ID: 980985710

View in Genome Browser
Species Human (GRCh38)
Location 4:139692350-139692372
Sequence CTGTATTCCCAGAAGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 377}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980985710_980985717 -8 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985717 4:139692365-139692387 GAATACAGGGGATGTGCCCAGGG No data
980985710_980985719 8 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985719 4:139692381-139692403 CCCAGGGACACAGCTCCTGCTGG 0: 1
1: 1
2: 4
3: 96
4: 1114
980985710_980985716 -9 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985716 4:139692364-139692386 GGAATACAGGGGATGTGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 153
980985710_980985724 28 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985724 4:139692401-139692423 TGGCAAGCAGCTGAAGCAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 339
980985710_980985722 26 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985722 4:139692399-139692421 GCTGGCAAGCAGCTGAAGCAAGG 0: 1
1: 0
2: 1
3: 28
4: 380
980985710_980985723 27 Left 980985710 4:139692350-139692372 CCCAATTCCTTCTGGGAATACAG 0: 1
1: 1
2: 1
3: 32
4: 377
Right 980985723 4:139692400-139692422 CTGGCAAGCAGCTGAAGCAAGGG 0: 1
1: 0
2: 2
3: 33
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980985710 Original CRISPR CTGTATTCCCAGAAGGAATT GGG (reversed) Intronic
901257901 1:7847773-7847795 CAGTATTTCCAGAAGCAATCAGG + Exonic
902026089 1:13384723-13384745 CTGTAGACTCAGTAGGAATTTGG + Intergenic
902309451 1:15569905-15569927 CTGTAATCCCAGCAGCACTTTGG - Exonic
902433864 1:16384491-16384513 CTGTATTCCCAAGTGAAATTGGG + Intronic
904648865 1:31989158-31989180 CTGTAATCCCAGCAGCACTTTGG - Intergenic
905256838 1:36690199-36690221 CTAGATTCACAGAAGGAAATAGG + Intergenic
906188582 1:43880766-43880788 ATGTATTACCAGAAGCAATGCGG + Intronic
906818889 1:48908112-48908134 CTGTCTTCCCAAAAGGAACAGGG - Intronic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
909617623 1:77629494-77629516 CTGTAGTCCCAGCAGCAACTTGG + Intronic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
910267773 1:85357769-85357791 CAGTATAACCAGAATGAATTTGG + Intronic
913189474 1:116401219-116401241 CTGTAAGACCAGGAGGAATTCGG + Exonic
914941282 1:152024993-152025015 CTGTGTTCCCAGAAGGCATGGGG - Intergenic
915220091 1:154367720-154367742 CTGTAATCCCAGCAGGCCTTTGG - Intergenic
915420244 1:155775163-155775185 CTGTTTTCCCAGAAAGAGCTGGG - Exonic
915442522 1:155954228-155954250 CTTTAATCCCAGAAGGATTTGGG - Intronic
915832467 1:159143797-159143819 TTGTATTCCCAGCAGCAAGTGGG - Intronic
916315565 1:163444366-163444388 TTGACTTCCCAGAAGGAATTAGG - Intergenic
917231030 1:172838328-172838350 TTCTACTCCCAGAAGGTATTAGG + Intergenic
917412236 1:174771015-174771037 CTAGTTTCCCAGAATGAATTTGG - Intronic
918873772 1:190011524-190011546 CTGGCTTCACAGAATGAATTAGG - Intergenic
919555660 1:199049553-199049575 CTGTCTTCCTAGAATAAATTAGG - Intergenic
922610748 1:226925229-226925251 CTGTATACTCACAAGGAAGTGGG + Intronic
922965029 1:229682547-229682569 CTGCATTCCAAGAATGAATGGGG - Intergenic
923656990 1:235925606-235925628 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1063595108 10:7427843-7427865 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1064201001 10:13284836-13284858 CGTCATTCCCAGAAGGAACTGGG - Intronic
1064562779 10:16609103-16609125 CTGTAATCCCAGAAGGTCTGAGG - Intronic
1064907838 10:20366996-20367018 CTGTCTTCATAGAATGAATTAGG + Intergenic
1065023918 10:21523809-21523831 CAGTGCTCCCAGAAGGATTTGGG - Exonic
1065237126 10:23664223-23664245 CTGCCCTCACAGAAGGAATTTGG - Intergenic
