ID: 980987084

View in Genome Browser
Species Human (GRCh38)
Location 4:139705843-139705865
Sequence CCTGAAGTGCAGTTATTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980987078_980987084 -4 Left 980987078 4:139705824-139705846 CCCCCAAAGCTGTTCTGACCCTG 0: 1
1: 0
2: 1
3: 16
4: 221
Right 980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
980987080_980987084 -6 Left 980987080 4:139705826-139705848 CCCAAAGCTGTTCTGACCCTGAA 0: 1
1: 0
2: 2
3: 18
4: 175
Right 980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
980987079_980987084 -5 Left 980987079 4:139705825-139705847 CCCCAAAGCTGTTCTGACCCTGA 0: 1
1: 0
2: 0
3: 26
4: 257
Right 980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
980987081_980987084 -7 Left 980987081 4:139705827-139705849 CCAAAGCTGTTCTGACCCTGAAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980987084 Original CRISPR CCTGAAGTGCAGTTATTGTC TGG Intronic
907795222 1:57709475-57709497 ATTGAAGTGCTGTCATTGTCTGG + Intronic
908301749 1:62768685-62768707 GCTGGAGTGCAGTAATTGCCTGG + Intergenic
909786200 1:79617207-79617229 CCTGAAATGCAGGTGTTGGCCGG + Intergenic
911450196 1:98052981-98053003 CCTGTAATGCTGTTATTGCCCGG + Intergenic
918573277 1:186024471-186024493 CATCAAGTTCAGTTCTTGTCTGG + Intronic
923934165 1:238743121-238743143 CCTGAAGTGAATTTGTTTTCCGG + Intergenic
1066586966 10:36946103-36946125 CCTGAAATCAAGTTATTGGCAGG + Intergenic
1069830338 10:71278989-71279011 CCTGAGGTGCAGTTCTTTCCAGG + Intronic
1070381589 10:75885062-75885084 CCTGAACTGCTGTCATTCTCTGG - Intronic
1076299789 10:129416383-129416405 CCTGAAGTGGCCTTATTTTCAGG + Intergenic
1077530902 11:3094334-3094356 CCTGAAATGCAGCCAGTGTCAGG + Exonic
1080470569 11:32541383-32541405 TCTGAAGGGCAATTATTGTCTGG - Intergenic
1080778139 11:35405175-35405197 CCTGAAATGGAGTTCTTTTCTGG - Intronic
1081114518 11:39183432-39183454 CCTGAATTTCAGTTATTACCTGG + Intergenic
1084205402 11:67588833-67588855 CCTGAAGTGCTGGGATTGGCTGG - Intergenic
1085901298 11:80703011-80703033 CCTGAAATCAAGTTATTGGCAGG - Intergenic
1088896443 11:114082340-114082362 CCTACAGTGCAGTTATTGTGTGG + Intronic
1090450908 11:126805614-126805636 CCTGAAGAACATTTATTTTCAGG + Intronic
1091855133 12:3733181-3733203 CCTGAAGGGCAGCTGTGGTCAGG + Exonic
1096186614 12:49585817-49585839 CCTGAAGTGCACCTTTTCTCGGG - Intronic
1103472197 12:121190930-121190952 GCTTAAGTGCAGTGATTGTTTGG - Intergenic
1104631619 12:130407700-130407722 CATGAAGTGCAGTGTTTGGCTGG + Intronic
1105225747 13:18429942-18429964 CATGAAGTGAACTTAGTGTCGGG - Intergenic
1106082586 13:26512770-26512792 CCTGACCTGAAGTGATTGTCAGG + Intergenic
1107181549 13:37467060-37467082 CCTGCCATGCAGTTATTGGCTGG - Intergenic
1109556397 13:63981585-63981607 CCTCATGTTCAGCTATTGTCAGG + Intergenic
1110674337 13:78222409-78222431 GCTGCAGTCCAGTTATTGGCTGG + Intergenic
1110787581 13:79549096-79549118 ACTGAAATGCTGTTATTTTCTGG - Intronic
1111391502 13:87601637-87601659 GCTGAAGTGCAGATGTTGACAGG + Intergenic
