ID: 980966162

View in Genome Browser
Species Human (GRCh38)
Location 4:139523119-139523141
Sequence GGGTGAGGAAACTCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980966158_980966162 26 Left 980966158 4:139523070-139523092 CCTGGAGGTTTTACTCTAGGACA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 980966162 4:139523119-139523141 GGGTGAGGAAACTCTCTTACAGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980966162 Original CRISPR GGGTGAGGAAACTCTCTTAC AGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
915905145 1:159872003-159872025 AGGTGAGGCAAGGCTCTTACTGG - Intronic
916584368 1:166137583-166137605 AGGTGAGGAAACTCAGTCACAGG - Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
921791858 1:219299299-219299321 GGGCGAGCAAACACTGTTACCGG + Intergenic
921791925 1:219299953-219299975 GGGTGAGCAAACACTGTTATAGG + Intergenic
921803923 1:219432882-219432904 GTGTGAGTATTCTCTCTTACCGG - Intergenic
921834407 1:219762979-219763001 GGGAGAGGAACCTCACATACCGG + Intronic
922711909 1:227840648-227840670 GGGTGAGCAAACTCTGTAAAGGG - Intronic
923916139 1:238507739-238507761 GTGTCAGTAAACTCTGTTACAGG - Intergenic
1066982327 10:42429227-42429249 GGCAGAGGAAACTCTCCTAGCGG + Intergenic
1067372129 10:45694652-45694674 GGCAGAGGAAACTCTCCTAGTGG - Intergenic
1067387651 10:45831502-45831524 GGCAGAGGAAACTCTCCTAGTGG + Intronic
1067418477 10:46125768-46125790 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1067446624 10:46353110-46353132 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1067503830 10:46832345-46832367 GGCAGAGGAAACTCTCCTAGTGG - Intergenic
1067590759 10:47507657-47507679 GGCAGAGGAAACTCTCCTAGCGG + Intronic
1067637878 10:48015756-48015778 GGCAGAGGAAACTCTCCTAGCGG + Intergenic
1067875612 10:50004589-50004611 GGCAGAGGAAACTCTCCTAGCGG - Intronic
1067977573 10:51043168-51043190 GAGTGAGGGTACTGTCTTACGGG + Intronic
1068846433 10:61680939-61680961 GGGGGAGCAAACTCTATTTCTGG - Intronic
1070134475 10:73680180-73680202 GGCAGAGGAAACTCTCCTAGCGG + Intronic
1070406610 10:76103367-76103389 TGATGAGGAAACTCTCCCACTGG - Intronic
1071607247 10:87004229-87004251 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1073117523 10:101100107-101100129 TGGGGAGGAAACTGTCTCACAGG + Intronic
1074865959 10:117544401-117544423 TGGTCAGGAAACTGTCTTAGAGG + Intronic
1080769136 11:35324564-35324586 CAGTGAGTAAACTCTCTTACTGG - Intronic
1083405664 11:62455310-62455332 GGATCAGGAGACTCTCTTAAGGG - Intronic
1083638243 11:64131844-64131866 GGTTGATGAAAATCTCCTACAGG + Intronic
1084398192 11:68928605-68928627 GGGTGAGGAAACAGGCTTAGGGG + Intronic
1084549232 11:69830987-69831009 TGGTGAGGAAACTCCCCTCCTGG - Intergenic
1085874584 11:80391020-80391042 GAGTGAGAAAACTTTATTACAGG + Intergenic
1089573443 11:119424543-119424565 GGGTGATGGAACACTCTAACTGG + Intronic
1096202702 12:49696898-49696920 GGGTGAGGAAACTCTACTGCAGG - Intronic
1096914874 12:55020388-55020410 GGGTGAGGAAAGTCTCTTCTGGG + Intronic
1101905177 12:108819324-108819346 CAGTGAGGAAAGTCTCTTACTGG + Intronic
1103921460 12:124401577-124401599 GCAGGAGGAAACTCTCTTGCTGG + Intronic
1104056371 12:125233959-125233981 GGGATAGGAATTTCTCTTACTGG + Intronic
1104235818 12:126935602-126935624 GGGTTAGGAGACTCTGTTCCCGG + Intergenic
1105582577 13:21713593-21713615 GGGTGAGGAACATCACTCACCGG + Intergenic
1108266190 13:48711396-48711418 GGGTGAGGAAAGTCACTTTCTGG + Intergenic
1112071045 13:95850886-95850908 GGGTGAGACAACTCTTTTCCTGG - Intronic
1113413416 13:110109629-110109651 GGGTGACGAAACTGTCTCTCAGG - Intergenic
1124497126 15:30193402-30193424 GGGTGAGGAATGTCACTTCCTGG - Intergenic
1124556762 15:30733223-30733245 GGGTGAGTTAACTCTCCTACAGG - Intronic
1124674513 15:31672513-31672535 GGGTGAGTTAACTCTCCTACAGG + Intronic
1124746450 15:32345245-32345267 GGGTGAGGAATGTCACTTCCTGG + Intergenic
1126097470 15:45099731-45099753 GGTTGAGGAAAGTCTCTCGCAGG + Exonic
1128822100 15:70666389-70666411 TGGTGGGGAAGCTCTCTTTCTGG - Intronic
1131473914 15:92719931-92719953 GGGTGAGGAAAGCCTGTTCCAGG + Intronic
1137576612 16:49604254-49604276 TGGTGAGGGCACTCTCTCACAGG - Intronic
1141546415 16:84772775-84772797 GAGTGAGGACATTCTCTTGCTGG + Intronic
1143172545 17:4938520-4938542 GTGTGAGGACACCCTCTTCCCGG + Exonic
1146595624 17:34165952-34165974 GGGAGAGGAAACTCTGCTAGAGG + Intronic
1147658366 17:42103890-42103912 GGTTAAGGAAAGTCTCTTCCAGG - Intronic
1154089601 18:11344701-11344723 AGGTGAGGAGCCTCTCTGACTGG + Intergenic
1157244731 18:46043065-46043087 GGATGAGGAAACTCTTTGAGTGG - Intronic
1157383004 18:47236662-47236684 TGGTGAGGGAGCTCTCTTCCTGG - Intronic
1159768811 18:72523428-72523450 GAGTGAGGAAAATCACTTTCCGG - Intergenic
1161550196 19:4908644-4908666 GAGAGAGGATACTCTCTCACTGG - Intronic
1164891086 19:31824225-31824247 TGGTGAGGCAACTCTCATGCTGG - Intergenic
1165334233 19:35157792-35157814 GGGAAAGGAAATTCTCTTGCTGG - Intronic
1168056757 19:53868749-53868771 GGGTGAGGAAACACCCCTCCGGG - Intronic
927441199 2:23119291-23119313 GGGTCAGCAAACTTTCTTAAAGG - Intergenic
929695955 2:44115453-44115475 GGGTGAGGAAAAGCTATCACTGG + Intergenic
935085958 2:99845578-99845600 GGGTGAAGAAACCATGTTACAGG + Intronic
936050298 2:109217652-109217674 AGATGAGGAAGCTCTCTCACCGG + Intronic
937313457 2:120916262-120916284 GGATGAGGAACATCTCTTGCTGG - Intronic
943534562 2:189131784-189131806 GGATGAAGAAATTCTCTTAGAGG - Intronic
943694123 2:190905289-190905311 AGGTGATGAAACTCTCTCAATGG - Intronic
946846099 2:223860253-223860275 GGGTGGGGAAAGGCTCTTACTGG - Intronic
948947935 2:241230714-241230736 GGGTGAGAATCCTCTCTCACCGG - Intronic
1173731664 20:45333182-45333204 GGGTGGGGAAGCTCGCTTGCTGG - Intronic
1177083819 21:16676877-16676899 GTGGGAGAAAACTTTCTTACGGG + Intergenic
1178378873 21:32091964-32091986 GGGGGAGGAAACTCTTTCCCAGG + Intergenic
1179406630 21:41131808-41131830 GGATGAAGAAAGTCTCTTCCAGG - Intergenic
1181589836 22:23877214-23877236 AGGTGAAGAAACGCTTTTACTGG - Intronic
952236040 3:31481227-31481249 GGGTGAGGTGGCTCTCTTCCTGG - Intergenic
954465107 3:50649723-50649745 GGGTGAGAGTGCTCTCTTACTGG - Intergenic
955530813 3:59871425-59871447 GGGTAAGGATACTATGTTACAGG - Intronic
957789265 3:84918774-84918796 AGGTGAGGAGAGTCTCTTACCGG + Intergenic
958461436 3:94402236-94402258 TACTGAGGAAAGTCTCTTACTGG + Intergenic
961630384 3:128294282-128294304 GGGTCAGCAAACTCTATTCCTGG - Intronic
965875026 3:173306164-173306186 GTGTGAGGAAACTGTCTCAGAGG + Intergenic
968156524 3:196385630-196385652 AGGTGAGGAGCCTCTCTGACCGG + Intronic
973987938 4:56373720-56373742 GGGAGAGCAAACTTTCTAACAGG + Intronic
975377206 4:73659487-73659509 GGGTGAGGTGACTCTCTAGCTGG - Intergenic
978930109 4:114299991-114300013 AGGTGAGGTAACTCTCTTGCAGG + Intergenic
979979491 4:127237040-127237062 GGGTGAGGAAATCCACTTGCTGG + Intergenic
980006577 4:127549703-127549725 GTGTGAGGAAGCTCTTTTATAGG - Intergenic
980966162 4:139523119-139523141 GGGTGAGGAAACTCTCTTACAGG + Intronic
983718133 4:170811264-170811286 GGGTTGGAAAACTCTCTTAAGGG - Intergenic
989481598 5:41936836-41936858 GGGTCAGGAAACTTTCTTAAAGG + Intronic
990335065 5:54764347-54764369 AGGTTAGGAATCTCCCTTACAGG - Intergenic
995750388 5:115448020-115448042 GGGTGAGGAACATCACATACTGG + Intergenic
997226171 5:132210946-132210968 GGGTGAGGAAAATAGCTTGCAGG + Intronic
997238983 5:132293659-132293681 GGGGGAGGAAACTCGCCTCCCGG + Intronic
997509541 5:134444303-134444325 GGGAGAGGCCACTCTCTTATGGG - Intergenic
997611973 5:135221765-135221787 GTGTGAGCAAGCTCTTTTACAGG + Intronic
1001506176 5:172282999-172283021 GGGTGGGGAAACGGTCTTCCCGG - Intronic
1007420565 6:41716785-41716807 AGGAGAGGACACTCTCTGACAGG + Intronic
1014838188 6:126183869-126183891 GGCTGAGGTAACTCTCTCTCAGG - Intergenic
1018457438 6:163964477-163964499 GGGTTAGGAGACTCTCTCCCAGG + Intergenic
1021735301 7:23636602-23636624 AAGTGAGGAAACTCTCTGCCTGG + Intronic
1022288662 7:28979652-28979674 GGCTGAGGCCACTATCTTACAGG + Intergenic
1029452265 7:100647649-100647671 GGGTGAGAAACCCCTCTTGCAGG - Intronic
1033550632 7:142444306-142444328 TGGTGAGGAATTTCTTTTACTGG - Intergenic
1039009954 8:33082662-33082684 AGGTGAGGCAAATCTCTTATAGG + Intergenic
1043402518 8:79897984-79898006 AGGTGAGGACACTCTCTTTGCGG + Intergenic
1043808277 8:84701670-84701692 GGGTGAGTACCCTGTCTTACTGG - Intronic
1043943536 8:86224374-86224396 AGGAGAGGAAACTCTCTCCCTGG + Intronic
1044538490 8:93384153-93384175 GGTTGAGGAAAGTCTCTCAATGG - Intergenic
1045673898 8:104588370-104588392 GGGTTAGGAAGTTCTCTCACCGG - Intronic
1053579719 9:39391965-39391987 GGGAGATGAAACTGGCTTACAGG - Intergenic
1053844236 9:42220042-42220064 GGGAGATGAAACTGGCTTACAGG - Intergenic
1054101306 9:60950774-60950796 GGGAGATGAAACTGGCTTACAGG - Intergenic
1054122679 9:61226137-61226159 GGGAGATGAAACTGGCTTACAGG - Intergenic
1054585045 9:66956107-66956129 GGGAGATGAAACTGGCTTACAGG + Intergenic
1055185416 9:73446467-73446489 AAGTGAGGAAACTTTCTTATTGG - Intergenic
1056050242 9:82761002-82761024 GGATGAAGCAACTCTTTTACTGG - Intergenic
1187675861 X:21715872-21715894 GGGCCAGGCAACTCTGTTACTGG - Intronic
1190735539 X:53253618-53253640 GGGGGAGGAAACTTTCTTCTGGG - Intronic
1192313071 X:70032401-70032423 GGGTGAGGAAACAGCCTTTCTGG - Intronic
1192448400 X:71227186-71227208 GGGAGAGGAAGCTCTCTCTCAGG - Intergenic
1193201801 X:78700041-78700063 GGGAGGGGAAAATCTATTACAGG + Intergenic