1065355563 10:24837407-24837429 CTGGCTTCACAGAATGAATTAGG - Intergenic
1065672941 10:28141790-28141812 GTATTTTCCCAGAAGAAATTTGG - Intronic
1066207679 10:33205756-33205778 CATTATTCCCAGAAGCAATTTGG + Intronic
1066409543 10:35153370-35153392 TTGTATACCCAGAAGTAAGTAGG - Intronic
1066632390 10:37469832-37469854 CTGTTTTCCCAGACAGAACTGGG - Intergenic
1068009038 10:51424894-51424916 CTGTATTACCATAAGGAATGCGG + Intronic
1068481062 10:57588913-57588935 CTGGCTTCACAGAATGAATTAGG - Intergenic
1069082261 10:64100995-64101017 CTATAATCCCAGAAGGGATTGGG - Intergenic
1069905527 10:71730092-71730114 CTGTAATCCCAGCAGCACTTTGG - Intronic
1072937569 10:99728089-99728111 CTTTTTTACCAAAAGGAATTAGG + Intronic
1074066732 10:110021982-110022004 CTGTTTTCCCAGTAGAAAGTTGG + Intronic
1074985520 10:118655569-118655591 CTGGCTTCACAGAATGAATTAGG + Intergenic
1074994284 10:118742569-118742591 CTGTAATCCCAGCAGAAATGGGG + Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1079899821 11:26168413-26168435 CAGTATTCACAGGAAGAATTTGG + Intergenic
1080880929 11:36319794-36319816 TTGTTTTCCCCCAAGGAATTTGG - Intronic
1081518954 11:43862849-43862871 CTGTAATCCCAGCATGATTTTGG - Intergenic
1085566130 11:77515402-77515424 ATGTTTTCCCTGAAGGAATGTGG + Intronic
1086903790 11:92396491-92396513 GTTTATTGCCAGTAGGAATTGGG + Intronic
1087634090 11:100683892-100683914 CTGTAATCCCAGCAGGTACTAGG - Intergenic
1087805617 11:102552295-102552317 AGGTATTCTCAGAAGGATTTGGG + Intergenic
1088206733 11:107400701-107400723 CTGGCTTCACAGAATGAATTAGG - Intronic
1089983652 11:122793121-122793143 CTGTAATCCCAGCATGACTTTGG + Intronic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1090638552 11:128709805-128709827 CTGTATTACCACAAGGACATGGG - Intronic
1090700822 11:129294079-129294101 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1090757600 11:129806945-129806967 CTGGCTTCACAGAATGAATTAGG - Intergenic
1090933581 11:131321581-131321603 CTGTCTTCTGAGAAGGAATGAGG + Intergenic
1091911024 12:4230780-4230802 CTGAGGTCCCAGAAGCAATTCGG - Intergenic
1092079614 12:5704607-5704629 CTGTCTTCCCTGAAGGCATTTGG + Intronic
1093015936 12:14154750-14154772 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1093779609 12:23120484-23120506 CTGAATTCCCACAAGGAGCTGGG - Intergenic
1094659339 12:32451644-32451666 CTGTAATCCCAGGAGGGATTTGG + Intronic
1094770453 12:33652317-33652339 TGTTATTCCCAGAAGCAATTTGG + Intergenic
1096644918 12:53027390-53027412 CTGTAATCCCAGCAGCACTTTGG - Intronic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1097354343 12:58584826-58584848 ATGTGTTTCCAGAAGGATTTAGG + Intronic
1098864682 12:75748254-75748276 TGTTATTCCCAGAAGCAATTTGG - Intergenic
1099063469 12:77943013-77943035 CTGTAATCCCAGAATCAAATTGG - Intronic
1101294150 12:103403416-103403438 CTGTCATCCCAAAAGGAATGTGG + Intronic
1101478708 12:105076106-105076128 CTGTATTGGCAGAAGTAACTGGG + Intronic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1103091669 12:118102491-118102513 CTGCTTTCCCAGTTGGAATTGGG - Intronic
1103106995 12:118237127-118237149 CTTAATTCCCAGCAGGATTTCGG + Intronic
1103315834 12:120054333-120054355 CTGTAATCCCAGCACCAATTTGG - Intronic
1103716887 12:122950185-122950207 CTGTTTTCCAAGTAGGAATCTGG - Intronic
1104286607 12:127430278-127430300 CTGTTTTCCCGGAAAGAACTTGG + Intergenic
1104698326 12:130881555-130881577 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1105708324 13:22982392-22982414 CAGTATTCCCAGAATGATCTGGG + Intergenic
1105791469 13:23804014-23804036 CTATTTTCTCAAAAGGAATTAGG + Intronic
1107235080 13:38158662-38158684 CAGTTTTCCCAGCATGAATTTGG + Intergenic
1107328039 13:39266426-39266448 CTTTATTCCCAAAAGAACTTTGG - Intergenic