1114010201 14:18358293-18358315 CATGAAGTGAACTTAGTGTCGGG - Intergenic
1116952055 14:50887676-50887698 CCTGAAAGGCAGTTATGGTAGGG + Intronic
1119331723 14:73799968-73799990 CCTGCAGTGGAGTTATTGTGAGG - Intergenic
1124058038 15:26260679-26260701 CTTCAAGTGCAGTTCTTCTCTGG + Intergenic
1125319969 15:38475423-38475445 CCTAAAGTGAAGGTATTGGCAGG + Intronic
1128438304 15:67677916-67677938 CCTCAATGGCAGTTATTGCCTGG - Intronic
1132024618 15:98394466-98394488 ACTGAAGCACAGTCATTGTCTGG + Intergenic
1136549278 16:30973951-30973973 TCTGAAATGCAGATATGGTCAGG - Intronic
1143243822 17:5466754-5466776 ACAGAAGTGCAGTTAAGGTCTGG - Intronic
1149670667 17:58406059-58406081 CCTGATGTGCAGTGATTCTGTGG + Intronic
1154527631 18:15309579-15309601 CATGAAGTGAACTTAGTGTCGGG + Intergenic
1156648835 18:39200211-39200233 CTTGAAGGGCATGTATTGTCTGG + Intergenic
1156690403 18:39700538-39700560 CCTGAATATCAGGTATTGTCTGG - Intergenic
1157128734 18:44982975-44982997 CCATAATTGCAGTTATAGTCAGG - Intronic
1157393026 18:47318787-47318809 ACTGAAGTGTAGATATTGTTTGG + Intergenic
1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG + Intergenic
925028751 2:632868-632890 CCTAAAGTGCAGTTTTTGGGGGG + Intergenic
934906347 2:98207713-98207735 GCTGAAGAGCACTTATTGTGAGG + Intronic
937379101 2:121360216-121360238 GCTGAAGCCCAGTTTTTGTCTGG + Intronic
938526725 2:132141036-132141058 CATGAAGTGAACTTAGTGTCGGG + Intergenic
939971638 2:148668704-148668726 CATGAAGTTCAGATATTCTCTGG + Intronic
940725817 2:157334989-157335011 CCTGAAGAGCATTTCTTTTCTGG - Intergenic
947016999 2:225632078-225632100 CCTGAAGTGCTGGGATTGCCCGG + Intronic
948418322 2:237834281-237834303 CCTGAAGTGCATTTATAATATGG - Exonic
1170252756 20:14303447-14303469 CGAGAAGAGCAGTTATTCTCAGG + Intronic
1170356736 20:15500215-15500237 CCTGGTGTACAGTAATTGTCTGG + Intronic
1173683654 20:44907401-44907423 GCTGGAGTGCAGTTATTCACAGG - Exonic
1175668154 20:60877870-60877892 CCAGAAGGGCAGGCATTGTCTGG + Intergenic
1176769800 21:13058965-13058987 CATGAAGTGAACTTAGTGTCGGG - Intergenic
1178010273 21:28276962-28276984 CCTAAAATCCAGATATTGTCAGG - Intergenic
1178291326 21:31371105-31371127 CTTGAATTGAAGTTGTTGTCAGG - Intronic
1180434699 22:15289094-15289116 CATGAAGTGAACTTAGTGTCGGG - Intergenic
1180516906 22:16152908-16152930 CATGAAGTGAACTTAGTGTCAGG - Intergenic
1180631872 22:17235409-17235431 CTTTAAACGCAGTTATTGTCAGG + Intergenic
1184751526 22:46489091-46489113 GCTGAATTGCAGTTATTCTTTGG - Intronic
956184967 3:66553621-66553643 CCTGAATGGCAGTAATTGGCTGG - Intergenic
958894505 3:99814878-99814900 CCTGAAGTACACTTATAGGCTGG + Intergenic
959115826 3:102177235-102177257 ACTGAAGTGCTGTCATTGTCTGG + Intronic
967242672 3:187456436-187456458 CCTGAAGTCCAGGAAATGTCTGG - Intergenic
967457398 3:189704097-189704119 CCTGAAGTGTAGGTAGTATCTGG - Intronic
968215298 3:196884395-196884417 CCTGAGGGGAAGTTATTGTTTGG - Intronic
970464078 4:16305847-16305869 CATGAAGTGCTGCTTTTGTCAGG + Intergenic
972669397 4:41199696-41199718 CTTGAAGGCTAGTTATTGTCAGG - Intronic
