ID: 980988352

View in Genome Browser
Species Human (GRCh38)
Location 4:139717468-139717490
Sequence GCTGGGCGCCCTCTCCGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980988352_980988360 4 Left 980988352 4:139717468-139717490 CCTCTTCGGAGAGGGCGCCCAGC 0: 1
1: 0
2: 1
3: 2
4: 70
Right 980988360 4:139717495-139717517 GCCTGGGCTTCTCACCCACCAGG 0: 1
1: 0
2: 1
3: 32
4: 273
980988352_980988362 13 Left 980988352 4:139717468-139717490 CCTCTTCGGAGAGGGCGCCCAGC 0: 1
1: 0
2: 1
3: 2
4: 70
Right 980988362 4:139717504-139717526 TCTCACCCACCAGGCACCTCTGG 0: 1
1: 0
2: 0
3: 27
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980988352 Original CRISPR GCTGGGCGCCCTCTCCGAAG AGG (reversed) Exonic
901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG + Intronic
903876015 1:26473179-26473201 GCTGGGCTCCGCCTCCGGAGGGG + Intronic
906719809 1:47996906-47996928 GCTGGGCGCCCTCTGGGGCGTGG + Intergenic
916610203 1:166384373-166384395 GCTGTGGGGCCTCTCCAAAGTGG - Intergenic
918038816 1:180899686-180899708 ACTGGGCTCCATCTCCAAAGAGG + Intergenic
1064354275 10:14603966-14603988 GCTGGGCCCCTTCCCCGCAGCGG + Intronic
1067342790 10:45418573-45418595 CCTGGGCGTCCTCTCTGATGGGG + Intronic
1077329824 11:1979360-1979382 GCTCGGTGCCCTCCCGGAAGGGG - Intronic
1078367063 11:10715564-10715586 GCTGGGAACCTTCTCCAAAGGGG + Intergenic
1090636818 11:128694669-128694691 ACTGGGCTTCCTCTCCGCAGAGG + Intronic
1202812802 11_KI270721v1_random:34539-34561 GCTCGGTGCCCTCCCGGAAGGGG - Intergenic
1104901476 12:132191711-132191733 CCTGGGCGCCCTCTCCTCACTGG - Intergenic
1106883270 13:34155106-34155128 GCTAGGCTCCCTCTCAGTAGGGG + Intergenic
1108689354 13:52847677-52847699 GCAGGGCGCCGTGGCCGAAGTGG - Exonic
1117176515 14:53152300-53152322 GCGGGGCGGCCTCTACGAGGTGG - Exonic
1117407335 14:55417044-55417066 GGGGGGCGCCCTTTCCCAAGAGG + Intronic
1118883719 14:69849981-69850003 GTGGGGCGCCCTCCCCCAAGGGG + Intergenic
1121636232 14:95455559-95455581 GCTGCGCGCCCTCTGGGAGGAGG - Exonic
1129607443 15:77031737-77031759 GCTGGGGGCCCTCTCTGCTGGGG - Intronic
1133921032 16:10153376-10153398 GCTGGGGGGACTCTACGAAGGGG + Intronic
1134444667 16:14321735-14321757 GCTGTGCCCCCGCTCAGAAGTGG - Intergenic
1136293378 16:29288938-29288960 GCTGGGCTCCCTCTCAGTGGAGG + Intergenic
1141318049 16:82980127-82980149 GGAGGGAGCCCTCTCTGAAGTGG + Intronic
1142031244 16:87839584-87839606 GCGGGGCCCCCTCTGCGTAGGGG + Intronic
1142099261 16:88262945-88262967 GCTGGGCTCCCTCTCAGTGGAGG + Intergenic
1142329889 16:89445070-89445092 CCTGGGCACCCTCACCCAAGGGG - Intronic
1143110043 17:4548014-4548036 GCTGGAGGCCCACTCCGCAGAGG - Exonic
1147986148 17:44308732-44308754 GCTGGGCCCTCTGTCCGACGGGG - Exonic
1150069347 17:62138556-62138578 GCTGGACGCCCTCGCCCAACTGG - Intergenic
1151163204 17:72183211-72183233 GCTGGGAGCCCTCTCCCAAGAGG + Intergenic
1151842680 17:76628943-76628965 GCTGGGCTTCCTCTCAGGAGGGG + Intronic
1152570326 17:81118841-81118863 GCAGGGGGCCTTCTCCGAGGAGG + Intronic
1159973220 18:74678495-74678517 GCTGGCTGTCCTCTCTGAAGTGG + Intronic
1160792572 19:929431-929453 GCCGGGCCCCCTCCCCGCAGGGG + Exonic
1162385440 19:10358003-10358025 CCTGGGCGCCCTCTCCAGGGAGG - Exonic
1162583362 19:11544235-11544257 TCTGGGAGGCCTCTCTGAAGAGG + Intronic
1167146243 19:47681993-47682015 GGTGGGGGCCCTCTGCGGAGAGG - Exonic
1167151630 19:47713531-47713553 GCTGGGAGCACTCACCGACGGGG - Exonic
930718197 2:54613072-54613094 GCTGAGCGCTCTCTCTTAAGGGG - Intronic
943917750 2:193658970-193658992 TCTGGGCTCCCTCTCTGCAGTGG + Intergenic
1173926406 20:46784502-46784524 GCTGGTCGTCCCCTCAGAAGAGG + Intergenic
1174287732 20:49484095-49484117 CCGGGGCGCGCTCTCCGAGGCGG + Intergenic
1174736701 20:52972168-52972190 TCTGTGCGCCCTCTCCGCCGGGG - Intergenic
1175905370 20:62376910-62376932 GCTTGGCCCCCACTCCCAAGAGG + Intergenic
1176123351 20:63464178-63464200 GCTGGGCGGCCTCTCGCAGGGGG - Intronic
1183784426 22:40021380-40021402 GCTGTACGCCATCTCCGAGGAGG + Exonic
953157389 3:40387229-40387251 GCTAGTCGCCTTCTCCGAATCGG + Exonic
954295083 3:49670020-49670042 GCGAGGAGCCCTCTCTGAAGGGG - Exonic
954913855 3:54132499-54132521 GCTGTGAGCCCTCTCCTGAGAGG - Intronic
955525793 3:59818346-59818368 GCAGGGTGCCCACTCCTAAGTGG + Intronic
961762766 3:129183779-129183801 GCTGCGGGCCCGCTCCGACGCGG - Exonic
980988352 4:139717468-139717490 GCTGGGCGCCCTCTCCGAAGAGG - Exonic
998341065 5:141418508-141418530 GGTGGGGACCCTCCCCGAAGCGG + Exonic
998981784 5:147711913-147711935 GCTGGGCGCGGTGTCCGAGGCGG - Intronic
1003175535 6:3750725-3750747 GCGGGGCGGCCGCTCCGAGGAGG + Intronic
1005965450 6:30723374-30723396 GCTCGGCGCCCTCTGTGTAGTGG - Exonic
1011522225 6:88221190-88221212 GCTGGACTCCCTTTCCAAAGTGG - Intergenic
1018943679 6:168329427-168329449 GATGGGAGCCCTCCCGGAAGAGG - Intergenic
1018943701 6:168329509-168329531 GATGGGAGCCCTCCCAGAAGAGG - Intergenic
1025261770 7:57424978-57425000 GCTGTGCGCCCCCGCCGAGGCGG + Intergenic
1033531857 7:142272163-142272185 GCTGGGAGCCGTCTCTGATGTGG + Intergenic
1035225080 7:157428327-157428349 GCTGGGCGCCCACTCCCCAGGGG - Intergenic
1035370022 7:158373831-158373853 TCTGGGCGCCCTCTCTGGATGGG + Intronic
1037895684 8:22652614-22652636 GCTGGCTGCCCTCTCAGAGGCGG + Intronic
1038757150 8:30352319-30352341 GCTCGGCGCCCTCTGTGTAGTGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1049431475 8:142567234-142567256 TGTGGGCGCCCTCTCGGAGGAGG - Intergenic
1049992141 9:1000297-1000319 GCTGGCCTCCCTCTCCCAAGGGG + Intergenic
1053055206 9:34989824-34989846 GCTTGGCGCCCTCACCGGTGAGG - Exonic
1056592446 9:87974401-87974423 CGTGGGCGCCCTCCCCGATGCGG + Exonic
1059305137 9:113348163-113348185 GCTGGGCACTCTCTCAAAAGGGG - Intergenic
1059431718 9:114254496-114254518 GCTGGGAGCCCAGTCCGAGGTGG + Intronic
1062434687 9:136541699-136541721 GCCCGGGGCCTTCTCCGAAGCGG + Intronic
1200393468 X:155968117-155968139 TCTGGGTCCCCTCTCCGTAGTGG - Intergenic