ID: 980988415

View in Genome Browser
Species Human (GRCh38)
Location 4:139717746-139717768
Sequence CTAGGACACGGAGGGAGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980988406_980988415 6 Left 980988406 4:139717717-139717739 CCTGGGAGTGCACAGAAGGCAGC 0: 1
1: 0
2: 2
3: 49
4: 622
Right 980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG 0: 1
1: 0
2: 0
3: 29
4: 389
980988401_980988415 28 Left 980988401 4:139717695-139717717 CCGACTCTTCCGTAGTGATCTGC 0: 1
1: 0
2: 1
3: 1
4: 58
Right 980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG 0: 1
1: 0
2: 0
3: 29
4: 389
980988404_980988415 19 Left 980988404 4:139717704-139717726 CCGTAGTGATCTGCCTGGGAGTG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG 0: 1
1: 0
2: 0
3: 29
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980988415 Original CRISPR CTAGGACACGGAGGGAGGAG GGG Exonic
900210363 1:1452586-1452608 CCAGCTCAAGGAGGGAGGAGCGG - Intronic
900456580 1:2777834-2777856 CCTGGACACAGCGGGAGGAGGGG + Intronic
901632935 1:10656730-10656752 CGAGAACCTGGAGGGAGGAGGGG + Exonic
903333978 1:22612853-22612875 CGTGGAGAGGGAGGGAGGAGGGG - Intergenic
903828188 1:26159861-26159883 CTGGGGCAAGGAGCGAGGAGGGG - Intronic
904873219 1:33634835-33634857 CAAGGAGCAGGAGGGAGGAGAGG - Intronic
904873615 1:33636768-33636790 CAAGAACATGGGGGGAGGAGGGG - Intronic
905173886 1:36124814-36124836 CTGGGAGAGGAAGGGAGGAGGGG + Intronic
905890163 1:41513709-41513731 CCAGGACTCGGAAGGACGAGAGG - Exonic
906787143 1:48626111-48626133 CTGGGCCACGTAGGTAGGAGTGG + Intronic
907821468 1:57974034-57974056 CAAGGACAAGGAGGCAGGGGTGG - Intronic
908007311 1:59740069-59740091 GGAGGACAGGGAGGGAGGAGAGG - Intronic
909925253 1:81430816-81430838 CATGGACACAGAGGGAGGATTGG - Intronic
911175260 1:94811710-94811732 CTGAGACAGGGAGGGAGGTGGGG - Intergenic
911364918 1:96926507-96926529 ATAGGACACTGAAGGATGAGGGG + Intergenic
911582004 1:99644821-99644843 CAAGGACACGGGGCAAGGAGAGG - Intergenic
912381118 1:109248795-109248817 CATGGACAGGGAGGCAGGAGGGG + Intergenic
913531519 1:119737294-119737316 CCAGGAGTCAGAGGGAGGAGAGG + Intronic
914845615 1:151282248-151282270 CTGGAGCGCGGAGGGAGGAGAGG + Intronic
915019089 1:152762960-152762982 CAAGGACACTGAGGGAAGATTGG - Intronic
915238755 1:154504040-154504062 CTAGGACTGGGAAGGCGGAGAGG - Intronic
917273384 1:173303392-173303414 CTTGGGCACAGAGGGAGGTGGGG - Intergenic
917337299 1:173938771-173938793 AGAGGACCCTGAGGGAGGAGGGG - Exonic
918265337 1:182837293-182837315 CTTGAACCTGGAGGGAGGAGGGG - Intergenic
919399569 1:197095239-197095261 CTAGGATAGGGAGAGGGGAGGGG - Intronic
919878378 1:201886862-201886884 CTAGGACAGAGAGTGAAGAGAGG - Intergenic
921667569 1:217890959-217890981 CCAGGAGATGGAGGAAGGAGGGG + Intergenic
922794538 1:228333560-228333582 CTGGGCCACGGGAGGAGGAGTGG - Intronic
923035050 1:230279810-230279832 TGAGGACAGGGCGGGAGGAGGGG + Exonic
924106025 1:240649835-240649857 GTAGGACAGAGAGGGAAGAGAGG + Intergenic
1063917848 10:10902844-10902866 CAAAGAAAGGGAGGGAGGAGAGG + Intergenic
1064336617 10:14448793-14448815 GGAGGAGAGGGAGGGAGGAGAGG + Intronic
1064483874 10:15765689-15765711 CCGGGACAAGGAGGGAGGAGAGG + Intergenic
1064963251 10:20989562-20989584 AGAAGACAGGGAGGGAGGAGGGG + Intronic
1064993823 10:21279320-21279342 CTAGGCAACAGAGGGAGCAGAGG - Intergenic
1070700135 10:78595889-78595911 CTAGGGCAGGGAATGAGGAGTGG + Intergenic
1072250261 10:93576350-93576372 CTACAACACTGAGGAAGGAGAGG + Intronic
1072520116 10:96223776-96223798 CCAGGACACAGAGGGGGGTGGGG - Intronic
1073076162 10:100826906-100826928 CTGAGACCCGGCGGGAGGAGCGG + Intronic
1073350936 10:102819327-102819349 CTCGGAAAAGGAGGGAGAAGTGG + Intergenic
1074782862 10:116814616-116814638 CTAGGACACAGCTGGATGAGGGG - Intergenic
1075619744 10:123917032-123917054 CCAGGACAGGAAGGGAGGGGAGG + Intronic