1107755684 13:43619756-43619778 CTGGCTTCACAGAATGAATTAGG + Intronic
1108746814 13:53404496-53404518 CTGTATCCCCAAAAGGCATGGGG + Intergenic
1108825857 13:54411431-54411453 CTGGCTTCACAGAATGAATTAGG - Intergenic
1109032328 13:57207707-57207729 CTGCATTCTCAGAAAGAGTTAGG + Intergenic
1109508083 13:63333405-63333427 CTGGCTTCACAGAATGAATTAGG + Intergenic
1109769858 13:66956446-66956468 CAGTATTACAAGTAGGAATTTGG + Intronic
1110341577 13:74397875-74397897 CTATAATCCCAGCAGGGATTTGG - Intergenic
1110664389 13:78099526-78099548 ATCTATTTCCAGAAGGAAATTGG - Intergenic
1110747119 13:79067236-79067258 CTCTTCTCCCACAAGGAATTGGG + Intergenic
1110959256 13:81599908-81599930 GAGTCTTCCCAGAGGGAATTTGG - Intergenic
1111831135 13:93331046-93331068 CTGTATTTCCAGGAGGTCTTTGG + Intronic
1112296689 13:98193722-98193744 CTGGATTTCCACAAGGCATTTGG - Intronic
1113338323 13:109397977-109397999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1115232495 14:31176673-31176695 CTGTAATCCCAGCAGCACTTTGG + Intronic
1116021310 14:39464969-39464991 CTGTCTTCTTAGAATGAATTTGG + Intergenic
1117475459 14:56090164-56090186 ATGGATTCTCAGCAGGAATTGGG - Intergenic
1118203764 14:63702447-63702469 CTGTAATCCCAGCAGCACTTTGG + Intronic
1118613727 14:67561288-67561310 CTGTAGTCCCAGCAGCACTTTGG + Intronic
1119205333 14:72789791-72789813 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119517696 14:75261308-75261330 CTGTAATCCCAGCAGCACTTTGG - Intronic
1120528297 14:85603204-85603226 CTGAATTCCCTGAAGGTACTTGG + Intronic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1122372207 14:101234938-101234960 CTGCATTCCGAGAGGGCATTTGG + Intergenic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1124386455 15:29211981-29212003 CTGGCTTCACAGAATGAATTAGG + Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1125009891 15:34859941-34859963 CTGATTTCCCACAAGGAATTAGG + Intronic
1125273161 15:37962543-37962565 CTGGCTTCACAGAATGAATTGGG + Intronic
1125387618 15:39155034-39155056 CTTTATTCCCAAAAGGATTCAGG + Intergenic
1126184833 15:45821755-45821777 CTATATTCCCAGAGGGATTATGG + Intergenic
1126730504 15:51677171-51677193 ATGGCTTCCCAGAAGGAATCAGG - Intergenic
1127234252 15:57031094-57031116 TTGTATTCTCAAAAGGAATAGGG + Intronic
1129586736 15:76875381-76875403 CTGTAATCCCAGAAAAACTTTGG + Intronic
1131031383 15:89188752-89188774 CTGTAATCCTAGGAGGATTTGGG + Intronic
1131181972 15:90246526-90246548 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1131789792 15:95951667-95951689 TTGTATTTACAAAAGGAATTTGG - Intergenic
1132877196 16:2145234-2145256 CTGTAATCCCAGCAGCACTTTGG - Intronic
1133537807 16:6718986-6719008 CTGTAGTCCCAGAAGCTACTTGG - Intronic
1135766980 16:25186234-25186256 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG + Intergenic
1135991301 16:27220417-27220439 CTGTATTCCCCGCAGGAGTCAGG + Exonic
1136571453 16:31099811-31099833 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1137224151 16:46486253-46486275 CTGTATTCATAGAATGAGTTAGG - Intergenic
1141026100 16:80550081-80550103 CTCCTTTCCCTGAAGGAATTAGG + Intronic
1141360064 16:83387390-83387412 CTGTGATTCCAGAAGGTATTGGG + Intronic
1143039422 17:4022550-4022572 CTGTATTCCCTGTTGGAAATAGG - Intronic
1144090329 17:11850523-11850545 CTGTAATCCCAGCTGTAATTTGG + Intronic
1144215661 17:13052993-13053015 CTATATTCTGAGAAGGGATTTGG + Intergenic
1145278502 17:21452098-21452120 CTGTATTCGCAGCAGCACTTTGG - Intergenic
1145399349 17:22518382-22518404 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1146134435 17:30306143-30306165 CAGCATTCCCAGAAGGAAACTGG - Intergenic
1147833055 17:43310622-43310644 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1148202917 17:45761801-45761823 CTTTCTTCCCAGGAAGAATTTGG - Intergenic
1148669982 17:49403125-49403147 CTCTGTTCCTAGAAGGATTTGGG + Intronic
1149150772 17:53561209-53561231 ATGCATGCCCAGAAGGCATTAGG + Intergenic
1149781034 17:59396768-59396790 CTGTAATCCCAGCAGGCATGAGG + Intronic
1150787874 17:68177280-68177302 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1152796877 17:82312329-82312351 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1153443398 18:5146237-5146259 CTGCATTTCCTGAAGGAAGTGGG - Intronic
1154265866 18:12878407-12878429 CTGTAATCCCAGCAGCACTTTGG + Intronic
1154319071 18:13330217-13330239 CTGTAATCCCAGCAGCACTTTGG - Intronic
1156582822 18:38397238-38397260 ATGCATTCCCAGAATGATTTGGG - Intergenic
1158216114 18:55102397-55102419 CTGTCCTCCCAGAAGCATTTGGG - Intergenic
1158655398 18:59326273-59326295 CAGTAGTTCTAGAAGGAATTGGG - Intergenic
1159659299 18:71074366-71074388 CTGAAATACCAGAAGTAATTGGG - Intergenic
1159829846 18:73262946-73262968 CTTTATTAAAAGAAGGAATTTGG - Intronic
1161537234 19:4827496-4827518 CTGTAATCCCAGCAGCACTTTGG + Intronic
1163250568 19:16124252-16124274 CTGAATTCCCAGGAGGATTTGGG + Intronic
1164298914 19:23941483-23941505 CTGGCTTCACAGAATGAATTAGG + Intronic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1164976109 19:32573959-32573981 CTGTAATCCCAGCAGGGATTTGG + Intergenic
1165083764 19:33328368-33328390 CTGTAATCCCAACAGGCATTGGG - Intergenic
1165265090 19:34655228-34655250 CTGAATTCCAAAAGGGAATTGGG - Intronic
1165834640 19:38746677-38746699 CTGTAATCCCAGCAGCACTTTGG + Intronic
1166114510 19:40645279-40645301 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1166145063 19:40828440-40828462 CTGTAATCCCAGAATATATTGGG + Intronic
1166643295 19:44512716-44512738 CTGTGTTCCCATCTGGAATTTGG - Intronic
1166740509 19:45112092-45112114 CTGTAATCCCAGCTGGGATTTGG - Intronic
1167194409 19:48017631-48017653 CTGTAATCCCAAAAGGGATTGGG + Intronic
1167736867 19:51300043-51300065 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1168396042 19:56049566-56049588 CTGTAATCCCAGCAGCACTTTGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925024063 2:594262-594284 CTTACTTCGCAGAAGGAATTCGG - Intergenic
925442700 2:3902096-3902118 CTGTATTCCCAGCATCTATTTGG + Intergenic
926642939 2:15257054-15257076 CTGGCTTCCCAGAATGATTTAGG + Intronic
926881018 2:17543347-17543369 CTGGATTCCCTGAAGGATTTTGG - Intronic
926902915 2:17775876-17775898 CTGTAATCCCAGCAGCATTTTGG + Intronic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927431390 2:23029268-23029290 CTGTAATCCCAGCAGCACTTTGG - Intergenic
928734009 2:34264629-34264651 CTGGCTTCACAGAATGAATTAGG - Intergenic
929517229 2:42614850-42614872 CTGTATTCCCAGAAGTATTTGGG + Intronic
930113493 2:47698751-47698773 TCTTATTCCCAGAAGCAATTTGG - Intronic
930225150 2:48784750-48784772 ATTTACTCCCAGAAGGAACTGGG + Intergenic
931178069 2:59873337-59873359 CTTTGTTCACAGAAGGAATCAGG + Intergenic
931835691 2:66096393-66096415 GTTTATTGCCAGAAGGAATTTGG + Intergenic
932270615 2:70405824-70405846 CTGGATTCATAGAATGAATTAGG - Intergenic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
935911277 2:107898792-107898814 CTGTATTCCAGGGAGGTATTTGG - Intergenic
935939516 2:108223475-108223497 CTGTTTTCTCAGAAGGGCTTCGG + Intergenic
935954308 2:108360371-108360393 CTGTCTTCATAGAATGAATTAGG - Intergenic
935969385 2:108515630-108515652 CTGTATTCCAGGGAGGTATTTGG - Intergenic
936133050 2:109863833-109863855 CTGTATTCCAGGGAGGTATTTGG - Intergenic
936211647 2:110507652-110507674 CTGTATTCCAGGGAGGTATTTGG + Intergenic
936420785 2:112362229-112362251 CTGTATTCCAGGGAGGTATTTGG + Intergenic