974576054 4:63724360-63724382 CCTGAAGTCAATTTTTTGTCAGG + Intergenic
977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG + Intronic
980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG + Intronic
983336468 4:166399802-166399824 CCTGAATTTCTGTCATTGTCAGG + Intergenic
983644821 4:169978969-169978991 TCTGCAGTGCAGATATTGGCAGG - Intergenic
987736184 5:21846436-21846458 CTTGAAGTGGCGTCATTGTCTGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
992641819 5:78774325-78774347 TCTGAAGTGCAGTCAATGACTGG + Intergenic
992830481 5:80588957-80588979 CCTGAAGTACAGCTAATATCAGG - Intergenic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
995991577 5:118246350-118246372 CCTGAAGTACAGTTATTAATTGG + Intergenic
996519467 5:124410866-124410888 CCTGAAGTGCAGTTTTGATATGG - Intergenic
1001976180 5:176001081-176001103 TTTGAAGTGCATTTATTGTAGGG - Intronic
1001982905 5:176048429-176048451 CCTGATGTTCACTTGTTGTCTGG + Intergenic
1002234558 5:177795628-177795650 CCTGATGTTCACTTGTTGTCTGG - Intergenic
1002241242 5:177842690-177842712 TTTGAAGTGCATTTATTGTAGGG + Intergenic
1006721442 6:36154807-36154829 TCTGAAGAGCATTTATTTTCAGG - Intergenic
1011867462 6:91848225-91848247 CCTAACGTGCAGTGATTGGCAGG - Intergenic
1017831531 6:158134719-158134741 CCTGAATAACAGTTATTGTTAGG - Intronic
1018001540 6:159582943-159582965 CCGGAAGTGGAGGTGTTGTCTGG + Intergenic
1019015536 6:168877235-168877257 CTTGAGGAGCAGTTATTGGCTGG - Intergenic
1026471641 7:70698374-70698396 CCTGCAGTGCAGCTATTTGCTGG - Intronic
1033523342 7:142184308-142184330 CTTGAAGTGAAGATATTATCTGG - Intronic
1036104305 8:5823933-5823955 CATGAAGTGAACTTAGTGTCAGG + Intergenic
1037647964 8:20810898-20810920 CCTGAAATGCAATTATTAACTGG - Intergenic
1037940958 8:22950458-22950480 ACTGAAGTGGCGTCATTGTCTGG + Intronic
1038909448 8:31946632-31946654 CCTGAATGGCACTTATTTTCAGG + Intronic
1042704922 8:71655963-71655985 CCTGAAGTTAAGTTATAGTTAGG + Intergenic
1043935204 8:86134647-86134669 CCTGAAGTGCAGTTGCTGAGTGG - Intronic
1044003203 8:86910699-86910721 AATGAAGTGGAGTCATTGTCTGG + Intronic
1044190775 8:89314808-89314830 GCTGAAATGTAGTTATTGTAAGG + Intergenic
1046187872 8:110746627-110746649 CCTGCTGTGCACGTATTGTCAGG - Intergenic
1047008994 8:120650663-120650685 TCTGAAGTTCAGTTAATGCCAGG - Intronic
1047651508 8:126927733-126927755 CTTGAAGTGGTGTCATTGTCTGG + Intergenic
1053705427 9:40748393-40748415 CATGAAGTGAACTTAGTGTCAGG + Intergenic
1054415502 9:64872000-64872022 CATGAAGTGAACTTAGTGTCAGG + Intergenic
1055797442 9:79990187-79990209 TCTGAACTGCAGTTATTGCTAGG - Intergenic
1057997449 9:99831079-99831101 CATGAAGTGCAGTTAATGATAGG + Intronic
1058077980 9:100669846-100669868 CCTGAAGTGGCATCATTGTCTGG + Intergenic
1058742932 9:107962343-107962365 CTTGAAGTGGATTTATTGTATGG - Intergenic
1191057714 X:56259963-56259985 TCTGAAATCAAGTTATTGTCAGG + Intronic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1197838858 X:130724055-130724077 TGTGAACTGCAATTATTGTCAGG - Intronic