1075797571 10:125131552-125131574 GTAGGACAGGGAGGGGGCAGCGG + Intronic
1075914614 10:126156765-126156787 CCAGGACAGGGTGGAAGGAGAGG + Intronic
1076530522 10:131141587-131141609 CAAGGGAAGGGAGGGAGGAGAGG - Intronic
1076752868 10:132552442-132552464 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752891 10:132552556-132552578 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752913 10:132552670-132552692 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752926 10:132552727-132552749 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752941 10:132552784-132552806 GTAGGATAGGGAGGGAGGACTGG + Intronic
1076752952 10:132552841-132552863 GTAGGACAGGGAGGGAGGACTGG + Intronic
1076752965 10:132552898-132552920 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752978 10:132552955-132552977 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076752991 10:132553014-132553036 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753002 10:132553071-132553093 GTAGGACAGGGAGGGAGGACTGG + Intronic
1076753015 10:132553128-132553150 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753028 10:132553185-132553207 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753041 10:132553242-132553264 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753054 10:132553299-132553321 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753077 10:132553413-132553435 GTAGGATAGGGAGGGAGGACTGG + Intronic
1076753088 10:132553470-132553492 GTAGGATAGGGAGGGAGGACTGG + Intronic
1076753122 10:132553647-132553669 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753145 10:132553765-132553787 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753158 10:132553822-132553844 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753171 10:132553879-132553901 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753184 10:132553936-132553958 GTAGGATAGGGAGGGAGGATTGG + Intronic
1076753205 10:132554050-132554072 GTAGGACAGGGAGGGAGGACTGG + Intronic
1077295648 11:1825185-1825207 GTAGGGCAGGGAGGGAGCAGGGG + Intergenic
1077539397 11:3139481-3139503 CTGGGAAAGGCAGGGAGGAGTGG + Intronic
1077923206 11:6656173-6656195 CCAGGGCACTGAGGGAGAAGAGG - Intergenic
1079336839 11:19577515-19577537 GAAGGACACAGAGGGAGAAGTGG - Intronic
1079448858 11:20581807-20581829 GTTGGACAGAGAGGGAGGAGTGG - Intergenic
1079689982 11:23406150-23406172 CGAGGACACAGAGGAAGAAGAGG - Intergenic
1082849537 11:57753160-57753182 CGAGGACTCGGGAGGAGGAGGGG - Intronic
1083053274 11:59795800-59795822 CTACGACAGGGAGGGAGGCATGG - Intronic
1083616381 11:64028552-64028574 CTGGGCCGCGGAGGGAGCAGAGG - Intronic
1083775669 11:64893362-64893384 CTAGGACAGGGAGGGCGGCAGGG + Intergenic
1084214420 11:67639819-67639841 GGAGGACAAGGAGGGAGGAAGGG - Intergenic
1084958909 11:72705966-72705988 CTGGGACAGGCAGGGATGAGAGG + Intronic
1085044098 11:73343348-73343370 CCAGGAGACGGTGGGGGGAGGGG + Intronic
1086338040 11:85818961-85818983 TAAGGACACCGAGGCAGGAGAGG - Intergenic
1087415169 11:97846078-97846100 CTGGGAAAGGAAGGGAGGAGAGG + Intergenic
1088481019 11:110296527-110296549 CTGCGACAGGGAGGGAGAAGCGG + Exonic
1089069618 11:115689302-115689324 CTCGGACAGGCAGGCAGGAGTGG + Intergenic
1089660656 11:119983097-119983119 CCAGGAACAGGAGGGAGGAGGGG - Intergenic
1089678644 11:120107357-120107379 CCAGGTGAGGGAGGGAGGAGAGG - Intergenic
1090252666 11:125262609-125262631 AAAGGACAGGGAGGGAGGAAGGG - Intronic
1090480945 11:127067541-127067563 CTAAGACACAGAGGGAGGGGTGG - Intergenic
1091218288 11:133916824-133916846 CTGGGACAGGGAGGGAGCTGGGG + Intronic
1092274643 12:7049970-7049992 CCAGGACACGGAGGTTGCAGTGG - Intronic
1095478722 12:42611577-42611599 CTAGAACAGGGAGGGAAGAGGGG - Intergenic
1099068936 12:78020917-78020939 CTAAGACACAGAAGGAGGCGAGG - Intronic
1099487495 12:83246502-83246524 CTCGGGCACAGAGGGAGGTGGGG - Intergenic
1100397788 12:94199705-94199727 CTGGGACACCAAGGGTGGAGAGG - Intronic
1101724788 12:107379851-107379873 CAAGGACATGGAGCAAGGAGTGG - Intronic
1102873853 12:116434679-116434701 CTGGGGCAGGGAGAGAGGAGAGG + Intergenic
1103119782 12:118371793-118371815 CGCGGACCCCGAGGGAGGAGCGG - Intronic
1103836857 12:123828676-123828698 CTCAGGCACAGAGGGAGGAGAGG - Intronic
1104465389 12:128985692-128985714 CGAGGGCTCAGAGGGAGGAGGGG - Intergenic
1104484804 12:129141761-129141783 CTAGAGCAGGGAGGGAGGAAGGG + Intronic
1104657165 12:130581924-130581946 CTGAGCCAGGGAGGGAGGAGAGG - Intronic
1104835323 12:131786501-131786523 CTGAGAGACGGAGGGAAGAGAGG + Exonic
1104955980 12:132466058-132466080 CCAGGGGAGGGAGGGAGGAGCGG - Intergenic
1106139039 13:26995429-26995451 CCAGGAACTGGAGGGAGGAGAGG - Intergenic
1106602486 13:31199945-31199967 GGCGGAGACGGAGGGAGGAGGGG + Exonic
1107074638 13:36309723-36309745 CTAGGCCGGGGAGGGAGGAGGGG + Intronic
1107629017 13:42324229-42324251 CTAGGACAGAGAGGAAGGTGAGG + Intergenic
1108473289 13:50788575-50788597 CTAGGACACAGAGGACAGAGTGG - Intronic
1109546025 13:63839689-63839711 CTAAGGCAGGGAGGGATGAGGGG - Intergenic
1109555262 13:63965932-63965954 TTAGGACACAGAGGCAGGTGGGG + Intergenic
1112504874 13:99969668-99969690 CTACGACCCGGTGGGAAGAGAGG + Intronic
1112995592 13:105571076-105571098 CTGGGAGAGGGATGGAGGAGGGG + Intergenic
1114214111 14:20642876-20642898 CTCGGGCACAGAGGGAGGTGAGG + Intergenic
1114260058 14:21030195-21030217 TGAGGAGACAGAGGGAGGAGAGG - Intronic
1115922507 14:38391998-38392020 CTAAGACACGGAGGAAGTGGAGG + Intergenic
1118508034 14:66436948-66436970 CTAGAAGAGGGAGGGAGGAAGGG - Intergenic
1118861727 14:69669395-69669417 CTAGTTCAAGGAGGGAGGAAAGG + Intronic
1118976091 14:70677734-70677756 CTAAGACACGGAGGAGGGGGAGG + Intergenic
1119686520 14:76636985-76637007 CCAGGAGATGGAGTGAGGAGGGG + Intergenic
1120136696 14:80878274-80878296 CTTGGGCATGGAGGGTGGAGTGG - Intronic
1121332350 14:93057678-93057700 CGAGGCCATGCAGGGAGGAGAGG + Intronic
1121410191 14:93744257-93744279 CAAGGCCACTGAGGAAGGAGTGG + Intronic
1122308249 14:100779016-100779038 GTAGGAGAGGGAGGGAGGAGCGG - Intergenic
1122556441 14:102583293-102583315 CTAGCACACGGAGGGGAGAAGGG - Intergenic
1125478267 15:40062408-40062430 CTAGGAAAAGCATGGAGGAGTGG + Intergenic
1127501384 15:59557093-59557115 CCAGGGCCCAGAGGGAGGAGAGG + Intergenic
1128332188 15:66763150-66763172 CTAGGAGATGGAAGGTGGAGGGG + Intronic
1128535945 15:68490575-68490597 CCAGGAAGAGGAGGGAGGAGCGG - Intergenic
1128818182 15:70629546-70629568 CTAGGGCAGGGAGGAGGGAGAGG - Intergenic
1129152890 15:73700118-73700140 CAGGGATAGGGAGGGAGGAGCGG - Intronic
1129656346 15:77527774-77527796 CAGGGAAACTGAGGGAGGAGAGG + Intergenic
1130006005 15:80098712-80098734 GTAGGATACTGAGGGTGGAGTGG + Intronic
1130042718 15:80418519-80418541 TGAGGACAAGGAAGGAGGAGTGG - Intronic
1130321916 15:82848816-82848838 CTGGGGCAGGGAGGGAGAAGGGG - Intronic
1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG + Intronic
1133616636 16:7483032-7483054 CTGGAACACCGTGGGAGGAGAGG + Intronic
1133898440 16:9950780-9950802 CTAGGACACGGAGGCTTAAGGGG - Intronic
1135881188 16:26259241-26259263 CTGGAACCTGGAGGGAGGAGAGG + Intergenic
1136777592 16:32880010-32880032 CTGGGACAGGGAGCCAGGAGAGG - Intergenic
1136893032 16:33981504-33981526 CTGGGACAGGGAGCCAGGAGAGG + Intergenic
1137655375 16:50154010-50154032 CGAGGACGCCGAGGGAGGCGAGG - Exonic
1137991588 16:53162205-53162227 CCAGGACACAGTGGGAAGAGAGG + Intronic
1138237678 16:55398781-55398803 GTTGGACAGGGAGAGAGGAGAGG + Intronic
1139966664 16:70749635-70749657 CTAGGAGACTGAGGGAAGATGGG - Intronic
1140875982 16:79152922-79152944 CTAGGAGACGGTGGAAAGAGAGG + Intronic
1142422428 16:89980271-89980293 GGAGGAGACGGAGGCAGGAGAGG + Intergenic
1203080007 16_KI270728v1_random:1142119-1142141 CTGGGACAGGGAGCCAGGAGAGG - Intergenic
1142615943 17:1135173-1135195 CTAGAACACAGAGTGAGCAGAGG + Intronic
1142921387 17:3190149-3190171 CTTGGGCACAGAGGGAGGCGGGG - Intergenic
1143273379 17:5692183-5692205 CAAGGTCAGGGAGGGAGAAGGGG + Intergenic
1143502464 17:7347321-7347343 CCAGGACAGGGAAGGAAGAGGGG - Intronic
1143554587 17:7652209-7652231 GTCGGTGACGGAGGGAGGAGTGG + Intronic
1143712287 17:8743231-8743253 CAAGGACAAGGATGGAGGGGTGG + Intronic
1144023858 17:11260640-11260662 CCAGGAGACAGAGAGAGGAGAGG - Intronic
1144478589 17:15610564-15610586 CTAGGGCACAGAGGGATGTGGGG - Intronic
1144825422 17:18103109-18103131 CTGGGACACAGCAGGAGGAGAGG - Intronic
1144919708 17:18753166-18753188 CTAGGGCACAGAGGGAAGTGGGG + Intronic
1144950748 17:18992244-18992266 CAAGGACACAGAGGGAGGTGGGG - Intronic
1145104323 17:20102774-20102796 CAAGGAGGAGGAGGGAGGAGGGG - Intronic
1146296362 17:31653661-31653683 CCAGGATACGGAGAGGGGAGAGG - Intergenic
1146377939 17:32307323-32307345 CGAAGACACTGATGGAGGAGTGG - Intronic
1146974327 17:37098082-37098104 CCAGGCCACAGAGGGAAGAGGGG - Intronic
1147139213 17:38452161-38452183 CTAGGGGACGGAGGTGGGAGGGG - Intronic
1147530647 17:41273847-41273869 CTAGGAAAAGGAGGGAGGGGAGG + Intergenic
1148965337 17:51430197-51430219 CTCGGGCACAGAGGGAGGTGGGG + Intergenic
1149366710 17:55952559-55952581 CTTGGGCACAGAGGGAGGTGGGG + Intergenic
1151372335 17:73656146-73656168 CTAGGGCATGGAAGGAGGAGAGG + Intergenic
1151380749 17:73724219-73724241 CTAGGAGAGGGAGGCTGGAGAGG + Intergenic
1151889512 17:76943851-76943873 CAGGGAGAGGGAGGGAGGAGCGG + Intronic
1151966478 17:77434210-77434232 CTAGGATACGGTGGCAGGACTGG + Intronic
1152521057 17:80857251-80857273 CTGGGAAAGGCAGGGAGGAGCGG - Intronic
1152642712 17:81455882-81455904 CGAGGCCACGGAGAGAGGAGGGG - Intronic
1152660088 17:81537993-81538015 CTAGGAAGCGGAGGGTGGGGTGG + Intergenic
1152800793 17:82329840-82329862 CCAGGAGAGGGAGAGAGGAGGGG - Intronic
1155198768 18:23499737-23499759 CTAGGAGCAGGAGTGAGGAGAGG + Intergenic
1156192791 18:34739060-34739082 CTAGAGCAGGGAGGGAGGAAGGG - Intronic
1156473366 18:37391086-37391108 ACAGGAGACGTAGGGAGGAGAGG + Intronic
1162445184 19:10718442-10718464 CTAGGGCGCGGAGGGCGGACCGG + Intronic
1162572522 19:11481315-11481337 CTAGGAGCTGGACGGAGGAGGGG - Intronic
1163086935 19:14988255-14988277 CTGGGGCACAGAGGGAGGTGGGG - Intronic
1163123785 19:15233263-15233285 CTAGGACTAGGAGGGAGGCGCGG + Intronic
1164564018 19:29313031-29313053 CTAGGACTGGGAGAGGGGAGTGG + Intergenic
1164592133 19:29512905-29512927 CTTGGAGAAGGAGGAAGGAGAGG + Intergenic
1164976361 19:32575585-32575607 CAGTGAGACGGAGGGAGGAGGGG - Intergenic
1165063966 19:33218570-33218592 CTTGGGCACGGAGGAGGGAGGGG + Intronic
1165259493 19:34599701-34599723 AGAGGACAGGGAGGGAAGAGAGG - Intronic
1165556640 19:36638666-36638688 CTAGGATGGGGAGGGAGGAGAGG + Exonic
1166169117 19:41014855-41014877 GTAGGAAAAGGAAGGAGGAGGGG + Intronic
1166876728 19:45902153-45902175 ATAGGAAATGGAGGGAGGATGGG + Intronic
1166995930 19:46719769-46719791 CTGGGGCATGGAGGGTGGAGTGG - Exonic
1167131045 19:47586136-47586158 GTGGGGCACTGAGGGAGGAGAGG - Intergenic
1167307848 19:48719391-48719413 CTAGGAAAGGGAGGAAGCAGAGG + Intronic
1167507488 19:49878475-49878497 CTAGGGTAAGGAGGGAGGCGGGG - Intronic
1167571345 19:50290823-50290845 CTAGCACACAGAGGGAGGCTGGG + Intronic
1168387282 19:55974828-55974850 CTAGGGCACAGAGGGAGGTGGGG - Intronic
925421670 2:3717757-3717779 CCTAGACACAGAGGGAGGAGCGG - Intronic
925615436 2:5740741-5740763 CTTGGGCACCGGGGGAGGAGTGG - Intergenic
926588449 2:14714814-14714836 CCAGGCCACGGAGGAAGGGGTGG + Intergenic
927490569 2:23518512-23518534 CTAGGCCACGGAAGTAGCAGAGG - Intronic
927511669 2:23647899-23647921 CTTGGATACTGAGGGGGGAGTGG - Intronic
927521875 2:23703886-23703908 CTAGGGCTGGGACGGAGGAGTGG + Intronic
