 GTTTTTAAGGATAATATGGTGGG - Intronic
1010201311 6:73284493-73284515 GTTTTTATAGATAATTTGGTGGG - Intronic
1010440132 6:75884653-75884675 ATTTTTAAGGATAATTTGGTAGG + Intronic
1010512940 6:76743220-76743242 GTTTTTAAGGATAATTTGACAGG - Intergenic
1011022804 6:82833175-82833197 GTTTTCAAGGACAGTTTGGTGGG + Intergenic
1011049316 6:83126902-83126924 GTTTTTAAGGATAATTTGGTGGG + Intronic
1011338639 6:86287466-86287488 GTTTTTAAGGATGATTTGGTGGG + Intergenic
1011491986 6:87901666-87901688 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1011513097 6:88123084-88123106 GTCTTTAAGGTTAATTTGGTGGG - Intergenic
1011612681 6:89168750-89168772 TTTTTTAAGGCTAATTTGGCAGG + Intergenic
1011680412 6:89777856-89777878 GTTTTTATGGATAATTTGGTGGG - Intronic
1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG + Intergenic
1012618112 6:101302900-101302922 GTTTTTAAGGACAATTTGATGGG - Intergenic
1012842269 6:104344304-104344326 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1013086076 6:106858939-106858961 GCTTTTAAGGATAATTTGCTGGG - Intergenic
1013089642 6:106888498-106888520 GTTTTTAAGGATAATTTAGTGGG - Intergenic
1013257528 6:108403368-108403390 TTTTTGACGTGTACTTTGGTTGG + Intronic
1013482879 6:110567239-110567261 CTTTTTAAGTGAATTTTGGTGGG - Intergenic
1013487921 6:110616042-110616064 TTTTTCAAAGATACTTTGGTGGG - Intronic
1013779818 6:113717059-113717081 GTTTTTAAGTGTACATTGAATGG - Intergenic
1014629339 6:123770292-123770314 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1014784481 6:125602093-125602115 GTTTTTGGGGGTATTTTGGGGGG - Intergenic
1015173264 6:130278282-130278304 GTTTTTAAGGATAATTTGGTAGG - Intronic
1015277639 6:131400790-131400812 GTTCTTAAAGATAATTTGGTGGG - Intergenic
1016028718 6:139315242-139315264 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1016164048 6:140917583-140917605 ATTTTTAAGGATAATTTGGTGGG - Intergenic
1016342393 6:143077669-143077691 TTTTATAAGTTTACTTTGGTAGG + Intronic
1016514055 6:144873973-144873995 GCTTTTATGGATAATTTGGTGGG - Intergenic
1016741627 6:147534562-147534584 GTTTTTAAGGATAACTTGGTGGG + Intronic
1016742484 6:147542500-147542522 GTTTTTAAGGATAACTTGGTGGG + Intronic
1016867820 6:148785937-148785959 GTTTTTATGGGTATTTTGAGGGG + Intronic
1017177781 6:151520853-151520875 GTTTTTAAGGATAACTTGGTGGG - Intronic
1017407827 6:154139052-154139074 GTTTTTAAAGACAGTTTGGTGGG - Intronic
1017475393 6:154786159-154786181 GTTTTTAAAGATAATTTGGTGGG + Intronic
1017778578 6:157698797-157698819 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1017785531 6:157753906-157753928 GTTTTTAAAGATAATTTGGTGGG + Intronic
1017787159 6:157765934-157765956 TTTTTTAAGGATAATTTGGTGGG - Intronic
1017795720 6:157842575-157842597 GTTTTTAAAGATAATTTGGTGGG + Intronic
1017795915 6:157844292-157844314 GTTTTTAAGGACAATTTGGTGGG + Intronic
1017980565 6:159397742-159397764 GTTTTTAAGGATAATTTAGTGGG - Intergenic
1018189025 6:161292308-161292330 GTTTTTAAAGACAATTTGGTGGG - Intergenic
1018189708 6:161299631-161299653 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1018227398 6:161641507-161641529 ACTTTTAAGGATAATTTGGTAGG - Intronic
1018313200 6:162531450-162531472 GTGTTTAAGGATAACTTGGTGGG + Intronic
1019100098 6:169623302-169623324 GTTTTTAAGGATAATTTGGTGGG - Intronic
1019803864 7:3108186-3108208 GTTTCTAAGGATAATTTGGTGGG - Intergenic
1020070626 7:5224562-5224584 GTTTTTAAGGATAACTTGGGTGG + Intronic
1020518177 7:9152037-9152059 GTTTTTAGGGATAATTTGGTGGG - Intergenic
1020763997 7:12298682-12298704 GTTTTTAAGGATAATTTGGCGGG - Intergenic
1020764775 7:12305781-12305803 GTTTTTAAGAATAATTTGGTGGG - Intergenic
1020832707 7:13111340-13111362 GTTTTTAAGGACAAGTTGGTGGG + Intergenic
1020991208 7:15198635-15198657 TTTTTTAAGGATAATTTGGTGGG + Intergenic
1021507581 7:21402531-21402553 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1021732423 7:23608869-23608891 GTTTTTAAGGATAATTTGGTAGG + Intronic
1021775655 7:24052733-24052755 GTTATTAAGGGCATTTTAGTGGG + Intergenic
1022338905 7:29450235-29450257 GTTTTTAAGGATTTTGTGGTAGG + Intronic
1022649498 7:32261414-32261436 GTTTTTAAAGATAATTTGGCGGG - Intronic
1023197963 7:37663117-37663139 GTTTTTAAGGATAATTTGGCAGG - Intergenic
1023579692 7:41668515-41668537 GTTTTTAAAGATAGTTTGGTGGG + Intergenic
1023753583 7:43394875-43394897 GTTTTTAACGATAACTTGGTGGG + Intronic
1023800793 7:43832661-43832683 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1023932491 7:44714409-44714431 GTTTTTAAGGATAGTTTGGTGGG - Intergenic
1023970728 7:44988828-44988850 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1024002568 7:45200446-45200468 TTTTTTAAGGGTACTTTGGCAGG + Intergenic
1024041543 7:45559831-45559853 GATTTTATGGATAATTTGGTGGG - Intergenic
1024134041 7:46388718-46388740 GTTTTTAAGGACAGCTTGGTGGG - Intergenic
1024315899 7:48016263-48016285 GTTTTTAAAGATAGTTTGGCAGG - Intronic
1024695784 7:51855494-51855516 GATTGTAAGGATAGTTTGGTGGG + Intergenic
1025009224 7:55382547-55382569 TTTTTAAAGGATAATTTGGTGGG + Intronic
1025084238 7:56009598-56009620 TTTTTCAAGGATACTTTGGCAGG - Intergenic
1026081600 7:67226572-67226594 GTTTTTAAGGACAACTTGGTGGG - Intronic
1026128991 7:67605091-67605113 TTTTTTAAGGATAATTTGGCAGG - Intergenic
1026139220 7:67690736-67690758 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1026142861 7:67721174-67721196 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1026234685 7:68516637-68516659 ATATTTCAGGGTACTTTGCTTGG - Intergenic
1026247627 7:68635270-68635292 GTCTTAAAGGATAATTTGGTGGG + Intergenic
1026274877 7:68867824-68867846 TTTTTCAAGGGTAGTTTGTTGGG + Intergenic
1026496418 7:70907518-70907540 GTTTTTAAGGATAACTTGATGGG - Intergenic
1026519289 7:71102422-71102444 TTTTATAAGGGCACTTTGGCAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026695475 7:72587425-72587447 GTTTTTAAGGACAACTTGGTGGG + Intronic
1026967938 7:74452342-74452364 GTTTTTATGGATAATTTGGTGGG + Intergenic
1027218478 7:76199291-76199313 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1027329346 7:77075270-77075292 GTTTTTAAGGATAATTTGATAGG - Intergenic
1027435391 7:78159074-78159096 GTTTTTAAAGATAATTTGGTGGG - Intronic
1027552448 7:79616235-79616257 GTTTTTAAAGATAATTTGGCGGG - Intergenic
1027735918 7:81932838-81932860 TTTTTCAAGGGTAGTTTGATGGG + Intergenic
1028002365 7:85515286-85515308 GCTTTTAAGGATAATTTGCTGGG - Intergenic
1028248415 7:88511060-88511082 TTTTTCAAGGATAATTTGGTGGG + Intergenic
1028557285 7:92137650-92137672 GTTTTTAAGGATAACTTGGTGGG + Intronic
1028926399 7:96361221-96361243 GTTTTTCAGGATAATGTGGTAGG + Intergenic
1028985967 7:97008196-97008218 TTTTTTAAGGATCCTTTTGTAGG + Intronic
1029002359 7:97167636-97167658 GTTTTTAAGGAAAATTTGGTGGG + Intronic
1029030401 7:97460763-97460785 GTTTTTAAGGACAATTTGGTGGG - Intergenic
1029030538 7:97461898-97461920 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1029509522 7:100985172-100985194 GTTTTAAAGGATAACTTGGTGGG + Intronic
1029559631 7:101294048-101294070 GTTTTTAAGGATAATTTGATGGG + Intergenic
1029576992 7:101410070-101410092 GTTTTTAAGGTTGGTTTGGTGGG + Intronic
1029582538 7:101446962-101446984 GTTTTTAAAGACAATTTGGTGGG + Intronic
1029618830 7:101677374-101677396 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1029786417 7:102796096-102796118 GTTTTTAAGGATAATTTGATAGG + Intronic
1029787412 7:102806494-102806516 CTTTTTAAGGCTACTTAGGTAGG + Intronic
1029800458 7:102941426-102941448 GTTTTTAAAGATAATTTGCTAGG - Intronic
1029871884 7:103703221-103703243 GTTTGGAAGGGTAATCTGGTGGG - Intronic
1029916976 7:104220458-104220480 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1029921073 7:104264609-104264631 GTTTTTCAGGATAATTTGATGGG - Intergenic
