ID: 980972110

View in Genome Browser
Species Human (GRCh38)
Location 4:139576540-139576562
Sequence CGTGCTTCAGAATCACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1668
Summary {0: 1, 1: 10, 2: 139, 3: 500, 4: 1018}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980972110 Original CRISPR CGTGCTTCAGAATCACCTGG GGG Intronic