928453190 2:31397255-31397277 CCAGGAGAGGGAAGGAGGAGGGG + Intronic
928467284 2:31533767-31533789 CTGGGACACACAGGGAGGAAAGG + Intronic
935341725 2:102065080-102065102 CACGGACACGGAGAGCGGAGGGG + Intronic
936230384 2:110695233-110695255 CTCGGGCACAGAGGGAGGTGGGG + Intergenic
936455078 2:112666724-112666746 CTAGGACTCAGAGGGGGAAGTGG + Intergenic
937980983 2:127615206-127615228 CTGGGCCAAGGAAGGAGGAGGGG + Intronic
939181000 2:138802762-138802784 ATAGGACAGAGAGGGAGGACAGG - Intergenic
939354084 2:141078390-141078412 CTAGGAGAAGGAGGCAGGGGTGG - Intronic
940391378 2:153136429-153136451 CTATGACTGGGAGGCAGGAGAGG + Intergenic
942886594 2:180932563-180932585 ATAGGACATTGAGGGAAGAGTGG - Intergenic
943078889 2:183232822-183232844 AAAGGACATGGAGGGAGTAGTGG + Intergenic
944994464 2:205278033-205278055 CTTGGACGCGGAGGGAGGATAGG + Intronic
945012245 2:205477994-205478016 GAAGGACACGGAGCAAGGAGAGG + Intronic
945453360 2:210018965-210018987 CTAGAACAAAGAGGGAGAAGTGG - Intronic
947793489 2:232880512-232880534 CCAGGACCCGGCAGGAGGAGAGG + Intronic
948066695 2:235086570-235086592 CTATGACACGGGAGGAGGACAGG + Intergenic
948317991 2:237044593-237044615 CTAGGACATAGAGGGTGGAAAGG + Intergenic
948745284 2:240087691-240087713 CTAGGGCACAGGGGGAGGTGAGG - Intergenic
1170021358 20:11840074-11840096 GCAGGACATGGAAGGAGGAGAGG - Intergenic
1170135871 20:13073201-13073223 CTAGAAAAGGTAGGGAGGAGGGG - Intronic
1170545678 20:17433979-17434001 AGAGGACAGGGAGAGAGGAGAGG - Intronic
1171196632 20:23205067-23205089 CTAGGAGGGGCAGGGAGGAGAGG - Intergenic
1172021554 20:31918140-31918162 CTCGGGCACAGAGGGAGGTGGGG - Intronic
1173364161 20:42370018-42370040 CCTGGACACAGAGAGAGGAGGGG - Intronic
1175032760 20:55972112-55972134 CTAGCACAGGGAGAGAGCAGGGG - Intergenic
1175404496 20:58717581-58717603 CTCTAACATGGAGGGAGGAGGGG - Intronic
1176020129 20:62958563-62958585 CCAGGACACTGGGGGAGGAGTGG - Intronic
1176098975 20:63356416-63356438 CTAGGGCACCGAGAGAGGAAGGG + Intronic
1176679548 21:9812013-9812035 CTGGGACCCGGAGGGTGTAGGGG + Intergenic
1176682382 21:9826102-9826124 CTGGGACCCGGAGGGTGGGGGGG + Intergenic
1176682661 21:9827511-9827533 CTGGGACCCGGAGGGTGGGGGGG + Intergenic
1176683220 21:9830327-9830349 CTGGGACCCGGAGGGTGGGGGGG + Intergenic
1176683499 21:9831737-9831759 CTGGGACCCGGAGGGTGGGGGGG + Intergenic
1176684056 21:9834547-9834569 CTGGGACCCGGAGGGTGGGGGGG + Intergenic
1177662597 21:24105498-24105520 CTAGGAGGGGGAGGGAGGAAGGG + Intergenic
1178914492 21:36699059-36699081 CTGGGTCCCGGAGGGGGGAGCGG - Intergenic
1179572678 21:42287139-42287161 GGAGGACACAGAGGCAGGAGAGG + Intronic
1180086264 21:45509285-45509307 GGAGGACACAGATGGAGGAGGGG + Intronic
1180179864 21:46113180-46113202 CTGGGACACACAGGGAGGTGGGG - Intronic
1180231565 21:46429613-46429635 CTAGACAACGGAGGGCGGAGGGG - Intronic
1182266637 22:29120611-29120633 GAAGGAAACGGAGGAAGGAGAGG + Intronic
1184361333 22:44020674-44020696 GTAGGGCAAGGATGGAGGAGGGG + Intronic
1184571420 22:45327426-45327448 AGAGGCCACGGAGGCAGGAGAGG - Intronic
1185009327 22:48304551-48304573 AGAGGACAGGGATGGAGGAGAGG - Intergenic
1185181195 22:49364422-49364444 CCAGGAAGGGGAGGGAGGAGAGG - Intergenic
1185181226 22:49364530-49364552 CCAGGAAGGGGAGGGAGGAGAGG - Intergenic
949520470 3:4848489-4848511 CTACTGCATGGAGGGAGGAGTGG - Intronic
950479690 3:13236722-13236744 CTGGGACACAGAGGGAAGGGTGG + Intergenic
950610111 3:14121188-14121210 CTGGGACACAGAGGGAGGTGGGG - Intronic
951026758 3:17839289-17839311 CTAGCATAAGGAGGGAGGAATGG + Intronic
953538010 3:43790484-43790506 GGAGGACACAGAGGGAAGAGTGG - Intergenic
954912730 3:54122505-54122527 AGAGGAGAGGGAGGGAGGAGAGG - Intergenic
955107040 3:55908408-55908430 CTGGGACAGGGAGGCAGGAAAGG + Intronic
955317074 3:57947984-57948006 CTAGGGGAGGGATGGAGGAGAGG + Intergenic
958078414 3:88713111-88713133 TTTGGAAAGGGAGGGAGGAGTGG + Intergenic
960031943 3:113062946-113062968 TCAGGACAGTGAGGGAGGAGGGG - Intergenic
960223937 3:115147782-115147804 GGAGGAAAAGGAGGGAGGAGCGG - Intergenic
961324271 3:126101087-126101109 CTTGGACCCGGGGGAAGGAGGGG - Intronic
961335052 3:126170856-126170878 CTGGGACACAAAGGGAGGTGGGG + Intronic
961518157 3:127451312-127451334 CCTGGACAGTGAGGGAGGAGTGG - Intergenic
962769692 3:138600906-138600928 GGAGGAGAAGGAGGGAGGAGGGG + Intergenic
962769702 3:138600931-138600953 GGAGGAGAAGGAGGGAGGAGGGG + Intergenic
963593777 3:147299234-147299256 CTAGAAAAGGAAGGGAGGAGTGG + Intergenic
963673816 3:148283567-148283589 CTAGAACAGGGAGGGAGGGAGGG - Intergenic
963852547 3:150223043-150223065 CTACCACTCGGAGGGGGGAGGGG + Intergenic
964359263 3:155877550-155877572 CTAGGACTGGGAGGGAGCGGTGG - Intronic
968234226 3:197022303-197022325 CAAGGACACGGGGAGTGGAGGGG + Intronic
968733126 4:2281078-2281100 CCAGGGCAGGGAGGCAGGAGAGG - Intronic
969155280 4:5204753-5204775 CCAGGACACGCCGGGAGCAGTGG - Intronic
970959011 4:21851169-21851191 TTAGTGCAGGGAGGGAGGAGAGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973832848 4:54779284-54779306 GTGGGACAGGGAGGGAGGAGGGG + Intergenic
974863549 4:67552473-67552495 CTTGGGCACAGAGGGAGGTGGGG - Intergenic
974865253 4:67572351-67572373 CTAGGACTCAGAGGAAAGAGTGG + Intronic
975316027 4:72954330-72954352 GTAGAACAGGGAGGGAGTAGAGG - Intergenic
976236248 4:82900539-82900561 CTCCAACGCGGAGGGAGGAGCGG + Intronic
976298571 4:83496379-83496401 CTTGGAAACAGAGGGAGGTGAGG - Intronic
976962711 4:90998879-90998901 CTAGGGCATGGAGGGAGGGAGGG - Intronic
980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG + Exonic
983178161 4:164615935-164615957 CTAGTTCAGGGAGGGAGGTGAGG + Intergenic
983680470 4:170347508-170347530 CTTGGGCACAGAGGGAGGTGGGG - Intergenic
985846895 5:2356447-2356469 CTGGGACAGAGAGGGAGGAAGGG - Intergenic
985973191 5:3393430-3393452 CGAGGACACGGTGGGGGGCGGGG - Intergenic
985988150 5:3534679-3534701 CTTGGACACGGAGGCGGGAGGGG + Intergenic
986773468 5:10994274-10994296 CTGGGACGGGGATGGAGGAGCGG + Intronic
987722900 5:21661913-21661935 CTAAAACATGGAGGGAGGTGGGG + Intergenic
987910157 5:24132463-24132485 CTAGGGCAGGGAGGGAGAGGAGG + Intronic
988471270 5:31541510-31541532 TTGGGACACTGAGGCAGGAGAGG + Intronic
988530537 5:32023331-32023353 CTTGGAGAAGGAGGAAGGAGAGG - Intronic
988791882 5:34616077-34616099 CTGGTACCCAGAGGGAGGAGAGG + Intergenic
990321348 5:54632660-54632682 CCAGGCCAGGGAGGGATGAGGGG + Intergenic
990370736 5:55115584-55115606 CTAGGAGAATGAGGGAGGAAAGG + Intronic
990726425 5:58760022-58760044 CTAGGTCAGGGAGACAGGAGAGG - Intronic
992265004 5:75009736-75009758 CGTGGATACGGAGGGAAGAGAGG + Intergenic
992484334 5:77180632-77180654 CTAGGACACGCAGGGACTAAGGG - Intergenic
994277985 5:97862829-97862851 CCAGGACAAAGATGGAGGAGGGG - Intergenic
994758110 5:103819325-103819347 GTAGGAAACTGAGGCAGGAGAGG + Intergenic
995603562 5:113825823-113825845 CTAAGGCACGGAGGCAGGATAGG + Intergenic
997639623 5:135440124-135440146 CAAGGCCACGAAGGGAGGGGTGG + Intergenic
998012346 5:138705328-138705350 CCAGGACAAAGAGGGAGGTGGGG + Intronic
998259588 5:140619390-140619412 CTTGGGCACGGAGGAAGGTGGGG + Intergenic
998799655 5:145856447-145856469 CCAGGACACTGGGAGAGGAGAGG - Intergenic
998914231 5:146996834-146996856 GTGGGACATGGAGTGAGGAGAGG - Intronic
999395280 5:151223249-151223271 GAAGGACAGGAAGGGAGGAGAGG + Intronic
999434709 5:151554325-151554347 GGAAGCCACGGAGGGAGGAGTGG - Intronic
1000349093 5:160338870-160338892 CTTGGACCCGGAGGTAGAAGTGG - Intronic
1001328989 5:170749081-170749103 CTCGGGGAGGGAGGGAGGAGAGG - Intergenic
1002001285 5:176197586-176197608 CTTGGGCACAGAGGGAGGTGGGG - Intergenic
1002253054 5:177941383-177941405 CTTGGGCACAGAGGGAGGTGGGG + Intergenic
1002762170 6:210491-210513 GTGGGAGACTGAGGGAGGAGAGG - Intergenic