937020425 2:118646011-118646033 CTGTAATCCCAGGAGTGATTGGG - Intergenic
937200765 2:120203344-120203366 CTGCATTCCCAGAGTGACTTTGG + Intergenic
938969175 2:136416578-136416600 GTGCATTCCCTGTAGGAATTTGG + Intergenic
939453873 2:142408161-142408183 CAGTGTTGCCAGAAAGAATTGGG - Intergenic
939911709 2:147991304-147991326 CTGTAATCCCAGCAGCACTTTGG - Intronic
941404045 2:165067012-165067034 ATGTTTTCTCAGAAAGAATTGGG + Intergenic
942067248 2:172283482-172283504 TTGTTTTCCCTGAAGTAATTTGG + Intergenic
942368123 2:175251114-175251136 CTGTAATCCTAGCAGGATTTGGG - Intergenic
942960054 2:181819574-181819596 CTTTTTTTCCAAAAGGAATTAGG - Intergenic
943392111 2:187283324-187283346 CTGGATTCATAGAATGAATTTGG + Intergenic
945074563 2:206025011-206025033 CTGTAATCCCAGCATGATTTGGG - Intronic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
946478374 2:220030604-220030626 TGGTATTCCTAGAAGGAAGTTGG + Intergenic
947103627 2:226647020-226647042 CTGTAATCCCAGCATGATTTGGG - Intergenic
947456761 2:230261958-230261980 CTGGCTTCACAGAATGAATTAGG + Intronic
947614829 2:231549143-231549165 CTGTATTCCAGAAAGGAAGTAGG - Intergenic
947615118 2:231551098-231551120 CTGTATTCTAGAAAGGAATTAGG - Intergenic
948194762 2:236087145-236087167 TTGGATTCCCAGAAGCAAATGGG - Intronic
1169088729 20:2843840-2843862 CTGTACTGCCAGAAAGGATTAGG + Intronic
1169246435 20:4028640-4028662 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170558896 20:17538929-17538951 GTGTATTCCCAGAAGGAAACGGG - Intronic
1172255422 20:33513482-33513504 CTGTAATCCCAGCTGTAATTGGG - Intronic
1174933777 20:54845069-54845091 CTATAATTCCAGATGGAATTTGG - Intergenic
1175622146 20:60457092-60457114 CTGTAATCCCAGCTGTAATTGGG - Intergenic
1177847622 21:26309184-26309206 CTGGCTTCACAGAATGAATTAGG - Intergenic
1177891387 21:26808159-26808181 TTGAAGTCCCAGAAGGAATCTGG + Intergenic
1178031545 21:28532792-28532814 CTGGACTCACAGAATGAATTAGG + Intergenic
1178689752 21:34741132-34741154 CAGTAATCACAGAAGGAAATTGG - Intergenic
1179003394 21:37484586-37484608 CTGTAATCCCAGCATGATTTGGG - Intronic
1179892048 21:44340372-44340394 TGTTATTCCCAGAAGCAATTTGG - Intergenic
1181721218 22:24776025-24776047 TTTTATTCCCAGAAGCAACTTGG + Intergenic
1182004391 22:26947213-26947235 CTGGAATCCAAGAAGGAAATTGG + Intergenic
1183372959 22:37445532-37445554 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1184001708 22:41679294-41679316 CTGTAATCCCAGCAGCACTTTGG + Intronic
1184488964 22:44798368-44798390 CTGTAATCCCAGCAGCATTTTGG - Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950395608 3:12731675-12731697 CTGTAATCCCAGCAGCACTTTGG - Intergenic
950868391 3:16208096-16208118 ATGTTTTTCCATAAGGAATTAGG - Intronic
950935744 3:16837269-16837291 TGGTATTCCCAGGAGCAATTTGG - Intronic
952429367 3:33207123-33207145 CTGATTTCCCAATAGGAATTTGG + Intronic
953716095 3:45318280-45318302 CTGTAATCCCAGCAATAATTTGG + Intergenic
953851786 3:46470304-46470326 ATTTCTTCCCAGAAGGAATGAGG + Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
955949195 3:64225114-64225136 CTGTTTTCCCTGAGGGAATGTGG - Exonic
956562454 3:70595297-70595319 CTGCATTCCCAAAAGGACTTTGG - Intergenic
956976038 3:74580977-74580999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
957524618 3:81363759-81363781 CTAGAATCCCAGAAGGAATTTGG + Intergenic
958717498 3:97803185-97803207 CTGTAATCCCAGCAGGTAATCGG + Intergenic
958789730 3:98637529-98637551 CTGTAATCCCAGAAGAAAAAAGG + Intergenic
959899408 3:111642957-111642979 CTGGCTTCACAGAATGAATTAGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960361635 3:116719149-116719171 CTTTATTCTCAGTAGCAATTTGG + Intronic
960954770 3:123024487-123024509 CTGGATTCCCAGTGGGAATGGGG + Intronic
962122361 3:132575412-132575434 TTGGTTTCCTAGAAGGAATTAGG - Intronic
962474021 3:135740123-135740145 CTGTGGTCCCAGAAGGCACTGGG - Intergenic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
963952361 3:151216934-151216956 CTGTATTCCCAGGTCTAATTTGG + Intronic
964624746 3:158748330-158748352 CTGCATTCCAGGAAGGAATAAGG - Intronic
965429268 3:168566617-168566639 CTGTAATCCCAGCATGATTTGGG + Intergenic
965601484 3:170458824-170458846 CTCTGTTTCCAGAAGTAATTTGG + Intronic
966020600 3:175204081-175204103 CTGGCTTCACAGAATGAATTAGG - Intronic
966518180 3:180843432-180843454 CTGTAATCCCAGCAGCACTTTGG - Intronic
966685222 3:182685940-182685962 CTGTATTCACAGAAAAGATTTGG + Intergenic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
966811168 3:183846231-183846253 CTGTAATCCCAGCAGTACTTTGG + Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
969928252 4:10605567-10605589 CTGTAATCCCAGCAGCACTTTGG + Intronic
971472314 4:27040356-27040378 TTATATTCCCAGAAGGATTACGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972614132 4:40681825-40681847 TTGTTTTCCCTGAAGGCATTAGG - Intergenic
973918357 4:55659439-55659461 ATAGATTCTCAGAAGGAATTTGG - Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
974286583 4:59876836-59876858 ATCTATTCCCAGAAGGAAGCAGG + Intergenic
975041497 4:69749728-69749750 TTGTTTTCCCAGAAAGATTTAGG + Exonic
975088509 4:70372621-70372643 CTGTATGTCCAGAAAGAATAGGG - Intronic
976025611 4:80684523-80684545 CTGTAATCCCAGCAGCACTTTGG - Intronic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
978537852 4:109781645-109781667 CTGGCTTCACAGAATGAATTGGG - Intronic
978559025 4:110011772-110011794 CTGCAGCCCCAGAAGAAATTAGG + Exonic
978884132 4:113745824-113745846 CTGAAATCCCAGAAGGATTAGGG - Intronic
979175934 4:117664055-117664077 CTGTAGTCCCAGAATGGAGTGGG + Intergenic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
979832600 4:125319083-125319105 CTCTATTGCCTGAAGGAAATGGG - Exonic
979917989 4:126462879-126462901 ATGTATACCCAGAAGAAAATTGG - Intergenic
980152910 4:129070261-129070283 CTGGCTTCACAGAATGAATTAGG + Intronic
980215194 4:129843695-129843717 CTGTGGTCCAAGAAGAAATTGGG + Intergenic
980238143 4:130135161-130135183 CTGTCTTCATAGAATGAATTAGG - Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981207619 4:142062473-142062495 CTGTAATCCCAGCAGCACTTTGG + Intronic
981634079 4:146855034-146855056 CTGTAATCCCAGCAGCACTTTGG + Intronic
982630936 4:157828210-157828232 CTGGCTTCACAGAATGAATTAGG - Intergenic
982949186 4:161667356-161667378 CTGTACTAACAGAAAGAATTGGG + Intronic
985478158 5:91470-91492 CTGAATTCCCAGCAGGAAGCTGG + Intergenic
986475688 5:8129315-8129337 CTGGATGGCCAGAAAGAATTGGG - Intergenic
987197917 5:15546255-15546277 CTGTATTTCCAGCAGAAATGGGG - Intronic
987564780 5:19570040-19570062 CTCTATTCCCAAAAGATATTGGG + Intronic
988078802 5:26389032-26389054 CTGTGTGCCAAGAAAGAATTAGG - Intergenic
989597710 5:43172003-43172025 CTGTAATCCCAGCAGCACTTTGG - Intronic
990357723 5:54986635-54986657 CTGTTTTCCCAGAGGGACCTAGG - Intronic
990961985 5:61403936-61403958 TTGTCTTCCCAGGATGAATTAGG + Intronic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
992265870 5:75017770-75017792 CTGTAGTGGCAGCAGGAATTGGG - Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993907536 5:93640186-93640208 CTGTAATCCCAGCAGCACTTTGG + Intronic
995063038 5:107832019-107832041 CTGTATCCCAGGAAGGAAATAGG + Intergenic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
995838882 5:116424490-116424512 CTGTAATCCCAGCAGCACTTTGG + Intergenic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996908094 5:128624968-128624990 CTGAATTCCCAGCATGACTTTGG + Intronic
999283392 5:150379609-150379631 CTGTCTTCCCAGGAGGTGTTGGG - Exonic
999613318 5:153394728-153394750 TTGTATTGCCAGAATGGATTGGG + Intergenic
1000137298 5:158365178-158365200 CTTTATTCCCACACAGAATTAGG + Intergenic
1000597446 5:163232213-163232235 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1000605037 5:163318806-163318828 CTGAATACCCGGAAGGAACTGGG - Intergenic
1000892543 5:166816661-166816683 ATTTATTCCCAGAATAAATTTGG + Intergenic
1001505965 5:172280843-172280865 GTGTATTCTTTGAAGGAATTTGG - Intronic
1003798681 6:9636081-9636103 CTGTATTCCTAGAAGGCACATGG - Intronic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1007533825 6:42566508-42566530 CTGTAATCCCAGCTGTAATTCGG - Intronic
1008156838 6:48026054-48026076 CTGTATCACCCTAAGGAATTTGG + Intronic
1008807528 6:55450006-55450028 CTGAGTTCCCTGAAGGAACTTGG + Intronic
1008841942 6:55913083-55913105 CTGTAGTCCCAGAGGTACTTGGG + Intergenic
1008939296 6:57029184-57029206 TGTTATTCCCAGGAGGAATTTGG - Intergenic
1009581981 6:65548318-65548340 CTGTATTCACTGAATCAATTAGG + Intronic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1011473575 6:87731451-87731473 CTGTAATCCCAGCAGTAGTTTGG - Intergenic
1011958796 6:93059882-93059904 ATCTCTTCCCAGAAGGAATATGG - Intergenic
1014285344 6:119490803-119490825 CTGGATTCATAGAATGAATTAGG - Intergenic
1014330480 6:120057753-120057775 CTGGCTTCACAGAATGAATTTGG - Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1016165084 6:140931796-140931818 TTGTATTTCAAGAAGGAATTTGG + Intergenic
1017358006 6:153532844-153532866 CTGGCTTCCCAGAATGAGTTAGG + Intergenic
1020197536 7:6053485-6053507 CTGTAATCCCAGCTGTAATTTGG - Intronic
1022046694 7:26627503-26627525 CTGTGCTCCCAGAAGGCACTGGG - Intergenic
1022051676 7:26680447-26680469 CTGTATTTCCTTAAGAAATTGGG - Intronic
1022186218 7:27972109-27972131 CTGTCTTCCCCTAAGGAATCTGG - Intronic
1022771107 7:33473580-33473602 CTGTAATCCCAGCAGCACTTTGG - Intronic
1023600338 7:41876112-41876134 AAGATTTCCCAGAAGGAATTGGG + Intergenic
1023701571 7:42896726-42896748 CTGGCTTCACAGAATGAATTAGG - Intergenic
1024452760 7:49566703-49566725 CTGGATTCACAGAATGAGTTAGG - Intergenic
1026317494 7:69239836-69239858 CTGTAATCCCAGCAGGCGTTTGG - Intergenic
1026984966 7:74549027-74549049 CTGTAATCCCAGCTGGCATTTGG + Intronic
1027699530 7:81452538-81452560 CTGGCTTCCTAGAATGAATTAGG - Intergenic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1029205778 7:98868841-98868863 CTGTATTTCCAGGAGGAAATAGG + Intronic
1030533460 7:110737443-110737465 TTATATTCCCAGAAGGATTAAGG - Intronic
1032672154 7:134094550-134094572 CTGGATTCACAGAATGAGTTAGG - Intergenic
1033239737 7:139667865-139667887 CTGTAATCCCAGCAGCACTTTGG + Intronic
1033331257 7:140418623-140418645 CTGTAATCCCAACAGGGATTTGG + Intronic
1033636705 7:143218623-143218645 TTGTGTTCACAGAAGGAGTTTGG - Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036213400 8:6860779-6860801 CGTTATTCCCAGGAGCAATTGGG + Intergenic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1038713874 8:29974331-29974353 CTGTCTGCCCAGGATGAATTTGG - Intergenic
1039529081 8:38243751-38243773 CTGTAGTCCCAGCAGTACTTGGG - Intronic
1041076395 8:54174156-54174178 CTGTAATCCCAGCAGGCCTTTGG + Intergenic
1041109661 8:54472572-54472594 CTGTCTCCCCAGAAGAACTTTGG + Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041938930 8:63365780-63365802 CAGTAATCCCAGGAGCAATTTGG - Intergenic
1042122521 8:65503887-65503909 CTGACTTCACAGAATGAATTAGG + Intergenic
1042355792 8:67826016-67826038 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1043121374 8:76329439-76329461 CTGGCTTCACAGAATGAATTAGG + Intergenic
1043876439 8:85491721-85491743 TTATATTCCCAGAAGGATTATGG + Intergenic
1044373709 8:91445092-91445114 CTTTAGTCCAAGAAGGATTTAGG - Intergenic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1045048960 8:98305653-98305675 CTCTGTACCAAGAAGGAATTTGG + Intergenic
1046152752 8:110249749-110249771 CTGCATTCCCAGATGAATTTAGG + Intergenic
1046302152 8:112309510-112309532 CTGATTTCCCAGAATTAATTTGG - Intronic
1046394613 8:113625554-113625576 TTATATTCCCAGAAGGATTATGG - Intergenic
1046857440 8:119049317-119049339 CTGTATTACCACTAGGGATTAGG + Intronic
1047478610 8:125259145-125259167 CTGTAATCCCAGCATGAAGTGGG - Intronic
1047654517 8:126962145-126962167 CAGTATTCCAAGAATTAATTTGG - Intergenic
1048932098 8:139323394-139323416 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1049638586 8:143703523-143703545 CTGTAATCCCAGCTGTAATTGGG - Intronic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051257551 9:15230722-15230744 CTGTAATCCCAGCAGGACTTTGG + Intronic
1051848817 9:21485058-21485080 ATGTAGTCCCAGAAGAGATTAGG - Intergenic
1051881444 9:21844365-21844387 CTGGCTTCACAGAATGAATTAGG - Intronic
1053089004 9:35255746-35255768 TGTTATTCCCAGAAGCAATTTGG + Intronic
1053171179 9:35885944-35885966 TTGTATTACCAGAAGAAATCTGG + Intergenic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1055785501 9:79865332-79865354 CTGTATTCCCAGAACCAAGGAGG - Intergenic
1055911174 9:81353857-81353879 CTGTCTTCATAGAATGAATTAGG + Intergenic
1055956961 9:81783016-81783038 CTATAATCCCAGAAGGATTTTGG - Intergenic
1056322430 9:85448895-85448917 CTGGCTTCACAGAATGAATTAGG + Intergenic
1058198760 9:102012000-102012022 CTGGATTCCTAGAATGAGTTAGG - Intergenic
1058291876 9:103252671-103252693 GTGTAGTCACTGAAGGAATTAGG - Intergenic
1058622890 9:106902425-106902447 CTGGATTCATAGAATGAATTAGG + Intronic
1058631287 9:106989543-106989565 CTGGCTTCCCAGAATGAATTAGG + Intronic
1059319076 9:113452614-113452636 CTGGAATCCCAGAAGAAAGTAGG - Intronic
1059451467 9:114373616-114373638 CTGTAATCCCAGCAGCACTTTGG + Intronic
1060685354 9:125606138-125606160 ATGTATTTCCTGAAGGAAATTGG - Intronic
1060692437 9:125675707-125675729 CTTTGTTGCCAGAAGGAATATGG - Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1185703636 X:2250232-2250254 CTGTAATCCCAGCAGAACTTTGG + Intronic
1186166424 X:6831237-6831259 TGTTATTCCCAGAAGCAATTTGG + Intergenic
1186994265 X:15102998-15103020 ATGTATATCCAGAAGGAATGGGG - Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1188686456 X:33075996-33076018 CTTTATGCCCAGGAGCAATTTGG - Intronic
1189339382 X:40193054-40193076 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1189878854 X:45467987-45468009 CTGGCTTCACAGAATGAATTAGG + Intergenic
1191820447 X:65300434-65300456 TTGCATTCCCAGAAGGATTATGG - Intergenic
1191870415 X:65740636-65740658 CTATACTCCTACAAGGAATTGGG - Exonic
1192740207 X:73885082-73885104 CTGGATTCATAGAATGAATTAGG - Intergenic
1192944059 X:75945847-75945869 CTGGATTCATAGAATGAATTAGG + Intergenic
1193148603 X:78102794-78102816 TGTTATTCCCAGAAGCAATTTGG - Intronic
1193723443 X:85014647-85014669 CTTTACAGCCAGAAGGAATTGGG - Intronic
1194557178 X:95374559-95374581 CTGGCTTCACAGAATGAATTAGG - Intergenic
1195628079 X:107024299-107024321 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1196294955 X:113986642-113986664 CTGTAATTTCAGAATGAATTTGG + Intergenic
1197145184 X:123164291-123164313 CTGGATTCATAGAAGGATTTAGG - Intergenic
1199578981 X:149342738-149342760 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1199717333 X:150515934-150515956 CTTTATGACCAGGAGGAATTTGG - Intergenic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic