ID: 980970074

View in Genome Browser
Species Human (GRCh38)
Location 4:139559304-139559326
Sequence CAGCAGCAGCAGAAGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 9, 3: 87, 4: 657}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980970074 Original CRISPR CAGCAGCAGCAGAAGTAGTG TGG Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
902651816 1:17842368-17842390 AAGCAACAGAGGAAGTAGTGGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
904299209 1:29543273-29543295 CACCAGCAGCATATGGAGTGGGG - Intergenic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905996878 1:42388907-42388929 CACCAAGAGCAGAAGTAGGGAGG + Intronic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906519617 1:46459342-46459364 CAGCAGCATGAGAAGTTTTGAGG - Intergenic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
908175083 1:61547506-61547528 AAGCATCAGCTGTAGTAGTGGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909610162 1:77543020-77543042 CTGCAGCAGCAGAATTGCTGAGG - Intronic
910077643 1:83299175-83299197 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912947744 1:114098748-114098770 TAGCAACAGCAGAAATAGAGAGG + Intronic
913128065 1:115811666-115811688 CAGCAGTAGCATAGGTAGTGTGG - Intergenic
913250992 1:116911448-116911470 CATCAGCAGCAGGAGTCATGGGG - Intronic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915136315 1:153734039-153734061 GAGCAGCAGCAGATGAAATGGGG - Intronic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916568033 1:165998728-165998750 AAGCAGCAGCAGTAGTGATGTGG + Intergenic
916787571 1:168097553-168097575 CAGCAGCAGCAGAATTGATCTGG - Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917524507 1:175775063-175775085 CAGCAGTGGCAGACGTAGCGTGG - Intergenic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919425277 1:197422062-197422084 AACCAGCAGCAGAAGTCTTGTGG - Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919856785 1:201711569-201711591 CAGCAGCGGCAGAAGGCTTGCGG + Intronic
920131221 1:203733357-203733379 CAGCAGGAACAGAAGTGGTGGGG - Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
920818111 1:209354538-209354560 CAGCCCCTACAGAAGTAGTGAGG - Intergenic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921487709 1:215734261-215734283 CAGCTGCAGCAAGAGTAGTCAGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922534295 1:226368410-226368432 CAGCAGGTCCAGAAGTAGCGTGG + Intronic
922571746 1:226638439-226638461 CAGCAGCTGCAGAGCAAGTGGGG - Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922947669 1:229530878-229530900 CAGCAGCCGCAGAACTGGAGGGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
1062760840 10:17419-17441 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1063308612 10:4931648-4931670 CAGCAGCAGCAGAACCTCTGTGG + Intronic
1063318059 10:5025824-5025846 CAGCAGCAGCAGAACCTCTGTGG - Intronic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064885044 10:20102511-20102533 CACCAGCAGCAGAAGGATTCTGG + Intronic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066747131 10:38611908-38611930 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1070459724 10:76652288-76652310 TATCAGCACCAGCAGTAGTGAGG - Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071416805 10:85449190-85449212 CAGCAGGAGCACAATTAGTCAGG - Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072919200 10:99561346-99561368 CAGCAGGAAGAGAAGCAGTGGGG - Intergenic
1074037363 10:109753832-109753854 CATCAGCTGCAGAAGTAGAAGGG + Intergenic
1074722673 10:116276182-116276204 CATAAGCAGCAGCAGTACTGGGG + Intergenic
1074985784 10:118658531-118658553 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1075233933 10:120709660-120709682 AAGCACCAGCAGCTGTAGTGAGG - Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075982724 10:126755407-126755429 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1076128847 10:127997360-127997382 CAGCAGCAGCAGAGGGACTTGGG - Intronic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076926597 10:133493438-133493460 CAGCAGAGGCAGATGTAATGAGG + Intergenic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077992249 11:7422465-7422487 CACCAGGAGCTGAAGAAGTGAGG - Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1078685364 11:13525280-13525302 CAGCAGGAGGATGAGTAGTGGGG + Intergenic
1078758411 11:14232921-14232943 CAGAGGCCGCAGAGGTAGTGGGG + Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1080055250 11:27900293-27900315 GAGCAGGATCAGAAGTAGTTGGG - Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080684760 11:34505757-34505779 CAACAGCAGGAGAGGTCGTGAGG + Intronic
1081195297 11:40152926-40152948 AAGCAGCAGCTGTGGTAGTGTGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082140457 11:48603066-48603088 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084576596 11:69992635-69992657 AGGCAGCAGCTGAATTAGTGAGG - Intergenic
1084687294 11:70704025-70704047 CCCCAGCAGCAGGAGTAGGGCGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086486915 11:87315120-87315142 AAGCAGTAGCAGCAGTAGTAGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087443014 11:98208815-98208837 CAGCTGCAGCAGGAGAGGTGCGG - Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1087948087 11:104189330-104189352 CAGCTGCAGCAGAAATACTTAGG + Intergenic
1088806465 11:113357915-113357937 CAACAGCAGCAGAAGACCTGTGG + Intronic
1089826252 11:121280931-121280953 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090757346 11:129803983-129804005 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1092693573 12:11144094-11144116 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1093661169 12:21758605-21758627 GAGCAGCAGGAGAAGTATGGTGG - Intergenic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093684353 12:22039612-22039634 AAGCAGCAGCACAAGTAGGCAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1094808573 12:34115122-34115144 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1095248152 12:39946366-39946388 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1095262698 12:40115571-40115593 TAGCAGCAGCAGTTGTAGTGGGG + Intergenic
1095435391 12:42181305-42181327 AAGCAGTAGGAGAAGTAGTAAGG - Intronic
1095466972 12:42497856-42497878 CAGCAGCCGTAGGAGTAGGGAGG - Intronic
1095732726 12:45522597-45522619 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096872710 12:54604138-54604160 CACAAGCAGCAGCAGAAGTGTGG + Intergenic
1097036330 12:56127023-56127045 CAGATGCAGCAGAAGAACTGGGG - Exonic
1097140617 12:56899970-56899992 CAGGAGCAGCAGTGGTGGTGGGG + Intergenic
1097141699 12:56908132-56908154 TAGCAGCAGCAGTGGTGGTGAGG + Intergenic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1098064917 12:66603579-66603601 CAGCAACTGCACAGGTAGTGAGG + Intronic
1099777382 12:87151175-87151197 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103840911 12:123863537-123863559 CACCAGAAGCAGAAGAGGTGAGG - Intronic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104991693 12:132627960-132627982 AAGCAGCAGCAGAATTTGAGAGG - Intronic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106664908 13:31841655-31841677 CAGCAGCAACAGACCTGGTGTGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107574462 13:41702825-41702847 CAGCAGGAACAGAAGTTGAGGGG - Intronic
1107649874 13:42534535-42534557 CAGCAGCATCAGATGGATTGTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108945556 13:56019092-56019114 AAGCAGAAGCAAGAGTAGTGGGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109476618 13:62887320-62887342 CATCAGCAGCAGTGGTAGAGTGG + Intergenic
1110447361 13:75601261-75601283 AAGCAGCAGCAGAATTTGAGAGG + Intronic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1112141819 13:96652396-96652418 AAGAAGGAACAGAAGTAGTGAGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1113269904 13:108662289-108662311 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1114030756 14:18577891-18577913 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117510757 14:56448644-56448666 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1117512868 14:56471140-56471162 CAGCAGTGGCAGTAGCAGTGGGG + Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1117639868 14:57786403-57786425 GAGCATCAGCTGTAGTAGTGTGG - Intronic
1117945834 14:61019428-61019450 AAGCAGATGCAGAAGTTGTGAGG - Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118071531 14:62251299-62251321 AAGGAGGAGCAGAAGTGGTGTGG - Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119775187 14:77243908-77243930 AATCAGCAGCAGAAGTGGTGTGG - Intronic
1119992714 14:79217305-79217327 CAGGAGCAAGAGGAGTAGTGGGG + Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124480116 15:30071865-30071887 TGCCAGGAGCAGAAGTAGTGGGG - Intergenic
1124855736 15:33386512-33386534 GAGCTGTAGCAGAAGTACTGGGG - Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126506081 15:49406239-49406261 CAGCAGCAGCAATAGAAATGTGG + Intronic
1126572753 15:50169166-50169188 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1127008181 15:54594330-54594352 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1128535856 15:68489734-68489756 CAGCAGCAGAAGAGGTATTTGGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130075455 15:80685349-80685371 CAGCAGAAGCCGAAGAAGTATGG + Intronic
1130197092 15:81790005-81790027 AAATGGCAGCAGAAGTAGTGGGG + Intergenic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132107473 15:99073737-99073759 GAGCTGCAGCAGAGGTAGGGAGG - Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132790614 16:1684947-1684969 AAAGAGCAGCAGAAGTAGTCTGG + Intronic
1132942841 16:2516795-2516817 CAGCAGCCACAGAAAGAGTGGGG - Intronic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133314050 16:4871105-4871127 GAGCAGCATCTGAAGTAGTTTGG + Intronic
1133489443 16:6252747-6252769 GAGCAGCAGATGAGGTAGTGTGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135994516 16:27238121-27238143 CAGCAGCAACAGAGGTGGCGTGG + Intronic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136735936 16:32467736-32467758 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1137343760 16:47636316-47636338 CAGCTGCAGCAGGGGAAGTGTGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1139309646 16:66017786-66017808 CAGCTTCAGCAGAAGTAACGTGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139714084 16:68798760-68798782 CACCCCCAGCAGAAGTAATGGGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139803784 16:69546386-69546408 AAGCAGCAGCAAAATTAGAGAGG + Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140954543 16:79849806-79849828 CAGCAGCTGTAGGAGGAGTGGGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142023217 16:87797169-87797191 CAGCAGCATCAGGAGCACTGTGG + Intergenic
1203017139 16_KI270728v1_random:361838-361860 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1203035474 16_KI270728v1_random:634996-635018 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144633286 17:16887077-16887099 CAGAAGCAGCATAAGAAGTTGGG + Intergenic
1145276156 17:21432249-21432271 CAGCAACAGATGAAGGAGTGGGG - Intergenic
1145314000 17:21718163-21718185 CAGCAACAGATGAAGGAGTGCGG - Intergenic
1145712448 17:26990140-26990162 CAGCAACAGATGAAGGAGTGAGG - Intergenic
1146608705 17:34285819-34285841 CAGCAGCCACAGAAGTGCTGCGG - Exonic
1146672404 17:34750555-34750577 CAGCAATAGCAGTAGTAGTAGGG - Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147631203 17:41933098-41933120 CAGCAGGAGGAGAATAAGTGGGG - Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148647168 17:49225714-49225736 GGGCAGCAGGAGAAGCAGTGGGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149298640 17:55284384-55284406 CAGCAGTAGCAGAGGAAGTCAGG - Intronic
1149383488 17:56118506-56118528 CAGCAGCAGCAATATTAGTAAGG - Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1152058682 17:78052237-78052259 GAGCAGCAGCACGAGTAGAGAGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152953747 18:17773-17795 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153501245 18:5752158-5752180 CTGCAGCAGGAGAACTTGTGAGG - Intergenic
1153557096 18:6326383-6326405 CTTCAGCAGCAGAAGAAATGGGG - Intronic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1158452483 18:57579563-57579585 CACCAGCAACAGAAGAGGTGAGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160570776 18:79816289-79816311 CTGCAGCAGCTGTAGTGGTGTGG + Intergenic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162621513 19:11847914-11847936 GAGCAGCTCCAGAAGGAGTGTGG + Intergenic
1162625298 19:11880184-11880206 GAGCAGCTCCAGAAGGAGTGCGG + Intronic
1162635446 19:11964193-11964215 GAGCAGCTCCAGAAGGAGTGTGG + Intronic
1163176425 19:15566867-15566889 CAGCACCAGCAGACGTGCTGAGG - Intergenic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925366406 2:3314960-3314982 CAGCAGCAGAAGATGCTGTGTGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926665676 2:15519769-15519791 CAGCAGCATCAGAAAAACTGGGG - Intronic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929871077 2:45759860-45759882 CACCTGCAACAGAAGCAGTGAGG - Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930159994 2:48145054-48145076 CACCAGCCACAGTAGTAGTGGGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932752169 2:74378218-74378240 CAGCGGCAGCAGGATGAGTGCGG - Exonic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
934694801 2:96391869-96391891 CAGAAGCAGCAGGAAAAGTGGGG + Intergenic
935154838 2:100475000-100475022 CAGAGGCAGTGGAAGTAGTGTGG + Intronic
935830472 2:106996522-106996544 CAGCTGCAGCAGAACTAGGCAGG - Intergenic
936164485 2:110107674-110107696 AAGCAGCAGCTGTAGTAGTATGG - Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937057892 2:118954556-118954578 AAGCATCAGCTGTAGTAGTGTGG - Intronic
937344378 2:121115389-121115411 CGTCAGCAGCAGAGGGAGTGAGG + Intergenic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
940428514 2:153558396-153558418 CAGCAGCAGCTTAAGAAGAGTGG + Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941700769 2:168602102-168602124 CAGCAGTAATAGAAGAAGTGAGG + Intronic
941918540 2:170828021-170828043 TGGCAGAAGGAGAAGTAGTGAGG - Intronic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942033073 2:171982426-171982448 CAGCAGCAGCAGAGATGGAGAGG - Intronic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
945132083 2:206584363-206584385 AAGCATCAGCTGTAGTAGTGTGG + Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945862333 2:215138352-215138374 CAGCAGAAACAGAAGAACTGTGG - Exonic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946036493 2:216746433-216746455 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948361240 2:237422016-237422038 CAGCAGGCGCAGAAGTGGAGGGG + Intronic
948764023 2:240210404-240210426 CAGCAGCACCAGAAGAGGTTTGG - Intergenic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169755445 20:9038385-9038407 CAACAGTAGCAGAAATAGTTAGG - Intergenic
1170586081 20:17735152-17735174 CAACAATTGCAGAAGTAGTGGGG + Intronic
1170621674 20:18001621-18001643 CAGCAGTAGCAGAAGGATTCCGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171285883 20:23937888-23937910 CAGCTGCAGCAGGAGAGGTGTGG + Intergenic
1172100845 20:32483431-32483453 CAGCAGCAGCTGGAGCTGTGGGG - Exonic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172531397 20:35633488-35633510 CAGCAGCAGTGGAAATAGTGAGG - Intronic
1172637527 20:36419977-36419999 CAGCAGGAGGAGTTGTAGTGAGG + Intronic
1173174054 20:40750986-40751008 CAGCAGAGGTGGAAGTAGTGAGG + Intergenic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173394778 20:42669134-42669156 CAGCAGCAGCAAAACAAGTTCGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175179285 20:57133973-57133995 GAGCAGCATCAGAGGTAGAGTGG - Intergenic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1176021556 20:62964830-62964852 CTGGAGCAGCAGAGGAAGTGGGG + Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1177174401 21:17689037-17689059 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177359045 21:20045500-20045522 CAGAAGTGGCAGAAGTAGTGTGG - Intergenic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1178441026 21:32598463-32598485 CATCTGCAACACAAGTAGTGGGG - Intronic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179174914 21:39001181-39001203 CAGCAGCAGCAGAGATGGGGTGG - Intergenic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180065055 21:45408209-45408231 GAGCAGCAGCAGGTGAAGTGGGG - Intronic
1180454870 22:15504947-15504969 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1180536626 22:16398216-16398238 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184176393 22:42791904-42791926 CAGCAGCAGCAGAGTTCCTGAGG - Intergenic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184730266 22:46367819-46367841 GAGCAGCAGCAGGAGGAATGCGG + Exonic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
949265105 3:2147988-2148010 CAACATCAATAGAAGTAGTGTGG - Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
951725831 3:25757920-25757942 CAGCTGCAGAAGTAGGAGTGCGG - Intronic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
952914968 3:38229689-38229711 CAACAGCAGCAGAACTATTAAGG + Exonic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
954328038 3:49874292-49874314 CTGCAGCAGCTGAACTCGTGAGG + Intergenic
954591024 3:51781630-51781652 AAGCTGGAGAAGAAGTAGTGAGG - Intergenic
955133793 3:56196104-56196126 TAGGAGCAGCAATAGTAGTGTGG - Intronic
955208194 3:56916538-56916560 CAGCAGTAGCAGGAGAGGTGGGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
958161347 3:89819270-89819292 CAGCTGCAGCACAAGAGGTGTGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959355879 3:105327693-105327715 AAGCAGCAGCAGAGTTTGTGAGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960914348 3:122681158-122681180 CAGCAGCCGCCGAAGTCGGGCGG - Intronic
961082997 3:124042501-124042523 AAGCAGCAGCAGAAATGGAGAGG + Intergenic
961262334 3:125612108-125612130 CAACAGCAGCAGTGGTGGTGGGG + Intergenic
961568639 3:127782715-127782737 CAGCAGCAGTAGAAGTTGGTGGG - Intronic
961990073 3:131180105-131180127 CACAAGCAGCAGAAGTAGATTGG + Intronic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962196228 3:133365887-133365909 CACCAGGAGCAGAAGTAATCAGG + Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
965052682 3:163671180-163671202 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
965420343 3:168450020-168450042 CTGCAGGAGCACAAGTGGTGAGG - Intergenic
965736889 3:171830087-171830109 CAGCAGCTGCAGAAGGCATGGGG + Intergenic
966083784 3:176041102-176041124 CAGCAGTGGCATAATTAGTGAGG + Intergenic
966214663 3:177490186-177490208 CAGCAGCAGGGAAAGTAGAGCGG - Intergenic
966223853 3:177577329-177577351 CTGGAGCAGCAGAGGTGGTGTGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
967399976 3:189049633-189049655 AAGCATCAGCTGTAGTAGTGTGG - Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
968539564 4:1157551-1157573 AAGCAGCAGCAGAATTGGAGAGG - Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970658591 4:18260043-18260065 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
971183090 4:24349306-24349328 CATCAGCTGCAGTAGTAGTGTGG + Intergenic
971674435 4:29607344-29607366 TAGCCGCAGCAGAAGTGGTGTGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
973142090 4:46781825-46781847 CAGCAGCTGCAGAGGATGTGCGG + Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974386931 4:61213108-61213130 CAACAACAACAGAAGTAATGGGG + Intronic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976433111 4:84986523-84986545 AAGCAGCAGCAGGAGTTGAGAGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977746810 4:100558870-100558892 CATCAGCTGTAGTAGTAGTGTGG - Intronic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979626769 4:122853648-122853670 CAAGTGCAGCAGGAGTAGTGTGG - Intronic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980824460 4:138057096-138057118 CAGCAGCAGCACAGGTTTTGTGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982363983 4:154555224-154555246 CTCCAGAAGCAGCAGTAGTGAGG - Intergenic
982390541 4:154858436-154858458 GAGCAGCAGCAAGAGCAGTGAGG - Intergenic
982456165 4:155611615-155611637 CAGAAGGAGCAGATTTAGTGAGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
984473863 4:180213045-180213067 CAGCAGCAGCAGAATAAAAGAGG - Intergenic
984581133 4:181511383-181511405 CAGCAGAAGCTGGAGTACTGGGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985815553 5:2125446-2125468 TAGCAGCAGCTGGAGTATTGGGG + Intergenic
985827070 5:2200358-2200380 CAACAGCAGCAGATGAGGTGGGG + Intergenic
985927512 5:3029478-3029500 CAGAAGAAGCAGAAGATGTGGGG + Intergenic
986680864 5:10231654-10231676 CAGCAGAAGCAAAAGTGCTGTGG - Intronic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
988908265 5:35812130-35812152 CAGCAGTAGTAGAAGTAGGTTGG - Intronic
989153940 5:38326331-38326353 GAGCAGCAACCGAAGTAGAGAGG + Intronic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
990712801 5:58604313-58604335 AAGCATCAGCTGTAGTAGTGTGG + Intronic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG + Intergenic
993373701 5:87123027-87123049 GAGAAGCAGCAGAAAAAGTGTGG - Intergenic
993516701 5:88845497-88845519 CAACAGCAGTAGAAGTTTTGAGG + Intronic
993871288 5:93257253-93257275 CAGAAGCAGCAGAAGGCTTGGGG - Intergenic
994150559 5:96442783-96442805 CAACAGCAGCAGCAGTGGTAGGG - Intergenic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994531837 5:100982276-100982298 AGGCAGCTGCAGAAGTCGTGGGG - Intergenic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
995272886 5:110242430-110242452 AAGCAGGAGCAGGAGGAGTGGGG + Intergenic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
997001064 5:129762594-129762616 CAGCAGCAGCACAATCAGTCAGG + Intronic
997043600 5:130286764-130286786 CACCAGCAGGAGAAGAAGTAGGG - Intergenic
997163100 5:131629993-131630015 AAGCAGCAGCAGAATTTGGGAGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
999106326 5:149074487-149074509 CAGCATCACAAGAAATAGTGAGG + Intergenic
999111800 5:149127829-149127851 CAGCATCACAAGAAATAGTGAGG + Intergenic
999337549 5:150735159-150735181 AAGCATCAGCTGCAGTAGTGTGG - Intronic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1001733729 5:173981409-173981431 CAGCATCAGCTGTAGTAGTATGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002813884 6:660279-660301 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1003029394 6:2589077-2589099 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1003063182 6:2877865-2877887 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004831019 6:19476661-19476683 CAGCAGCAAGAGAAAAAGTGAGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006738663 6:36292515-36292537 CAGCAGCAGGCAAAGCAGTGTGG - Intronic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007368864 6:41413275-41413297 CAGCAGCAGCAGAACTGGGAAGG - Intergenic
1007474067 6:42107378-42107400 CAGCAGCAGGGGAGGTGGTGGGG + Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007892690 6:45310415-45310437 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008789582 6:55214090-55214112 CAGCAGCTCCAGAAGAACTGTGG + Intronic
1009308887 6:62125163-62125185 TAGCAGCAGCAGTAGCTGTGTGG + Intronic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010387694 6:75301557-75301579 TAGCATTAGCAGAAGTAGAGAGG + Intronic
1011082330 6:83503222-83503244 CACCAGCAGAGGAAGGAGTGAGG + Intergenic
1011178482 6:84591633-84591655 AAGCAGCAGCAGAATTTGAGAGG - Intergenic
1011471268 6:87710159-87710181 CAGCTGCAGTAGAAGGTGTGAGG - Intergenic
1011941483 6:92848489-92848511 CAGCAGCATCAGTAGCAGTTGGG - Intergenic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1012922709 6:105235608-105235630 AAGCATCAGCTGAAGTAGTGTGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013618470 6:111866907-111866929 CAGCATCAGGAGAACTAGAGGGG - Intronic
1013990403 6:116248518-116248540 CAGCAGCACGAGGAGTAATGGGG + Exonic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014279846 6:119429622-119429644 AAGAAGCAGCAGAAGTCGTGAGG + Intergenic
1014285001 6:119487215-119487237 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1014618450 6:123634323-123634345 CCTCAGCATCAGAAGTAGTTAGG - Intronic
1014831398 6:126106482-126106504 CAACAGCGCGAGAAGTAGTGAGG - Intergenic
1015227080 6:130869922-130869944 CAGCAGCAGCAGTGAGAGTGAGG - Exonic
1016429526 6:143968060-143968082 CTGCAGCTGCAAAAGAAGTGAGG + Intronic
1016986658 6:149900505-149900527 CAGCAGCAGCAAAAGAGATGTGG + Intergenic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1019014146 6:168867534-168867556 CAGCAGGAGCAGGAGAGGTGAGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019374847 7:683895-683917 CATCAGCTGCAGAAGAAGTGGGG - Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019886147 7:3907718-3907740 CCGCAACAGCAGAGGTGGTGAGG + Intronic
1020026033 7:4900750-4900772 GATCAGCAGCAGAACAAGTGTGG + Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022200457 7:28111815-28111837 TACCAGCAGGAGAAGTAGGGTGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022717300 7:32910180-32910202 CAATAGCAGTACAAGTAGTGTGG + Intergenic
1022777668 7:33544698-33544720 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1024306947 7:47937391-47937413 CAGGAGCAGCAGAAGTCTCGTGG + Intronic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027295412 7:76764371-76764393 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031633304 7:124070478-124070500 CAGCAGCAGAAGTAGTATTTTGG + Intergenic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031800601 7:126239479-126239501 CAACACCAGCAAAAGTAGAGAGG + Intergenic
1032690831 7:134284938-134284960 CAGCAGCACTTGAAGTTGTGGGG - Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034454004 7:151155031-151155053 CAGCAGGAGCTGCAGTAATGGGG - Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037538396 8:19848960-19848982 CAGCAGCAGCGGGTGCAGTGAGG + Intronic
1037627018 8:20617189-20617211 CTGCAGCACCAGAAGTAAGGTGG + Intergenic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1041860266 8:62504820-62504842 GAGCAGAAAGAGAAGTAGTGAGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042304106 8:67313766-67313788 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1042380146 8:68104172-68104194 CACCAGCAGTAGAGGTAGGGAGG - Intronic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042690992 8:71498681-71498703 CAGCAGCAGAAGAGGTCCTGAGG - Intronic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1043364770 8:79520224-79520246 CAGCAGCAACAGTACAAGTGAGG + Intergenic
1043618857 8:82162661-82162683 CAGCAGCAGCAGAACTTGTCAGG - Intergenic
1043956109 8:86361350-86361372 AAGAAGCAGCAGAGGTATTGAGG - Intronic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046603263 8:116342141-116342163 CAGCAGCACCAGAAGACTTGCGG - Intergenic
1047021348 8:120777930-120777952 CAGCAGCAGCAGAAACACTTTGG + Intronic
1047032394 8:120896559-120896581 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1047277823 8:123419050-123419072 CTGCAGGAGCCAAAGTAGTGTGG - Intronic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1051145763 9:14025819-14025841 CCACAGCAGCAGAAGAAGTGTGG + Intergenic
1051362715 9:16295051-16295073 GAGCATCAGCTGTAGTAGTGTGG - Intergenic
1051881199 9:21841259-21841281 CACCAGCTGCAGAAGGAGTAGGG - Intronic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1051978637 9:22985680-22985702 CAGTAGGAGCACAAGTAATGAGG + Intergenic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1055203584 9:73698074-73698096 TAGTAGCAGAAGAAATAGTGAGG - Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1055905778 9:81292284-81292306 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1056322694 9:85451901-85451923 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1056694234 9:88832832-88832854 CAGGAGCAAAAGGAGTAGTGGGG + Intergenic
1056716919 9:89039007-89039029 CAGCAGCAAAAGAAGTAGCCAGG + Intronic
1056845878 9:90037688-90037710 CAGCAGCAGCAGGAAGAATGAGG - Intergenic
1057711222 9:97446947-97446969 CAGCAGAAGCAGAAGTGAAGAGG + Intronic
1057782942 9:98064751-98064773 CAGCAGCAGCTGAGGGACTGTGG - Intronic
1058410435 9:104725194-104725216 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059386269 9:113967212-113967234 CATAAGCAGCAGAAGTGGTACGG - Intronic
1059404869 9:114093302-114093324 CAGCAGGGGCAGGAGTAGAGGGG + Exonic
1059786121 9:117586362-117586384 CAGCAGCAGATGACCTAGTGAGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060549052 9:124476625-124476647 AAGGGGCAGCAGAAGGAGTGGGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060745444 9:126127904-126127926 CAGCAGGAGAAGGAGGAGTGAGG + Intergenic
1061309122 9:129750928-129750950 CAGGAGCAGCCCAAGGAGTGGGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1186199488 X:7142612-7142634 CAGCAGCAGCAGAGTTTGAGAGG + Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187748420 X:22433829-22433851 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1188116980 X:26256516-26256538 CAACAGCAACAAAACTAGTGAGG + Intergenic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188737975 X:33741945-33741967 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189550346 X:42086169-42086191 GAGCAGCAGCAGGAAAAGTGTGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1191008469 X:55737040-55737062 CAGCTGCAGCTGAAGTAGGTGGG + Intronic
1191067588 X:56366994-56367016 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1193255408 X:79342688-79342710 CACCAGCTGCAGTAGTAGTAGGG - Intergenic
1193374015 X:80736034-80736056 CATCAGCACCAGTAGAAGTGAGG + Exonic
1193740817 X:85215190-85215212 CAGCTGGAGCCGAAGTGGTGGGG + Intergenic
1193826274 X:86231280-86231302 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193924128 X:87464561-87464583 CACCAGCAGCAGTAGTAGAAGGG - Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1194422551 X:93695006-93695028 CAGTAGCACCAAGAGTAGTGAGG - Intronic
1194815833 X:98440119-98440141 CACCAGCTGCAGTAGTAGTAGGG - Intergenic
1195092052 X:101470022-101470044 CAGCAGCAGCAGAACACTTGCGG - Intronic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196415437 X:115466136-115466158 CAGCAGCAGCAAAAGTATTAAGG - Intergenic
1196473688 X:116058404-116058426 TAGCAGCAGCATCAGTAGTATGG + Intergenic
1196918131 X:120560593-120560615 CAGCAGCAGCTGAGGGACTGGGG + Exonic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197855914 X:130913742-130913764 TAGCAGCAGCAGCAGTAATCAGG - Intergenic
1197953733 X:131924020-131924042 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1198809629 X:140522581-140522603 CAGCAGCTGCTGAAGTAGACAGG + Intergenic
1199424234 X:147682141-147682163 CACCAGCTGCAGTAGTAGTAGGG - Intergenic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1201534584 Y:15031824-15031846 CAACAGCAGCAGATGTCTTGAGG + Intergenic
1201858896 Y:18573713-18573735 CAGCACCTGCAGAGGTACTGAGG - Intronic
1201874426 Y:18746668-18746690 CAGCACCTGCAGAGGTACTGAGG + Intronic