1004566292 6:16801184-16801206 GTAGGACTGGGAGGGAGGAGAGG + Intergenic
1005104228 6:22205928-22205950 CTGGGAGAGGGAGTGAGGAGTGG + Intergenic
1006452565 6:34113590-34113612 GTGGGACTCGGAGGGAGGATGGG + Intronic
1006463423 6:34177203-34177225 GTGGGCCAGGGAGGGAGGAGGGG - Intergenic
1006478950 6:34276360-34276382 CTAGGACACAGAGGGAGACCTGG - Intergenic
1006670906 6:35729083-35729105 CCAGGACAGGCGGGGAGGAGTGG + Intergenic
1006856403 6:37136497-37136519 TTTGGAAAGGGAGGGAGGAGGGG + Intergenic
1006963822 6:37961490-37961512 CTAGGACACTGAGCGAACAGAGG + Intronic
1007111217 6:39314359-39314381 CTAGGACCCGGTGGGAGGGAAGG + Exonic
1007472341 6:42099079-42099101 CAAGGGGAAGGAGGGAGGAGTGG + Intergenic
1008475523 6:51931852-51931874 AAAGGAGAGGGAGGGAGGAGAGG + Intronic
1010470063 6:76217001-76217023 CTAGAACATAAAGGGAGGAGAGG - Intergenic
1013419914 6:109958105-109958127 CTAAAACAGGGAGGGAGGAAGGG + Intergenic
1014957862 6:127643171-127643193 CTTGGGCACGAAGGGAGGTGTGG - Intergenic
1017067967 6:150547718-150547740 AGAGGAAAGGGAGGGAGGAGGGG + Intergenic
1017474207 6:154771732-154771754 CTAGAAGAGGGAGGGAGGAAGGG + Intronic
1018089453 6:160333147-160333169 GTAGGAGAAAGAGGGAGGAGAGG + Intergenic
1018587263 6:165375052-165375074 CAAGGACAGGGAGGGAGATGGGG - Intronic
1018712689 6:166508134-166508156 CTGGGACTCGAGGGGAGGAGGGG - Intronic
1019340859 7:508167-508189 CTAGGCCCCGGAGGGAGATGGGG - Intronic
1020080029 7:5282208-5282230 GAAGGAGAGGGAGGGAGGAGGGG + Intronic
1020896234 7:13943999-13944021 GTAGGAAATGGAGGGTGGAGAGG + Intronic
1021411857 7:20337950-20337972 CAAGGACACTGATGCAGGAGAGG + Intronic
1022546493 7:31193970-31193992 CTTGAACACAGAGGGAGGGGTGG + Intergenic
1022547129 7:31200131-31200153 CTAGGAAAGGGAGGTGGGAGAGG - Intergenic
1024470574 7:49765745-49765767 CTAGGACACTGAGGGAGCACAGG - Intergenic
1024604607 7:51013470-51013492 CAAGGACAGGGAGGGAAGAGGGG - Intergenic
1025040363 7:55638070-55638092 CTAGTACTCGGAGGGGGAAGGGG + Intergenic
1025198887 7:56950008-56950030 GAAGGAGAGGGAGGGAGGAGGGG - Intergenic
1025673059 7:63626925-63626947 GAAGGAGAGGGAGGGAGGAGGGG + Intergenic
1026136287 7:67664180-67664202 CTCGGGCACAGAGGGAGGTGGGG - Intergenic
1026707872 7:72711071-72711093 CTGGGGCACAGAGGGAGGTGAGG + Intronic
1026960506 7:74404603-74404625 CAAGGTCACGGTGGGAGGTGAGG - Exonic
1027232556 7:76281399-76281421 ACAGGGCACGGAGGGGGGAGAGG - Intronic
1028255961 7:88597979-88598001 CAAGGATAGGGAGGGAGGAAGGG + Intergenic
1028342686 7:89741752-89741774 CTAGGCCAAGGAGAGAGGAAAGG - Intergenic
1029270404 7:99374179-99374201 CGAGGACACGGAGGGCCAAGGGG + Intronic
1029367679 7:100127165-100127187 CGAGGACGCCGAGGGAGGGGCGG + Intronic
1032130785 7:129225462-129225484 CTAGGAGAGGAAGGGAGGGGAGG + Intronic
1034207550 7:149330848-149330870 CTAGTACAGGAAGGCAGGAGGGG + Intergenic
1034491179 7:151393858-151393880 TAAGGACACGGAGGGAGGGCCGG + Intronic
1034738130 7:153447769-153447791 CTGGGACAGGGAGAGGGGAGGGG - Intergenic
1036604510 8:10293733-10293755 GAAGGAAAGGGAGGGAGGAGAGG - Intronic
1036646189 8:10612508-10612530 CGAGGGCCCGGAGTGAGGAGGGG - Exonic
1037592096 8:20321713-20321735 TTGGGACACTGAGGCAGGAGAGG - Intergenic
1037876489 8:22551415-22551437 CCAGGACAAGGGGGCAGGAGTGG - Intronic
1038340579 8:26682057-26682079 CTAGGACAAGCAGGCAGGAGTGG - Intergenic
1040831468 8:51681604-51681626 CTGAGACAGGGTGGGAGGAGAGG - Intronic
1040920214 8:52607713-52607735 CTTGGGCACAGAGGGAGGTGAGG - Intergenic
1042494425 8:69440335-69440357 GGAGGACAGGAAGGGAGGAGAGG + Intergenic
1042925786 8:73967229-73967251 CCAGGATACGGGTGGAGGAGAGG - Intronic
1048533716 8:135273616-135273638 CTGGGGAAAGGAGGGAGGAGAGG - Intergenic
1049159349 8:141087413-141087435 CTGGGCCACAGAGGCAGGAGTGG - Intergenic
1049199782 8:141334426-141334448 CTGGGACAGAGAGGGACGAGGGG - Intergenic
1049280362 8:141741068-141741090 GTGGGCCACGGAGGCAGGAGCGG - Intergenic
1049381466 8:142318506-142318528 CTGGGGCTGGGAGGGAGGAGAGG - Intronic
1049403132 8:142439797-142439819 CTAGAACAGGGAGGGAAGAAAGG - Intergenic
1049403144 8:142439846-142439868 CTAGAACAGGGAGGGAAGAAAGG - Intergenic
1049930787 9:454607-454629 CTAGGACAAGGAGGAAAGATTGG + Intronic
1050256259 9:3795310-3795332 CTAGGAGGTGGAGGGTGGAGAGG - Intergenic
1053013224 9:34647214-34647236 CCAGGACACAGAGGGTTGAGAGG - Exonic
1056625275 9:88248256-88248278 CCAGGACATTGAGTGAGGAGGGG + Intergenic
1056745173 9:89295488-89295510 CTCGGGCACAGAGGGAGGTGAGG + Intergenic
1057337332 9:94166280-94166302 CCAGGACCCGGATGGAGGCGCGG - Intergenic
1057794830 9:98147954-98147976 AAAGGACACAGAGGCAGGAGTGG + Intronic
1057861211 9:98642245-98642267 CGAGGAGACTGAGGAAGGAGAGG - Intronic
1057914951 9:99048219-99048241 GTAGGACCCAGAGGGAGTAGGGG + Intronic
1058453969 9:105122047-105122069 CTAGGGCACAGAGGGAGGTTAGG - Intergenic
1058890382 9:109355972-109355994 CAAGGAGGCGGAGGAAGGAGTGG + Intergenic
1059277721 9:113109725-113109747 CAAGGACACTGAGGGAACAGTGG + Intergenic
1059278530 9:113114826-113114848 CAAGGACACTGAGGGAACAGTGG - Intergenic
1059335809 9:113567718-113567740 CTGGGCCATGGAGGGTGGAGGGG + Intronic
1059622878 9:116027846-116027868 CTAGGAAAAGGAGCCAGGAGGGG + Intergenic
1059651931 9:116323085-116323107 CAGGGAGACGGAGGGAGAAGAGG - Intronic
1060222970 9:121774143-121774165 CTGGGACACGGTGGGAAGAGGGG - Intronic
1060401623 9:123353072-123353094 CTCAGACACAGAGGGAGCAGGGG + Intergenic
1060877002 9:127090699-127090721 ATAGGAAATGGAGGCAGGAGGGG + Intronic
1061828220 9:133274947-133274969 CTGGGACCCGCAGGGAGGATGGG - Intronic
1061992480 9:134167034-134167056 CACGGACACTGAGGGAGGGGAGG + Intergenic
1062173538 9:135148454-135148476 CTGGGACACTGAGGGATGGGAGG - Intergenic
1062262208 9:135668434-135668456 CTTGGACCAGGAGGGAGCAGTGG - Intergenic
1062270145 9:135704555-135704577 GTAGGACAGGGAGGGACCAGTGG + Intronic
1062636384 9:137493759-137493781 CCAGGACAAAGATGGAGGAGTGG + Intronic
1185448563 X:271234-271256 CCAGGACACAGAGGGAGGAAGGG + Intergenic
1185448699 X:271780-271802 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185448724 X:271878-271900 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185448804 X:272221-272243 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185448817 X:272270-272292 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185449336 X:274380-274402 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185449360 X:274478-274500 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185449431 X:274772-274794 CCAGGACACGGAGGAAGGGCCGG + Intergenic
1185485828 X:481458-481480 GAAGGAGACGGAGGAAGGAGAGG + Intergenic
1185485859 X:481572-481594 GAAGGAGACGGAGGAAGGAGAGG + Intergenic
1185485876 X:481627-481649 GAAGGAGACGGAGGAAGGAGAGG + Intergenic
1185485893 X:481682-481704 GAAGGAGACGGAGGAAGGAGAGG + Intergenic
1185485969 X:481941-481963 GAAGGAGACGGAGGAAGGAGAGG + Intergenic
1185916656 X:4043027-4043049 CTAGAGCAGGGAGGGAGGTGAGG - Intergenic
1186271265 X:7890871-7890893 CTAGAAGGGGGAGGGAGGAGAGG + Intergenic
1187327866 X:18308331-18308353 GAAGGACAGGGAGGGAGGAAAGG + Intronic
1187726630 X:22209808-22209830 GGAGGAGACAGAGGGAGGAGAGG - Intronic
1189763234 X:44343694-44343716 CGGCGTCACGGAGGGAGGAGGGG + Intergenic
1189904174 X:45741110-45741132 CTAACACAAGGAGGGAGCAGTGG - Intergenic
1190126794 X:47712828-47712850 CTTGGGCACAGAGGGAGGAGCGG + Intergenic
1193338410 X:80317930-80317952 CTAAGGCACAGAGGGAGGTGGGG + Intergenic
1193756719 X:85418308-85418330 CGAGGACAGGGAGGGATGAGTGG - Intergenic
1198930275 X:141850219-141850241 CTAGAGCAGGGAGGGAGGAAGGG + Intronic
1200102258 X:153694032-153694054 CTGGGACAGGGAGCCAGGAGGGG + Intronic
1200375625 X:155776739-155776761 GTAGTACACGGGGGGAAGAGGGG + Exonic