ID: 980988454

View in Genome Browser
Species Human (GRCh38)
Location 4:139718048-139718070
Sequence TTTCTGATGAGTAGGGATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980988449_980988454 7 Left 980988449 4:139718018-139718040 CCTCCACCTCTCTGGGATTTTAT 0: 1
1: 0
2: 0
3: 25
4: 280
Right 980988454 4:139718048-139718070 TTTCTGATGAGTAGGGATGATGG 0: 1
1: 0
2: 0
3: 27
4: 351
980988451_980988454 1 Left 980988451 4:139718024-139718046 CCTCTCTGGGATTTTATATTTGT 0: 1
1: 0
2: 1
3: 34
4: 428
Right 980988454 4:139718048-139718070 TTTCTGATGAGTAGGGATGATGG 0: 1
1: 0
2: 0
3: 27
4: 351
980988450_980988454 4 Left 980988450 4:139718021-139718043 CCACCTCTCTGGGATTTTATATT 0: 1
1: 0
2: 4
3: 34
4: 386
Right 980988454 4:139718048-139718070 TTTCTGATGAGTAGGGATGATGG 0: 1
1: 0
2: 0
3: 27
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980988454 Original CRISPR TTTCTGATGAGTAGGGATGA TGG Exonic
901144970 1:7058579-7058601 TGTTTAATGAGTAGGGAGGAGGG + Intronic
904042036 1:27590718-27590740 ATTGTGATGAGTAGGGCGGAGGG - Intronic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905332474 1:37215305-37215327 TTTGTGATGATTAGAGATGTTGG - Intergenic
905839813 1:41165626-41165648 TCTCTGATGATTAGAGATGTTGG + Intronic
906446192 1:45900421-45900443 TCTCTGATGATTAGTGATGTTGG + Intronic
906838745 1:49112854-49112876 TTTCTTATGAATAGCTATGAGGG - Intronic
907019130 1:51048129-51048151 TCTCTGATGATTAGTGATGATGG + Intergenic
907301429 1:53489149-53489171 GTTCTGAAGAGCAGGGATGAAGG - Intergenic
907647003 1:56254301-56254323 TTCCTGCTGATTAGGGGTGATGG + Intergenic
910209727 1:84780593-84780615 TTTCTTATGGGGAGAGATGAAGG - Intergenic
911679461 1:100698180-100698202 TCTCTGATGATCAGTGATGATGG + Intergenic
911967321 1:104385070-104385092 ATTCTGATGTGTAGGGAAGGGGG - Intergenic
912875277 1:113351567-113351589 TTTCTGAAGAGCAGGGAGAAAGG - Intergenic
914414135 1:147462694-147462716 TCTCTGATGACTAAGGATGTTGG + Intergenic
915069278 1:153252680-153252702 GTTCTGAAGGGTAGGGATCAAGG - Intergenic
915873760 1:159590090-159590112 TTTCTGGTGAGGTGGTATGATGG + Intergenic
916296372 1:163224777-163224799 TCTCTGATGATTAGTGATGTAGG + Intronic
917069344 1:171132928-171132950 TTCCTGATGATTAGTGATGTTGG - Intergenic
917116297 1:171607316-171607338 TTTCTGATAAGTACAGATGCTGG - Intergenic
917271994 1:173286989-173287011 TCTCTGATGACTATGGATGCTGG - Intergenic
917438132 1:175041593-175041615 TCCATGATGAGTAGTGATGATGG - Intergenic
918085895 1:181245018-181245040 CTTCAGAAGAGTTGGGATGAGGG - Intergenic
918534893 1:185563190-185563212 TTTCTGTTGATCAGGGATTACGG + Intergenic
918830590 1:189392242-189392264 TTTCTAATGATTAGTGATGATGG - Intergenic
918980053 1:191545895-191545917 TTTCTGATGATTAGTAATGTGGG - Intergenic
919400553 1:197111334-197111356 TTTCTGATGTTTAGTGGTGATGG - Intronic
920293863 1:204943948-204943970 TTTCTGATTGGTAGTGGTGAAGG + Intronic
921440172 1:215176232-215176254 TCTCTGATGATTAGTGATGTGGG + Intronic
921999532 1:221461865-221461887 TTCCTGGTGAGAAAGGATGAAGG - Intergenic
924427118 1:243962070-243962092 TTTCTGAAGATTGAGGATGAGGG + Intergenic
924592624 1:245418072-245418094 ATGCTGTTGAGTGGGGATGACGG + Intronic
1062964597 10:1597524-1597546 TCTCTGATGGTTAGTGATGATGG - Intronic
1066193441 10:33076815-33076837 TTTGTGAAGAATAGGGGTGAAGG - Intergenic
1066242888 10:33555144-33555166 TTTCTGATGATTACCGTTGAAGG - Intergenic
1066538415 10:36417106-36417128 TTTCTGTTGATTTGGGATAATGG - Intergenic
1066645469 10:37603291-37603313 TTTCTGTTGACTTGGGATAATGG - Intergenic
1067345579 10:45436008-45436030 TCTCTGATGATTAGTGATGTTGG + Intronic
1067579028 10:47428326-47428348 TCTCTGATGACCAGTGATGATGG + Intergenic
1068210515 10:53914017-53914039 TCTCTGATGACCAGTGATGATGG - Intronic
1070226289 10:74510300-74510322 TCTCTGATGATTAGTGATGTTGG + Intronic
1070666032 10:78344184-78344206 TTTCTTAGGGGTAGGGATGCAGG - Intergenic
1073211899 10:101810861-101810883 TTTTTGTTTAGTAGAGATGAGGG + Intronic
1073602171 10:104857298-104857320 TTTCTGTGGAGTAGAGAGGAAGG + Intronic
1074207219 10:111293617-111293639 TTTCATATGAGAAGGGGTGATGG - Intergenic
1074210357 10:111327315-111327337 TTTCTAATGATTAGTGATGTTGG - Intergenic
1074228789 10:111513401-111513423 TGTCAGCTGAGTAGGGAAGAGGG + Intergenic
1075179648 10:120198521-120198543 TCTCTGATGATTAGTGATGTGGG + Intergenic
1075359931 10:121822041-121822063 TTCCTGATGAATAGAGATGTGGG - Intronic
1076211534 10:128650136-128650158 TCTCTGATGATTAGTGATGTTGG - Intergenic
1076699344 10:132262845-132262867 TCTCTGATGATTAGTGATGTGGG - Intronic
1078460225 11:11509666-11509688 TTTCTGATGAGATGTGCTGAGGG - Intronic
1079853982 11:25576903-25576925 TTACTGCTGAGTTGGGAAGAAGG + Intergenic
1080138344 11:28884927-28884949 TTTCTGATGACCAGTGATGATGG - Intergenic
1081134721 11:39426071-39426093 TTTCTGATAATTAGTGATGTGGG - Intergenic
1081319543 11:41674625-41674647 CTTCAGAGGAGTAGTGATGAAGG - Intergenic
1081835793 11:46152698-46152720 TCTCTGATGATTAGCGATGCTGG + Intergenic
1082637092 11:55609738-55609760 TTTCTGATGATCAGTGATGTTGG + Intergenic
1083201323 11:61122799-61122821 TCTCAGATGAGCAAGGATGACGG + Intronic
1083610734 11:64003009-64003031 TTTCTGCTGACTTGGGGTGAGGG - Intronic
1085656360 11:78318804-78318826 TTTCTGGTGAGAAGGGGTGGTGG - Intronic
1085979028 11:81699430-81699452 TCTCTGATGAGTAGTGAGGGTGG - Intergenic
1086553550 11:88082639-88082661 TTTCTGATGAATGGAGATGTGGG - Intergenic
1086806805 11:91254028-91254050 TTTCTGATCAGTAGGACTTAAGG - Intergenic
1087804152 11:102537733-102537755 TTACTGGTGAGTAGGGAGTAGGG + Intergenic
1088156945 11:106817749-106817771 TATCTGATGATTAGTGATGTTGG - Intronic
1088651816 11:111964223-111964245 TCTCTGTTGACCAGGGATGAGGG - Intronic
1090680986 11:129057256-129057278 TCTCTGATGAGTAGGGAGTAGGG - Intronic
1091424799 12:378213-378235 GTTCTGAGGAGTAGGAATGGGGG + Intronic
1092102113 12:5892587-5892609 TTTCTCATGAGGAGCCATGAAGG + Intronic
1092397905 12:8144711-8144733 TCTCTAATGATTAGTGATGATGG - Intronic
1093048146 12:14475376-14475398 TTTCTCATGATTTTGGATGATGG + Intronic
1093589750 12:20887457-20887479 TCTCTGATGATTAGTGATGTTGG + Intronic
1093603396 12:21058911-21058933 TCTCTGATGATTAGTGATGTTGG + Intronic
1093978025 12:25444503-25444525 TTTCTGATGATTAGTGATGTTGG + Intronic
1095911908 12:47436171-47436193 TTTCTGATGATTAGAGATATTGG - Intergenic
1095923125 12:47551077-47551099 TTTCTGCTGGTTAGAGATGAAGG + Intergenic
1096055782 12:48650763-48650785 TTTCTCAAGAGAAAGGATGAGGG + Intergenic
1096115935 12:49055057-49055079 TTTGTGTTAAATAGGGATGATGG - Intronic
1098621075 12:72599459-72599481 TCTCTGATGATTAGTGATGTGGG + Intronic
1099431784 12:82594680-82594702 ATACTGATGAGTAGTAATGAAGG + Intergenic
1100294221 12:93245783-93245805 TTTCAGATGAGAAGGTATGGAGG - Intergenic
1100567396 12:95810593-95810615 TTTCAGAAGAGAAGGAATGAAGG + Intronic
1101203302 12:102459544-102459566 TGTCTGAAGAGTTGGGTTGATGG + Intronic
1101294967 12:103412704-103412726 TCTCTGATGATTAGTGATGCTGG + Intronic
1101847909 12:108378009-108378031 TCTCTGATGATTAGTGATGTTGG - Intergenic
1102022528 12:109694047-109694069 CTTCTGGGGAGTAGGAATGAAGG + Intergenic
1102344925 12:112153427-112153449 TTTCTAATGGGGAGGGCTGAGGG + Exonic
1103496076 12:121363269-121363291 TTTCTGAAGGGTATGAATGAAGG + Intronic
1104876741 12:132040122-132040144 TTCCTGATGATTAGTGATGCTGG - Intronic
1104956664 12:132469999-132470021 TTCCTGATGATTAGTGATGCTGG - Intergenic
1105939025 13:25130384-25130406 TTTATTATAAGTTGGGATGAAGG - Intergenic
1107192618 13:37607758-37607780 TCTCTAATGAGCAGTGATGATGG - Intergenic
1107890584 13:44910796-44910818 TTTCTTTTCAGTAGAGATGAAGG - Intergenic
1108488824 13:50957844-50957866 GCTCTGATGATTAGTGATGATGG + Intronic
1109031432 13:57194765-57194787 TTTCTGATGATCAGTGATGCTGG + Intergenic
1110303932 13:73962566-73962588 TTGCGTATGTGTAGGGATGAGGG + Intronic
1110693753 13:78462470-78462492 TATCTGATGATTAGTGATGTTGG + Intergenic
1111000344 13:82171060-82171082 TCTCTGATGATTAGTGATGTTGG - Intergenic
1111446976 13:88359246-88359268 TTTCTGATGATTAGTGGTGTTGG - Intergenic
1111717670 13:91899922-91899944 TTTGTGATAATTAGGTATGATGG + Intronic
1111861592 13:93714336-93714358 ACTCTGATGACTAGTGATGATGG - Intronic
1113278543 13:108762569-108762591 TCTCTGATGATTAGTGATGTTGG + Intronic
1114713723 14:24803886-24803908 TCTCTGCTGAGGTGGGATGAGGG - Intergenic
1115004443 14:28465152-28465174 TCTCTGATGATTAGTGATGGTGG + Intergenic
1115041716 14:28938647-28938669 TCTCTGATGACCAGTGATGATGG + Intergenic
1115634857 14:35281396-35281418 TTTCTGTTAAGTGGGGAAGATGG + Intronic
1115863505 14:37715651-37715673 TTTCTCATGAGAAGTGATGGAGG + Intronic
1116081421 14:40178339-40178361 TTTCTGATGATTAATGATGTTGG + Intergenic
1117423138 14:55567764-55567786 TTTCTGATGATTAGTGATACTGG + Intronic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1120131671 14:80815318-80815340 TCTCTGATGATTAGTGATGTTGG - Intronic
1120585532 14:86307592-86307614 TTTGTGATGAGGAGTTATGAAGG - Intergenic
1122185724 14:99993414-99993436 TATCTGATGAATACCGATGAAGG - Intronic
1122420008 14:101569980-101570002 TTCCTGATGATTAGTGATGTGGG - Intergenic
1124572356 15:30876211-30876233 TTTCTGGTGATTGGTGATGATGG + Intergenic
1127212583 15:56789332-56789354 TTTCTAATGACCAGTGATGATGG - Intronic
1129093973 15:73183159-73183181 TCTCTGTGGTGTAGGGATGAAGG + Intronic
1129485773 15:75870737-75870759 TTTCTTTTGAGGAGGGTTGATGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130816897 15:87445953-87445975 ATACTGATGAGGAGGCATGAAGG - Intergenic
1131333075 15:91520526-91520548 TTTCTGCTGAGTAGGACTGTTGG - Intergenic
1132565945 16:623052-623074 TGTCTGAGGAGTAGGGGTTACGG - Intronic
1133552169 16:6867261-6867283 TTTCTGATGAGCATGGATGGAGG + Intronic
1133686749 16:8172313-8172335 TTGATGATGAGTTAGGATGAAGG + Intergenic
1137737928 16:50738817-50738839 TCTCTTTTGAGTAGAGATGAGGG - Intergenic
1137980770 16:53067632-53067654 TTTCTCATGATTAGGGTTGTGGG + Intronic
1138981400 16:62273128-62273150 TTTCTTATGAGTGGTGAGGAGGG + Intergenic
1139744550 16:69063688-69063710 TTTTTAATGAGTAGTGAGGATGG + Intronic
1142135938 16:88452118-88452140 TTTCTTATGAGTACGGGGGATGG + Intergenic
1142523476 17:521059-521081 ATTTTGAAGAGTAGGGATGAGGG - Intronic
1143297602 17:5883161-5883183 TTGCTGATGAGTTGGGGTGTAGG - Intronic
1144958558 17:19032121-19032143 TTTCTGACCAGGAGGGAAGATGG - Intronic
1144976602 17:19142403-19142425 TTTCTGACCAGGAGGGAAGATGG + Intronic
1146158601 17:30546332-30546354 TGTCTAATGATTAGTGATGATGG + Intergenic
1147231088 17:39018426-39018448 TTTATGATGAGCAGGGGTGGAGG + Intergenic
1148578497 17:48727685-48727707 TTGCTGTTGAGTGGGGATCAGGG - Intronic
1148902163 17:50886511-50886533 TTTCTGAAGAGCAGGCAGGAGGG + Intergenic
1150693566 17:67385017-67385039 TTTCTGTTGAGAAGGGACCAAGG + Intronic
1152664964 17:81562573-81562595 TCTCTGATGATTAGTGATGTTGG - Intronic
1153974165 18:10252328-10252350 CTTCTGATGAGTAGGTATAGAGG + Intergenic
1155550645 18:26961598-26961620 TTTTTAATGTGTAGAGATGAAGG + Intronic
1155899301 18:31368404-31368426 TCTCTGATGATTAGTGATGTTGG - Intergenic
1156301188 18:35837638-35837660 TTTCTGACGAGGATGGATGTCGG - Intergenic
1156583246 18:38403880-38403902 TCTCTGATGAGTAGTGATGCAGG + Intergenic
1156613605 18:38756468-38756490 TTTCTGAATAATAGAGATGAAGG + Intergenic
1156683022 18:39614087-39614109 TTTCTAATGAGTATGTTTGAAGG + Intergenic
1158551479 18:58439749-58439771 TCTCTGATGATCAGGGAAGAGGG + Intergenic
1158750766 18:60257392-60257414 TCTCAGATGATTAGTGATGATGG - Intergenic
1159377487 18:67612396-67612418 TTTCTGATGATTAGCAATGTTGG - Intergenic
1159719113 18:71863771-71863793 TTTCTGATTATTAGTGATGTTGG + Intergenic
1160017567 18:75156393-75156415 TTTCAGATGTGGAGGGTTGATGG - Intergenic
1160125040 18:76164074-76164096 TTCCTGATGGTTATGGATGAAGG + Intergenic
1160247035 18:77167081-77167103 TCTGTGTTGAGAAGGGATGAAGG + Intergenic
1160570115 18:79810306-79810328 TTTCTGATCAGTGGGGAGGGGGG + Intergenic
1164860823 19:31560962-31560984 TTTATGCTCAGTAGGGATGCGGG + Intergenic
1164991617 19:32688619-32688641 TTTCTGTTGATCAGGGATTAGGG - Intergenic
1165687667 19:37836175-37836197 TTTCTGATTAAGAGAGATGAGGG - Intergenic
1165770296 19:38376034-38376056 TTCCTCATGAGTCTGGATGATGG + Intronic
1166669311 19:44700577-44700599 ATTCTGATAAATAGAGATGATGG - Intronic
1167116114 19:47489936-47489958 TTTCTGATGAATAGGGCAGCAGG - Intronic
1167665591 19:50821307-50821329 TGTGTGTTTAGTAGGGATGAGGG + Intronic
925381971 2:3434760-3434782 TTTTTGATGAATTGGGATTAGGG + Intronic
925762280 2:7196859-7196881 TCTCTGATGATTAGTGATAAGGG + Intergenic
926149608 2:10417572-10417594 TTTCTTATGAGTACGTAAGATGG + Intronic
927146972 2:20172558-20172580 TTTCTGAGGCTTAGGGATGCGGG - Intergenic
928342645 2:30458501-30458523 TTTTGGATGAGTAGGGAGGTAGG + Intronic
929020606 2:37548612-37548634 TATCTGCTGGGTAGAGATGAGGG + Intergenic
929267615 2:39936876-39936898 TTTCTAATGAGTAGTGATGTTGG - Intergenic
930293063 2:49519856-49519878 TATCTGATGACCAGTGATGATGG - Intergenic
930531013 2:52588340-52588362 TCTCTAATGACTAGTGATGATGG + Intergenic
932360869 2:71104484-71104506 TTCCTGATGATTAGTGATGTTGG - Intergenic
932949938 2:76281243-76281265 TGTCTGCTGAGTAAGGATAAGGG + Intergenic
936791436 2:116157808-116157830 TTTCTGCTGATTAGGAGTGATGG + Intergenic
937278503 2:120701854-120701876 TGGCTGTTGAGTAGGGCTGAGGG - Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
941127776 2:161607098-161607120 TTCCTAATGACTAGGGATGTTGG + Intronic
941212205 2:162654400-162654422 TCTCTGATGATTAGTGATGTTGG - Intronic
941234294 2:162950011-162950033 TCTCTGATGATTAGTGATGTTGG - Intergenic
942065313 2:172265442-172265464 TCTCTGATGACCAGTGATGATGG + Intergenic
943617060 2:190104890-190104912 TCTCTGATGATTAGTGATGTGGG - Intronic
944972239 2:205006549-205006571 TCTCTGATGATTAGTGATGTTGG + Intronic
947718735 2:232354901-232354923 TTCCTGCTGATTAGGGATGTAGG + Intergenic
947891439 2:233625192-233625214 TCTCTGATGATTAGTGATGTTGG - Intronic
1169555304 20:6743281-6743303 ACTCTGAGGAGTAGGGAAGAAGG - Intergenic
1171335241 20:24379680-24379702 TTTCTGATGAGTGGGAATGTTGG - Intergenic
1171509501 20:25669866-25669888 TTTCTGAGGTGCAGGGATGTTGG + Intergenic
1171936325 20:31278311-31278333 GATCTGATGAGTAGGGCTGCTGG + Intergenic
1173424205 20:42928578-42928600 TTTCTGATGAGTAGGCCAGGAGG + Intronic
1174411692 20:50340669-50340691 TTTGTGGTGAGAAGGGAAGAAGG + Intergenic
1174469585 20:50746763-50746785 TTTCCCATGAGTAGGTATGTAGG + Intronic
1177043344 21:16140115-16140137 CTTCTGATAAGGAGGGCTGACGG + Intergenic
1177768946 21:25493195-25493217 TCTCTGATGATTAGTGATGATGG - Intergenic
1178441959 21:32605542-32605564 TTTTTGTTCAGTAGGCATGATGG - Intronic
1179958077 21:44752119-44752141 TTGCTGGTGAGTCGGGTTGAGGG - Intergenic
1181156175 22:20922550-20922572 TTGCTGGTGGGTGGGGATGAAGG + Intronic
1181557839 22:23682071-23682093 TTTGTGATGATTAGTGATGTGGG - Intergenic
1181889633 22:26050817-26050839 TTGCTTATGAGTAGTGATGAGGG + Intergenic
1183814489 22:40288380-40288402 TTTCAGCTGAGTAGTGATGTAGG + Intronic
1184481427 22:44750210-44750232 TCTCTGATGATTAGTGATGTTGG - Intronic
949404351 3:3698759-3698781 TTTCTGTTGAGTGGCGATCATGG + Intergenic
950433556 3:12965695-12965717 CTTCTAATGAGAAGGGATGTGGG + Intronic
950838497 3:15943528-15943550 TCTCTGATGATTAGTGATGTGGG - Intergenic
951531629 3:23703702-23703724 TTTGTTATGAGAAGGGAGGAAGG - Intergenic
952630483 3:35459611-35459633 ATTCTGGTGAGGATGGATGAAGG + Intergenic
953069755 3:39507370-39507392 TTTCTGATGGGAAGGGGTGCAGG + Intronic
953408569 3:42673570-42673592 CCCCTTATGAGTAGGGATGAAGG - Intergenic
953760827 3:45685563-45685585 TTGCTAATTAGTAGGGGTGAGGG + Exonic
954009946 3:47627307-47627329 TTCCTCATGACTAGAGATGATGG - Intronic
955719342 3:61865092-61865114 TTGCTGATTAATGGGGATGATGG + Intronic
956565843 3:70637785-70637807 TCCCTGATGATTAGGGATGTTGG + Intergenic
956857710 3:73292195-73292217 TTTCTGATGAGGAGGATTAACGG + Intergenic
956865988 3:73369196-73369218 TCTCTGATGGCCAGGGATGATGG + Intergenic
957377149 3:79372583-79372605 TTTCTGAGGGGTAGGGGGGAAGG - Intronic
957796399 3:85014605-85014627 TTTTTGAGGATTAGGGATGCAGG + Intronic
958785939 3:98596296-98596318 TTTCTGATGAGTTGGGCAGAAGG - Intergenic
959013406 3:101105548-101105570 TTCCTGATGATTAGTGATGTTGG - Intergenic
959257992 3:104038820-104038842 TCTCTGATGATTAGTGATGTTGG - Intergenic
959337664 3:105086662-105086684 TTTCTGATGTGGATGGATGAAGG - Intergenic
959684815 3:109133353-109133375 ATTCTGATAAGAAGGAATGAGGG - Intergenic
960657184 3:120018058-120018080 TTTGTGATGATGAGTGATGATGG - Intronic
960775607 3:121248381-121248403 TCTCTAATGATTAGTGATGATGG + Intronic
962480629 3:135795157-135795179 TTCCTGCTGGCTAGGGATGAAGG + Intergenic
962984936 3:140527331-140527353 TTTCTGATGATTAATGATGTTGG - Intronic
963537715 3:146548632-146548654 TTTCTGATGAATAGTGATGCTGG + Intergenic
963646200 3:147917930-147917952 TTTGTGATGAGAACTGATGAAGG - Intergenic
963678009 3:148338221-148338243 TCTCTGATGATTAGTGATGTCGG + Intergenic
964653133 3:159034224-159034246 TCTCTAATGATTAGTGATGATGG + Intronic
965505129 3:169507017-169507039 TTTCTTATGATTAGTGAAGAGGG - Intronic
966687637 3:182713286-182713308 TCTCTGATGATTAGCGATGTGGG - Intergenic
966848586 3:184149876-184149898 TTCCTGGTGAGAAGGGCTGACGG + Intronic
967635626 3:191799355-191799377 TCTCTGATGATTAGTGATGCTGG - Intergenic
969539573 4:7778615-7778637 TGGCTGATGAGGAAGGATGACGG + Intronic
970184322 4:13433562-13433584 TCTCTGATGATTAGTGATGTTGG - Intronic
970417104 4:15869915-15869937 TTTCTGATGAGGAGGGAAGCTGG - Intergenic
971310298 4:25520501-25520523 TTTCAGATAGGTAGGGATGCAGG - Intergenic
971623176 4:28883249-28883271 ATACTGATGAGTGGGGGTGAAGG - Intergenic
971772131 4:30910561-30910583 TCTCTGATGACTGGTGATGATGG - Intronic
972017823 4:34268380-34268402 TTTCTGATGATTAGAGATGTTGG - Intergenic
973884034 4:55302541-55302563 TCTCTGATGACCAGTGATGATGG - Intergenic
974531575 4:63115106-63115128 TCTCTGATGATTAGTGATGTTGG + Intergenic
974639698 4:64612248-64612270 TCTCTGATGGTTAGTGATGATGG - Intergenic
976289952 4:83407642-83407664 TTTCTGATGTGTAAGGATTCAGG - Intronic
976326537 4:83778194-83778216 GTTCTGATGAGCATGGAGGAAGG + Intergenic
977241741 4:94579134-94579156 CTTCTTATGAGTAAGGATTAAGG + Intronic
977822311 4:101488093-101488115 TTTTTGATGGGTCGGGGTGAGGG + Intronic
978253594 4:106664625-106664647 TTCCTGATGAATAATGATGATGG + Intergenic
979191296 4:117862482-117862504 TCCCTGCTGAGTAGGGATGTAGG - Intergenic
980089916 4:128432241-128432263 TCTCTGATGACCAGTGATGATGG + Intergenic
980988454 4:139718048-139718070 TTTCTGATGAGTAGGGATGATGG + Exonic
983334153 4:166371228-166371250 TCTCTGATGACCAGTGATGATGG + Intergenic
983384615 4:167043538-167043560 TTTCTCATAATTAGGTATGATGG + Intronic
983987257 4:174074074-174074096 TTTCTGGTGAGTTGGGAAAAGGG - Intergenic
984465927 4:180100631-180100653 TTAGTGATGAGTAGGGGTGTGGG + Intergenic
985513969 5:328617-328639 TCTCTGATGATTAGTGATGTGGG + Intronic
986714607 5:10513910-10513932 TCTCAGATGAGGAGGCATGAAGG + Intronic
986730118 5:10629113-10629135 TTTCGGATGAGTAGTGGGGATGG + Intronic
987277631 5:16378372-16378394 TTTCTGAGGAGGAGGGAGTAAGG - Intergenic
987404881 5:17514531-17514553 TCTCTGATGATTAGTGATGCAGG + Intergenic
987412487 5:17628258-17628280 TCTCTGATGATTAGTGATGCGGG + Intergenic
987585766 5:19854166-19854188 TGTCTCATGAGTAAGGTTGATGG - Intronic
987825636 5:23027041-23027063 TCTCTGAAGAGCAGGGCTGATGG - Intergenic
988106385 5:26754483-26754505 TCTCTGATGATTAGCGATGTGGG + Intergenic
988948666 5:36234867-36234889 TTTGGGAAGGGTAGGGATGAAGG - Intronic
989131525 5:38111917-38111939 TTCCTGATGGGTAGTGATGTGGG + Intergenic
989241616 5:39209007-39209029 TGTGTGATGAGAAGGGATGGAGG - Intronic
990280986 5:54250551-54250573 GTTCTGAGGAGTAGAAATGAAGG + Intronic
990349514 5:54901607-54901629 TTTCTGAGGAGGAGGGAGGCTGG - Intergenic
990516916 5:56539023-56539045 TTGATGATGAGAAAGGATGAAGG + Intronic
990656649 5:57964269-57964291 TCTCTGATGATTAGTGATGTTGG + