ID: 980985123

View in Genome Browser
Species Human (GRCh38)
Location 4:139687611-139687633
Sequence GGGCTTCTTGGCTATGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980985123_980985129 7 Left 980985123 4:139687611-139687633 CCCTCAGCATAGCCAAGAAGCCC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 980985129 4:139687641-139687663 TGACTAATTCTATCTTTAGGTGG 0: 1
1: 0
2: 1
3: 10
4: 165
980985123_980985128 4 Left 980985123 4:139687611-139687633 CCCTCAGCATAGCCAAGAAGCCC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 980985128 4:139687638-139687660 TTATGACTAATTCTATCTTTAGG 0: 1
1: 0
2: 2
3: 16
4: 255
980985123_980985130 13 Left 980985123 4:139687611-139687633 CCCTCAGCATAGCCAAGAAGCCC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 980985130 4:139687647-139687669 ATTCTATCTTTAGGTGGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980985123 Original CRISPR GGGCTTCTTGGCTATGCTGA GGG (reversed) Intronic
901407841 1:9061760-9061782 GTGCTTGTTGGCTGTGCTGCTGG - Intronic
903376780 1:22871378-22871400 GAGCTCCTAGGATATGCTGATGG - Intronic
905018920 1:34795149-34795171 GGGGTTTTTGGCCATTCTGAGGG - Exonic
905527376 1:38649280-38649302 GGACTTCATGGCTAGGGTGAGGG - Intergenic
906743402 1:48204847-48204869 GGGCTTCTTGGGAATGGTGGAGG - Intergenic
907949505 1:59168495-59168517 GCACTTTTTGGCTATGATGAAGG - Intergenic
908168735 1:61484117-61484139 TGGTTTCTTTGCAATGCTGAGGG + Intergenic
912378432 1:109232084-109232106 GGGCTTCTTTTCTAAGCTCATGG - Intronic
913202961 1:116511003-116511025 TGGCTTCTGGGCTATGCAGCTGG - Intergenic
915016642 1:152740289-152740311 GGGCTTCTTGGCTCTCCTCCTGG - Intronic
915392854 1:155560449-155560471 GAACTTCTTGGCTGGGCTGAAGG - Intronic
915409011 1:155686378-155686400 GAACTTCTTGGCTGGGCTGAAGG - Intronic
915465385 1:156094673-156094695 GGCCTTCCTGACCATGCTGATGG + Intronic
916114190 1:161473477-161473499 GTGCTTCTGGGCTGAGCTGATGG + Intergenic
917790190 1:178494470-178494492 GGGCTTCTGGGCTGTGCAGGAGG + Intergenic
918889502 1:190247427-190247449 GTGCATTTTGTCTATGCTGATGG + Intronic
919072582 1:192774546-192774568 GGGCTTCTAGGCAATGGTAAAGG - Intergenic
921012992 1:211161449-211161471 GGGCTTCTTCAGTATGCTGGAGG + Intergenic
923520891 1:234734341-234734363 GGGCTTCTTGGCAAAGGTGACGG + Intergenic
1063759857 10:9061397-9061419 GGGATTCTCTGCTTTGCTGAAGG + Intergenic
1065728930 10:28693110-28693132 GTGCTTGTTTGCTCTGCTGACGG + Intergenic
1067757208 10:49014177-49014199 GGGGTTCTGGGCTGTGCTGAAGG - Intergenic
1068003123 10:51360003-51360025 GGGTTTCTGGGGTATCCTGATGG + Intronic
1070390716 10:75968085-75968107 GGGCTTGTTGGCTCTGCAGTGGG + Intronic
1070656933 10:78278105-78278127 GGCCTTCATGGCAAGGCTGATGG + Intergenic
1070775548 10:79107808-79107830 GAGCTTCTGGGCTCTGCTGTAGG + Intronic
1071314180 10:84376725-84376747 TGGGTTATAGGCTATGCTGATGG + Intronic
1072661470 10:97366287-97366309 GGGCTTGTTGGTCATGATGAGGG - Intronic
1075316725 10:121459173-121459195 GGGTTTCTTGGCAGAGCTGATGG - Intergenic
1075950083 10:126469617-126469639 GGGCTTTTAGGAGATGCTGAGGG - Intronic
1076392237 10:130111462-130111484 GGGCCTTTGGGCTGTGCTGAAGG + Intergenic
1078457522 11:11486812-11486834 GGGGGTCTTGGCTGTGCTGGGGG - Intronic
1084264454 11:67997674-67997696 GGCCTTCCTGGCCATGCTGCTGG - Exonic
1084762558 11:71283228-71283250 GGGCATCCTGTCTTTGCTGATGG + Intergenic
1087030365 11:93697801-93697823 GGGCTTCTCGCCTAGCCTGAAGG - Exonic
1088729792 11:112670820-112670842 GGGCTGCTGGAGTATGCTGAAGG - Intergenic
1091737506 12:2935199-2935221 GGGCTGCTTGGCTAGAATGATGG - Intronic
1095277506 12:40305410-40305432 GGTCTTCTTGCCTTTACTGAAGG + Intronic
1097688217 12:62710613-62710635 GGGCTTCCTGGCTGTAGTGATGG + Intronic
1103973132 12:124684832-124684854 GGAGTTCTTGGATATGCAGATGG - Intergenic
1104131196 12:125895937-125895959 GGGTGCCTTGGCTATGCAGATGG + Intergenic
1105070955 12:133234329-133234351 GAGCTTCCTGACTCTGCTGAAGG - Exonic
1106440818 13:29767532-29767554 GTTTTTCTTGGATATGCTGAGGG - Intronic
1109679096 13:65723818-65723840 GGGCTGGTTGGTTATGCTAATGG - Intergenic
1110242912 13:73288630-73288652 GGCCTTTTAGTCTATGCTGACGG - Intergenic
1110715713 13:78701726-78701748 GGGCTACTTGGCTATTTTGGTGG + Intergenic
1110936142 13:81291703-81291725 GGGCTTCTTGCCTTTGCTGTAGG + Intergenic
1113794297 13:113048089-113048111 GGGCTGCTTCGCTATCCTGTAGG - Intronic
1116435018 14:44887036-44887058 GGGCTGCTTGGCTGTCCTGGTGG + Intergenic
1118264392 14:64280615-64280637 GGGCTGCTTAGCAATGCTGTTGG - Intronic
1119638258 14:76294060-76294082 GGGCTTGTGAGCTATGCTGTGGG + Intergenic
1125604318 15:40931410-40931432 GTCCTTCTTGGCTGTGATGATGG - Intronic
1126225251 15:46262300-46262322 GGGCTTCTGTGCTATGCTGGGGG + Intergenic
1127408483 15:58680086-58680108 TGGCTTCTGCGCTATGCTTAGGG + Intronic
1127709693 15:61583997-61584019 GGGCTTGTAGGCTACACTGAAGG + Intergenic
1128391581 15:67186219-67186241 CTGCTTCTTGGCTCTGCTGGGGG + Intronic
1129271026 15:74419322-74419344 GGGCTCCTTGGCCATGCTCTGGG + Intronic
1130146329 15:81276531-81276553 GGGCCTGTTGGCTTTACTGAGGG - Intronic
1130876809 15:88021690-88021712 TGGCTTCTTGGCTAAGATGTAGG + Intronic
1131829204 15:96343712-96343734 GGGCTTCTAGGCGAAGCTAATGG + Intergenic
1132892355 16:2210532-2210554 GGGCTTCTTGGCTCTGCTCAGGG - Exonic
1136748890 16:32615575-32615597 GGGCTTCCTGGTTTTCCTGATGG - Intergenic
1137555459 16:49467671-49467693 CGGCGTCTTTGTTATGCTGACGG - Intergenic
1137614942 16:49840892-49840914 GGGCTTCCTGGCCAGGCTCAGGG - Intronic
1140778446 16:78272293-78272315 GGGATGCTTGGCTCAGCTGAGGG + Intronic
1141251681 16:82364334-82364356 GGGCTTCTTGGATACACTCACGG + Intergenic
1141457199 16:84151130-84151152 GGGCTTCCAGTCTGTGCTGATGG + Intronic
1141948325 16:87324997-87325019 GGGCCGCTTGGCTGTGCTGCCGG - Intronic
1203051023 16_KI270728v1_random:874789-874811 GGGCTTCCTGGTTTTCCTGATGG - Intergenic
1144136951 17:12304454-12304476 GGGCTTCTTGGCTTTTGGGAGGG + Intergenic
1144999074 17:19290862-19290884 GGTCTTCTTGGCTCTCCTCATGG + Intronic
1145244998 17:21262860-21262882 GGGAATCTTGGCTCTGCTGCTGG + Intergenic
1147202200 17:38810247-38810269 GGGTATCTTGGCCATGCTGCTGG - Intronic
1147399435 17:40171196-40171218 GGGCTTCTGTTCTCTGCTGAGGG + Exonic
1149852278 17:60045130-60045152 GGACTTCTTGGCTCTCCAGAAGG + Intronic
1155526067 18:26717335-26717357 CTGCTTCTGGGCTCTGCTGAGGG + Intergenic
1156294141 18:35774623-35774645 GGCCTTCTAGGCCATGGTGAAGG - Intergenic
1156789131 18:40950669-40950691 GGGTTTCTAGGCCTTGCTGATGG - Intergenic
1156892896 18:42210070-42210092 GGCATTCTGGGATATGCTGAGGG + Intergenic
1158322899 18:56282692-56282714 GGGTTTCTGGGACATGCTGATGG + Intergenic
1159078841 18:63712641-63712663 GAGCCTGTTGGCAATGCTGAGGG - Exonic
1162501070 19:11054264-11054286 GGGCATCTGGGCTGTGCTCAGGG - Intronic
1164495392 19:28755928-28755950 GGCCTTCTTGTCTATCTTGAAGG - Intergenic
1167642690 19:50690455-50690477 GGTGTTCTTGGGTATTCTGAAGG - Intronic
1168252693 19:55149392-55149414 GGGCTCCTGGGCCATGCAGATGG - Intergenic
927353917 2:22151758-22151780 TAGCTTCTTGGCCATGCTGATGG - Intergenic
930012257 2:46946177-46946199 GGGCTTTGGGGCTTTGCTGAGGG + Intronic
932949112 2:76272027-76272049 AGGATTCTTGGAGATGCTGAAGG + Intergenic
933270466 2:80227550-80227572 CTGCTTCTTGACTTTGCTGATGG + Intronic
934623291 2:95829493-95829515 GAGCATCTGTGCTATGCTGAGGG + Intergenic
944984496 2:205159978-205160000 GGCCTTCTTGGCTTTGCTGTGGG - Intronic
947184658 2:227444411-227444433 GGGCCTCTTGCCCATCCTGAAGG + Intergenic
947372095 2:229457543-229457565 TGGCTTCTTAGCTATACTGCTGG - Intronic
948547390 2:238742591-238742613 TGGCTTGTTGGCCATGCTGGTGG - Intergenic
1171132120 20:22663575-22663597 GTGCTTCTGGGCTGTGCTGCAGG - Intergenic
1173549768 20:43924472-43924494 GAGCTTCTGGGCCATGCTTAAGG + Intronic
1176411813 21:6453296-6453318 GGGGGACTTGGCCATGCTGAGGG + Intergenic
1179374986 21:40842078-40842100 GGGTTTGCTGGCTCTGCTGAAGG + Intronic
1179687307 21:43061618-43061640 GGGGGACTTGGCCATGCTGAGGG + Intronic
1182404865 22:30118176-30118198 GGCCTTGTTGGCTATGGTAAGGG - Intronic
1183668029 22:39256350-39256372 GGGCTTCTGGGAGATGCTCAAGG - Intergenic
1183987494 22:41577527-41577549 GGGCTTCCTGGCAGTTCTGAAGG - Intronic
951632295 3:24735246-24735268 GGGCTACTTGGGTTTTCTGAAGG - Intergenic
953482973 3:43268222-43268244 GGGACTCTTGGCTATGTTCAGGG - Intergenic
955203784 3:56876767-56876789 GGGCATCTTTTCTATGCTGGTGG - Intronic
956711416 3:72041701-72041723 TGGCATCTTGGCTGTGCTGTAGG - Intergenic
960155621 3:114294787-114294809 GGATTTCTTGGCTTTCCTGAAGG + Intronic
962257657 3:133883496-133883518 GGGCTTGTTGGCCATGCACAGGG - Intronic
962652845 3:137513741-137513763 AGGCTTCTTGAATATGCTGTGGG + Intergenic
969319451 4:6402920-6402942 GGCCTTCATGGCTTTGCAGAGGG - Intronic
972918001 4:43904273-43904295 GTGCTTCTTGGCTGTGCCAATGG + Intergenic
973800698 4:54474926-54474948 GGATGACTTGGCTATGCTGAGGG + Intergenic
973804892 4:54516034-54516056 GGGCTCCTTCGCTGTTCTGATGG - Intergenic
975761152 4:77621078-77621100 GGGGTTTTTGGCAATGCTAAAGG + Intergenic
975820846 4:78268792-78268814 GGCATTCTTGGCTATTCTTAGGG + Intronic
977147717 4:93466330-93466352 TGGGTTCTTGGCTTTGCTCAGGG + Intronic
980985123 4:139687611-139687633 GGGCTTCTTGGCTATGCTGAGGG - Intronic
985915465 5:2915138-2915160 GGGCTGCTTGGCCATGCAAATGG - Intergenic
988601763 5:32646796-32646818 GGACTTAGTGGCTATGGTGATGG + Intergenic
992424214 5:76639067-76639089 GGGGTACTTGGCTATGTTTATGG - Intronic
997456361 5:134020415-134020437 GGGGTCCTTGGCTGTGGTGATGG - Intergenic
999429377 5:151512628-151512650 GGACTCCTTGGCTTTGCTGATGG - Intronic
999696000 5:154189676-154189698 GGGCTTCTGGGCGATGCGGAGGG - Intronic
1000364516 5:160478539-160478561 GGCCTTGTAGGCCATGCTGAGGG + Intergenic
1004569821 6:16834432-16834454 GGGCCTGGTGGCTATGGTGATGG + Intergenic
1008740972 6:54607888-54607910 GGGCTTCCAGGTGATGCTGATGG - Intergenic
1008889131 6:56465215-56465237 GGGCCTCTTGGTTTTGGTGATGG - Intronic
1010339418 6:74731032-74731054 GGGCTTCTTTGCAAGGCCGATGG + Intergenic
1016671788 6:146718066-146718088 GGGCATCTGTGCTATTCTGAAGG - Intronic
1017536160 6:155349773-155349795 GAGCAGCTGGGCTATGCTGAGGG + Intergenic
1018390381 6:163336807-163336829 CTGCTTCTTGGCTCTGCAGATGG + Intergenic
1018989467 6:168662559-168662581 AGGCTTCTGGGCTATGCTGGAGG - Intronic
1019130235 6:169867966-169867988 TGGCTACTGGGCCATGCTGAGGG + Intergenic
1020079474 7:5279665-5279687 GGTCTTGTTGGCCATGGTGAGGG - Intronic
1020400799 7:7775022-7775044 GGGTTTCTTGGCTATGAGGAAGG - Intronic
1021355654 7:19651001-19651023 GGGCAGCTTTGCTGTGCTGAGGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1025199420 7:56952531-56952553 GGTCTTGTTGGCCATGGTGAGGG + Intergenic
1025672528 7:63624402-63624424 GGTCTTGTTGGCCATGGTGAGGG - Intergenic
1027627648 7:80564818-80564840 GGGCTGCTGTGCTATGCTGGGGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1039031164 8:33311159-33311181 GGTCTTCATGGCTACCCTGAAGG - Intergenic
1041255658 8:55978037-55978059 GTGCTTCTTGGCTTTAGTGAGGG - Intronic
1042049491 8:64688202-64688224 GGGCTTCTGGGCATTGCTGCAGG - Intronic
1043572326 8:81618780-81618802 GGGCTTCTTGGCGCTTCTGAAGG - Intergenic
1052369853 9:27651775-27651797 GGACTTGTTGTCTATTCTGACGG - Intergenic
1052615985 9:30842651-30842673 AGGCTTCCAGGCTATACTGATGG + Intergenic
1056768676 9:89461032-89461054 GGGCTTCATGAGTGTGCTGAGGG - Intronic
1057548319 9:96034377-96034399 GGGCTCCTTGGCTCTTCTCAAGG - Intergenic
1057705383 9:97391852-97391874 GGGATTCTTTCCTATGCTGGTGG - Intergenic
1059425457 9:114218180-114218202 GCTCTTCTTGGTCATGCTGAAGG - Intronic
1060216863 9:121743689-121743711 GAGCCTGGTGGCTATGCTGAGGG + Intronic
1060428985 9:123532035-123532057 GTGCATCTTGGCTAAGCTGGGGG + Intronic
1062624880 9:137438240-137438262 GGTCTTCTTGGCCCTGCTGGGGG - Exonic
1186886698 X:13921404-13921426 GGGGTTCTTGGCTTTGCCCAGGG + Intronic
1193720320 X:84978211-84978233 GGTCTTCTTGGATATTTTGATGG + Intergenic
1196026289 X:111044593-111044615 TGCCTTCTTGGCTATGGTGGTGG + Intronic
1198426964 X:136530039-136530061 GGCCTTGTAGGCTATGCTGTGGG + Intergenic
1198971064 X:142280777-142280799 GGGCTTCTTGTCTATCCACAGGG + Intergenic
1199687646 X:150279016-150279038 GTCCTTCTTGGCCATTCTGAGGG + Intergenic
1200881059 Y:8211564-8211586 GTACTTCTAGGCTAAGCTGAGGG - Intergenic
1201955230 Y:19615768-19615790 GGGCTTGTTGGATAAGGTGAAGG - Intergenic