1029952982 7:104606769-104606791 CTTTTTATGGGCAATTTGGTGGG + Intronic
1030194952 7:106844293-106844315 GTTTTTAAGGATAATCTGGCAGG + Intergenic
1030364281 7:108627751-108627773 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1031513779 7:122678486-122678508 TTTTGTAAGGATAATTTGGTGGG + Intronic
1031595680 7:123647099-123647121 GTTTTTAAGGACAACTTGGTAGG + Intergenic
1031702272 7:124941507-124941529 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1031840832 7:126737393-126737415 GTTTTTAAGGATAATTTGGTGGG - Intronic
1032246760 7:130219905-130219927 GTTTTTATAGGTAAATTGGTGGG - Intergenic
1032472273 7:132187182-132187204 TTTTTTAAGGATAATTTGGCAGG - Intronic
1032667144 7:134047979-134048001 GTTTTTAAAGATAATTTGGTGGG + Intronic
1032747722 7:134804960-134804982 ATTTTTAAGGGTAATTTGGTGGG + Intronic
1033069687 7:138190888-138190910 GTTTTTAAGGATAACTTGATGGG - Intergenic
1033071518 7:138207724-138207746 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1033076951 7:138258554-138258576 GTTTTTAATGATAATTTGGTGGG - Intergenic
1033091263 7:138388358-138388380 GTTTTTATGGATAATTTGGCAGG + Intergenic
1033121196 7:138668240-138668262 GTTTTTAAGGACAACTTGGTGGG - Intronic
1033340178 7:140485939-140485961 GTTTTTAAGGATAACCTGGTGGG + Intergenic
1033341708 7:140497306-140497328 GTTTTCAAGGATAGTTTGGTGGG + Intergenic
1033365835 7:140672227-140672249 GTTTTTAAGGACAACTTGGTGGG + Intronic
1033505337 7:141994370-141994392 TTTGTAAAGGGTACTTTGGTGGG + Intronic
1033587138 7:142782415-142782437 GTTTTAGAGGATAATTTGGTGGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034055055 7:148025430-148025452 GTTTTTCAAGGTAATTTGGTGGG - Intronic
1034067641 7:148152266-148152288 GTTTTTAAGGACAATTTGGTGGG + Intronic
1034100624 7:148446944-148446966 GTTTTTAAGGACAATTTAGTAGG + Intergenic
1034113824 7:148564276-148564298 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1034114373 7:148570695-148570717 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1034480535 7:151317050-151317072 GCTTGTAAGGGAGCTTTGGTGGG - Intergenic
1034482715 7:151335078-151335100 GTTTTCAAGGATAGTTTGGTGGG - Intergenic
1034585565 7:152089113-152089135 GTTTTTATGGACAGTTTGGTGGG + Intronic
1034915518 7:155035396-155035418 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1035563099 8:622602-622624 GTTTTCAAGGGTAGTCTGTTTGG - Intronic
1035716795 8:1761637-1761659 GTTTTTAAGGATAATTTGGTAGG + Intronic
1035811549 8:2495727-2495749 GTTTTTAAGGACAATTTGGTGGG + Intergenic
1035959979 8:4126171-4126193 GTTTTTAATGGTAATTTGGTGGG - Intronic
1036047972 8:5165277-5165299 GTTTTCAAGACTAATTTGGTGGG + Intergenic
1036466334 8:9001446-9001468 GTTTTTAAGGATAATTGGGTGGG + Intergenic
1036680862 8:10872266-10872288 GTTTTTAGGGAGACTTTGGGAGG - Intergenic
1036763454 8:11529318-11529340 GTTTTTAAGAATAATTTGGTGGG + Intronic
1037010636 8:13838205-13838227 ATTTTTAAGGATAATTTGGCAGG - Intergenic
1037134322 8:15443968-15443990 GTTTTTAAGGACAGCTTGGTGGG - Intronic
1037267589 8:17083075-17083097 GTTCTTAAGGATAATTTGGTGGG + Intronic
1037333120 8:17764067-17764089 GTTTTAAAGGGTTTTTTGGTGGG + Intronic
1037527341 8:19739973-19739995 TTTCTTATGGGTACTTTTGTAGG + Intronic
1037561052 8:20074708-20074730 TTTTTTAAGAATAGTTTGGTGGG + Intergenic
1037670298 8:21009691-21009713 GTTTTTAAGGACAATTTGGTGGG - Intergenic
1037986860 8:23295661-23295683 GCTTTTTAGGGTCCTTTGGGAGG - Intronic
1038090451 8:24247327-24247349 CTTTTTAAGGATAGTTTGGTGGG - Intergenic
1038160240 8:25030422-25030444 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1038165040 8:25077704-25077726 GTTTTTAAGGATAATTTGATGGG + Intergenic
1038280104 8:26156375-26156397 GTATTTATGGATAATTTGGTGGG + Intergenic
1038393644 8:27230204-27230226 GTTTTTATGGACAATTTGGTGGG - Intergenic
1038497145 8:28011495-28011517 GTTTTTAAAGATAATTTAGTGGG + Intergenic
1038666623 8:29543106-29543128 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1038732251 8:30138120-30138142 GTTTTTAAGGATAATTTGGTGGG - Exonic
1038822469 8:30965458-30965480 GTGTTTAAGGATAATTTGGTGGG + Intergenic
1039013583 8:33122478-33122500 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1039113681 8:34068253-34068275 GTTTTCAGGGATAGTTTGGTGGG - Intergenic
1039184866 8:34905797-34905819 GTTTTTAAGGACAACTTGGTCGG - Intergenic
1039184904 8:34906082-34906104 GGGTTCAAGGGTAGTTTGGTGGG + Intergenic
1039259090 8:35751086-35751108 GTTTTGAAGGATAATTTGGTGGG + Intronic
1039300642 8:36205177-36205199 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1039345927 8:36705119-36705141 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1039694334 8:39894743-39894765 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1039729392 8:40257783-40257805 GATTTTAAGACTAATTTGGTGGG + Intergenic
1039909223 8:41810841-41810863 TGTTTTAAGGGTACTTTGGCAGG + Intronic
1040386366 8:46917513-46917535 GTTTTTAAGGATAATTTGGCGGG - Intergenic
1040647640 8:49418573-49418595 GTATTTAAGGATAATCTGGTGGG - Intergenic
1040728046 8:50407794-50407816 CGTTTTAAGGATAGTTTGGTGGG + Intronic
1040772964 8:51001350-51001372 ATTTTTAATTTTACTTTGGTAGG + Intergenic
1040855452 8:51944116-51944138 GTTTTTATGGACAATTTGGTGGG - Intergenic
1040998084 8:53421865-53421887 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1041212452 8:55566251-55566273 GATTTTAAGGTTACTTTGGCAGG - Intergenic
1041240508 8:55845246-55845268 ATTTTTAAGGATAACTTGGTAGG + Intergenic
1041450300 8:57999062-57999084 GTTTTAAAGGAAACTTTAGTAGG + Intronic
1041478829 8:58295632-58295654 GTTTTTAAGTCTAATTTGGTGGG - Intergenic
1041710785 8:60892475-60892497 GTTTTGAAAGGTATTTGGGTTGG + Intergenic
1041758011 8:61334956-61334978 GGTTTTAAGGATAATTTGGTAGG + Intronic
1041917961 8:63154817-63154839 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1042198381 8:66254214-66254236 TTTTTTGAGGATAATTTGGTGGG - Intergenic
1042207296 8:66342281-66342303 ATTTTTAAGGATACTCTGGTGGG - Intergenic
1042828876 8:73005742-73005764 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1043182063 8:77097372-77097394 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1043250729 8:78069842-78069864 GTTTTTAAGGATAATCTGGTGGG - Intergenic
1043589353 8:81809822-81809844 GGTTTTAAAGGTACTTTCCTAGG - Intronic
1043668165 8:82844641-82844663 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1043706040 8:83352159-83352181 GTTTTTAAGGAAAACTTGGTGGG + Intergenic
1043853972 8:85244375-85244397 GTTTTTAAGGACAATTTGGTGGG - Intronic
1044233167 8:89802000-89802022 GTTTTTATGGATAATTTGGTGGG - Intergenic
1044553923 8:93541686-93541708 GATTTTAAGGATAATTTGGTGGG - Intergenic
1044950006 8:97426786-97426808 GTTTTTAAAATGACTTTGGTTGG - Intergenic
1044987744 8:97769915-97769937 GTTTTAAAGAATAATTTGGTGGG + Intergenic
1045196920 8:99942034-99942056 GTTTTTAAGGGTGCTCTGGTCGG - Intergenic
1045647935 8:104317545-104317567 GTTTTTATGGACAATTTGGTGGG + Intergenic
1045690833 8:104758279-104758301 GTTTTTAAGGATAACTTGGTGGG + Intronic
1045692133 8:104770770-104770792 GTTTTTAAGGATAATTTGGTGGG + Intronic
1045957000 8:107919748-107919770 GTTTTTAAGGACAACTTGGTGGG - Intronic
1045982825 8:108211583-108211605 GTTTCTAAGGATGCTTTAGTGGG - Intronic
1045991883 8:108317251-108317273 GTTTTTAAGGACAACTTGGTAGG - Intronic
1046164847 8:110418979-110419001 GTTTTTATGGATAATTTGGTGGG - Intergenic
1046190568 8:110789702-110789724 GTTTTTTTGGGCAATTTGGTGGG + Intergenic
1046433637 8:114160123-114160145 TTTTTTAAGGATAGTTTGATGGG - Intergenic
1047042091 8:121007598-121007620 GTTTTTAATGATAATTTGGCGGG + Intergenic
1047048604 8:121083233-121083255 TTTTTTAGGGATAGTTTGGTGGG - Intergenic
1047385064 8:124401448-124401470 GTTTTTAAGCATGATTTGGTGGG - Intergenic
1047533427 8:125697831-125697853 CTTTTTAAGAGCACATTGGTGGG + Intergenic
1047647361 8:126882720-126882742 GTAATTAAGGGTACACTGGTAGG - Intergenic
1047691466 8:127358945-127358967 GGTTTTATGGATAATTTGGTGGG - Intergenic
1048043823 8:130754901-130754923 TTTTTCAAGGATAATTTGGTGGG - Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049479196 8:142812102-142812124 GTTTTTAAAGGTACTTTGGCTGG - Intergenic
1050163271 9:2739790-2739812 TTTTTTAAGGATAGTTTGGCAGG + Intronic
1050441699 9:5670836-5670858 TTTTTCAAGGATAGTTTGGTGGG + Intronic
1050491656 9:6195094-6195116 TTTTTTAAGGGCAATTTGGCCGG + Intergenic
1050569204 9:6920121-6920143 GTTTTTATGGACAATTTGGTGGG + Intronic
1051048986 9:12909245-12909267 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1051266889 9:15317927-15317949 GTTTTTAAGGAAAACTTGGTGGG + Intergenic
1051269817 9:15344588-15344610 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1051371832 9:16365416-16365438 GGTTTTAAGGACAATTTGGTGGG + Intergenic
1051599009 9:18853358-18853380 TTTTTCAAGGATAGTTTGGTGGG + Intronic
1051974671 9:22935094-22935116 GTTTTTAAGGACAATTTGGTGGG - Intergenic
1052074006 9:24118287-24118309 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052317485 9:27130860-27130882 GTTTTTTAAAGTACTTTGGCCGG - Intronic
1053081507 9:35181882-35181904 TTTTTCAAGGATAGTTTGGTGGG - Intronic
1053203431 9:36167589-36167611 GTTTTTAAAGATAACTTGGTGGG + Intergenic
1053356664 9:37451725-37451747 GTTTTTAAGGATAATTTGGTGGG + Intronic
1053450124 9:38186761-38186783 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1053450184 9:38187184-38187206 GTTTTTAAGGACAATTTGGTAGG - Intergenic
1053451111 9:38194871-38194893 GTTTTTAAGGACAATTTGGTGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053803485 9:41778475-41778497 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1053900632 9:42792691-42792713 GTTTTTAAGGATAATATGGCAGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054141778 9:61536649-61536671 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1054191779 9:61989785-61989807 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054646591 9:67597927-67597949 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1054725145 9:68642509-68642531 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1054763209 9:69021666-69021688 GTATTTAAGGATAATTTGGTGGG + Intergenic
1054775298 9:69120016-69120038 GTTTTTAAAGATAATTTGGCGGG - Intergenic
1054855007 9:69889571-69889593 GGTTTTAAGAATAATTTGGTGGG - Intronic
1055037654 9:71835604-71835626 GTTTTTATGGGTGATTTGGTGGG - Intergenic
1055216747 9:73872777-73872799 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1055352968 9:75408234-75408256 TTTTTCAAGGATAGTTTGGTGGG - Intergenic
1055410899 9:76028409-76028431 GTTTTTAAAGATAATTTGGTGGG + Intronic
1055496458 9:76860011-76860033 GTTTTTCAGGGTACTTTAGTGGG + Intronic
1055878897 9:80974931-80974953 GTTTTTGAGGATAATTTGGTGGG - Intergenic
1056184081 9:84115319-84115341 GTTTTTAAAGATACATTGTTAGG + Intergenic
1056221027 9:84450910-84450932 GTTTTTAAGGCCAGCTTGGTGGG - Intergenic
1056391347 9:86144341-86144363 GTTTTTAAGGTTTACTTGGTGGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056518147 9:87374315-87374337 GTCTTTAAGGATAACTTGGTGGG + Intergenic
1056562406 9:87743110-87743132 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1056638993 9:88354230-88354252 GTTTTTAAAGACAATTTGGTGGG - Intergenic
1056640147 9:88362908-88362930 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1056641205 9:88372424-88372446 GTTTTTAAGGACAATTTTGTGGG + Intergenic
1057400749 9:94720911-94720933 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1057417635 9:94878965-94878987 GTTTTTAAGGGTAATTGGGTGGG + Intronic
1057629852 9:96710783-96710805 GCTTTCAATGTTACTTTGGTGGG - Intergenic
1057781625 9:98055331-98055353 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1058370162 9:104257084-104257106 GTTTTTAAGAATTGTTTGGTGGG - Intergenic
1058982210 9:110180668-110180690 TTTTTCAAGGATAGTTTGGTGGG + Intergenic
1058992827 9:110270928-110270950 GTTTTTAAGGATAGATTGGTGGG - Intergenic
1058995478 9:110294638-110294660 GTTTTTAAGGACATATTGGTGGG + Intergenic
1059137085 9:111817412-111817434 GTTTTTCAGGATAATTTGGTGGG + Intergenic
1059246198 9:112851738-112851760 GTTTTTAAAGATAATTTGGTGGG + Intronic
1059253323 9:112906660-112906682 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1059690896 9:116685312-116685334 GATTTTAAGGATAACTTGGTGGG - Intronic
1060079179 9:120625357-120625379 GTTTTTAAGGACAACTTGGTGGG + Intronic
1060375118 9:123110340-123110362 GTTCCCAAGGGTACTTTGGCAGG - Intronic
1060500021 9:124146192-124146214 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1060502659 9:124173764-124173786 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1061786890 9:133034506-133034528 CTTTTTAGGGTTAGTTTGGTAGG + Intronic
1062693474 9:137858305-137858327 GTTTTTAAGGTTACCTCTGTGGG + Intronic
1185446707 X:261619-261641 GTTTTTCAGGATAATTTGCTGGG + Intergenic
1185550966 X:982069-982091 GTTTTTAAGGATGATTTGGTGGG - Intergenic
1185775996 X:2803523-2803545 GTTTTTAAAGATAATTTGGCGGG + Intronic
1185817811 X:3172582-3172604 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1185894518 X:3845512-3845534 GTTTTTCATGGTACTTTTGTGGG + Intergenic
1185899636 X:3883936-3883958 GTTTTTCATGGTACTTTTGTGGG + Intergenic
1185904752 X:3922365-3922387 GTTTTTCATGGTACTTTTGTGGG + Intergenic
1185946171 X:4379100-4379122 GTTTTTAGGGATAATTTGGTGGG + Intergenic
1185973108 X:4686452-4686474 TTTTTTAAGGATAGTTTGGTGGG - Intergenic
1185974910 X:4709673-4709695 GTTTTAAAGGATAATTTGGCAGG - Intergenic
1185983640 X:4806810-4806832 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1186027208 X:5326390-5326412 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1186036677 X:5430344-5430366 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1186039077 X:5456616-5456638 GTTTTTAAAGACAATTTGGTGGG - Intergenic
1186048015 X:5557136-5557158 GTTTTTATAGATAATTTGGTAGG - Intergenic
1186062603 X:5726345-5726367 ATTTTTAAGAATAATTTGGTGGG + Intergenic
1186115557 X:6301759-6301781 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1186116610 X:6310685-6310707 GTTTTTCAGGGAAGTTTGGTGGG + Intergenic
1186132808 X:6487092-6487114 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1186166397 X:6831004-6831026 GCTTTTATGGGTAATTTGGTGGG + Intergenic
1186182072 X:6983255-6983277 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186316998 X:8381956-8381978 GTTTTTAAGGAAAATTTGGTGGG + Intergenic
1186499377 X:10039038-10039060 GGAATTAAGGGTACTTTGGGTGG - Intronic
1186680076 X:11863457-11863479 TTTTTTTAGGAGACTTTGGTGGG + Intergenic
1186711260 X:12199825-12199847 GTTTTTAAGGATAATTTGGTGGG + Intronic
1186817175 X:13249491-13249513 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1186833215 X:13411808-13411830 TTTTTTGAGGATAATTTGGTGGG - Intergenic
1186841602 X:13489746-13489768 GTTTTTATGAATAATTTGGTGGG - Intergenic
1187074236 X:15918010-15918032 GTTTTCAAGGATAGTTTGGTGGG + Intergenic
1187091262 X:16099277-16099299 GTTTTTAAGTGTATTTTGGTGGG - Intergenic
1187136272 X:16550616-16550638 TTGTTTAAGGGCACTTTGGTGGG + Intergenic
1187161443 X:16768873-16768895 TTTTTAAAGGATAATTTGGTGGG - Intergenic
1187536703 X:20147408-20147430 GTTTTAAAGGATAATTTGGTGGG - Intergenic
1188138620 X:26521028-26521050 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1188148567 X:26644804-26644826 GTTTTTAAAGATAATTTGGCAGG + Intergenic
1188179792 X:27040479-27040501 GTTTTTAAGCATAATTTGGCGGG - Intergenic
1188249508 X:27875399-27875421 TTTTTTAAGGGTAGTTTTGCTGG + Intergenic
1188286292 X:28328898-28328920 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1188495979 X:30783386-30783408 GTTTTTAAGGATAATTTGGCGGG - Intergenic
1188686484 X:33076229-33076251 GTTTTTAAGGACAATTTGGTGGG - Intronic
1188686564 X:33076910-33076932 GTTTTTAAGGATAACTTGGTGGG + Intronic
1188687349 X:33084450-33084472 GTTTTTAAGGATAACTTGGTGGG + Intronic
1188751178 X:33907304-33907326 GTTTTTAAAGATAATTTGGCAGG - Intergenic
1188871727 X:35381743-35381765 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1188881224 X:35494224-35494246 GTTTTTAAAGATAATTTGGTGGG + Intergenic
1188902672 X:35753218-35753240 GTTTTTAAAGATAATTTGGCGGG + Intergenic
1188909383 X:35826856-35826878 GTTTTTATGGATAATTTGGCAGG - Intergenic
1188910360 X:35839811-35839833 TTTTTAAAGGGTACTTGGGTGGG + Intergenic
1188999731 X:36931059-36931081 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1189194143 X:39138246-39138268 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1189348819 X:40262195-40262217 ATTTTCAAGGGTACTTTTATTGG + Intergenic
1189415235 X:40806892-40806914 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1189416822 X:40822646-40822668 GTTTTTAAGGACAATTTGGTAGG - Intergenic
1189483496 X:41411168-41411190 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1189515868 X:41712964-41712986 GATTTTAAGGATAATTTGGTGGG - Intronic
1189619647 X:42821926-42821948 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1189758980 X:44301330-44301352 TTTTTTAAGTATAATTTGGTCGG - Intronic
1189777526 X:44483637-44483659 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1189784821 X:44549995-44550017 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1189789606 X:44590873-44590895 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1189792849 X:44620063-44620085 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1189953639 X:46257206-46257228 TTTTTTGAAGGTAGTTTGGTGGG + Intergenic
1189958415 X:46301268-46301290 TTTTTTAAGGGTACTTTGGCAGG + Intergenic
1189983503 X:46533283-46533305 TTTTTCAAGGATAGTTTGGTAGG - Intronic
1190007568 X:46755118-46755140 GCTTATAAGTGTCCTTTGGTGGG + Intronic
1190083747 X:47377240-47377262 TTTTTAAAGGATAATTTGGTGGG - Intronic
1190083852 X:47378126-47378148 GTTTTTAACGATAATTTGGTGGG + Intronic
1190368662 X:49721253-49721275 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1190369015 X:49723870-49723892 GTTTTTAAGGAAAACTTGGTGGG + Intergenic
1190477519 X:50842594-50842616 GTTTTTAAGGGCAACTTGGTGGG + Intergenic
1190862149 X:54355407-54355429 TTTTATTACGGTACTTTGGTTGG - Intronic
1191118470 X:56876337-56876359 GTTTTTAAAGATAAATTGGTGGG + Intergenic
1191127643 X:56974739-56974761 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1191798554 X:65051778-65051800 TTTTTTAAGGACACTTTGGCAGG + Intergenic
1192063519 X:67856001-67856023 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1192338721 X:70243838-70243860 GTTTTTAAGGATAACTTGGTAGG - Intergenic
1192681658 X:73259440-73259462 CTTTTTAGAGTTACTTTGGTGGG + Intergenic
1192812331 X:74558430-74558452 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1193125585 X:77867028-77867050 GTTTTTAAGGATAGCTTCGTGGG - Intronic
1193148631 X:78103020-78103042 GTTTTTAAGGATAATTTGGCAGG - Intronic
1193431076 X:81406806-81406828 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1193433953 X:81448758-81448780 GTTTTTAGGGATAATTTGGCGGG - Intergenic
1193523583 X:82560595-82560617 GGTTTTAAAGATAATTTGGTGGG - Intergenic
1193530097 X:82645785-82645807 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1194073730 X:89361617-89361639 GTTTATAAGGATAATTTGGTGGG + Intergenic
1194111202 X:89836813-89836835 GTTTTTAAGGACAATTTGATGGG + Intergenic
1194302328 X:92203688-92203710 GTTTTTAAGGATAATTTGGTGGG + Intronic
1194411528 X:93564275-93564297 GTTTTAAATGATAATTTGGTGGG - Intergenic
1194577146 X:95627150-95627172 CTTTTTAAGGATAATTTGGTGGG - Intergenic
1194614423 X:96083778-96083800 TCTTTTAAGGATAGTTTGGTGGG - Intergenic
1194641569 X:96409137-96409159 GTTTTTAAATATAATTTGGTGGG - Intergenic
1194718254 X:97311466-97311488 GTTTTTAAGGACAACTTGGTGGG + Intronic
1194758471 X:97765786-97765808 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1194762714 X:97813656-97813678 GTTTTTCAGGGAATTTTGATGGG - Intergenic
1194918626 X:99735414-99735436 GGGTTTAAGGGAACTTTGGTAGG + Intergenic
1194932493 X:99904471-99904493 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1194960067 X:100224705-100224727 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1195048487 X:101076476-101076498 GTTTTTAAGGATAACTTGGTAGG - Intergenic
1195087010 X:101422326-101422348 GTTTTTAAAGATAACTTGGTGGG + Intronic
1195258604 X:103112159-103112181 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
1195484903 X:105393149-105393171 TTTTTCAAGGATAATTTGGTGGG + Intronic
1196082222 X:111645266-111645288 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1196251859 X:113470219-113470241 CTTTTTAAAGATAATTTGGTGGG + Intergenic
1196287561 X:113899940-113899962 GTTTTTAAGGATAGTTTGGTGGG - Intergenic
1196543863 X:116939802-116939824 ATTTTTAAGGATAATTTTGTGGG - Intergenic
1196862737 X:120042975-120042997 GTTTTTAAGGATAACTTGGTGGG - Intergenic
1196880365 X:120193369-120193391 GTTTTTAAGGATAACTTGGTGGG + Intergenic
1196963520 X:121030120-121030142 GTTTTTAAGGATAATTTGGTGGG + Intergenic
1197067001 X:122245524-122245546 TTTTTTAAGGACAATTTGGTGGG + Intergenic
1197111111 X:122775979-122776001 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1197213450 X:123846880-123846902 GTTTTTATGGACAATTTGGTGGG - Intergenic
1197245725 X:124164364-124164386 TTTTTCAAGGATAGTTTGGTGGG + Intronic
1197678742 X:129359579-129359601 GTTTTTAGGGATAATTTGGTAGG - Intergenic
1198612032 X:138411977-138411999 GGCTTTAAGGGAACATTGGTGGG + Intergenic
1199082504 X:143592350-143592372 GTTTTTAAGAATATTTTGGTGGG - Intergenic
1199362119 X:146933312-146933334 GTTTTTAAGGATAATTTGGTGGG - Intergenic
1199372277 X:147064443-147064465 GTTTTTAAAAATAATTTGGTAGG + Intergenic
1199556000 X:149109372-149109394 TTTTTCAAGGATAGTTTGGTAGG - Intergenic
1199993504 X:153003967-153003989 GTTTTTAAAGATAATTTGGTGGG - Intergenic
1200463866 Y:3491556-3491578 GTTTTTAAGGACAATTTGATGGG + Intergenic
1200624770 Y:5497880-5497902 GTTTTTAAGGACAACTTGGTGGG + Intronic
1200729111 Y:6713175-6713197 GTTTATAAGGATAATTTGGTGGG + Intergenic
1201233316 Y:11886889-11886911 GTTTTTAAACATAATTTGGTGGG - Intergenic
1201262921 Y:12177875-12177897 GTTTTTAAGGACAACTTGGTGGG + Intergenic
1201294001 Y:12448178-12448200 GTTTTTAAAGATAATTTGGCGGG - Intergenic
1201296537 Y:12468030-12468052 GATTTTAAGGATAATTTGGTGGG - Intergenic
1201355476 Y:13092835-13092857 GTTTTTAAAGATACTTTGGCAGG + Intergenic
1201642350 Y:16193056-16193078 GTATTTAAGGATAATTTGGTGGG - Intergenic
1201660464 Y:16392264-16392286 GTATTTAAGGATAATTTGGTGGG + Intergenic
1201701612 Y:16888327-16888349 GCTTTTAAGGATAATTTGGCAGG + Intergenic
1201705623 Y:16933483-16933505 TTTTTTAAGGATAGTTTGGTGGG + Intergenic
1201750514 Y:17426554-17426576 GTTTTTAAGGACAACTTGGTGGG - Intergenic
1201911909 Y:19141337-19141359 CTCTTTAATGTTACTTTGGTGGG - Intergenic
1202256467 Y:22926131-22926153 GTTTTGAAGGTTACTTTTGCTGG + Intergenic
1202409457 Y:24559884-24559906 GTTTTGAAGGTTACTTTTGCTGG + Intergenic
1202461324 Y:25110194-25110216 GTTTTGAAGGTTACTTTTGCTGG - Intergenic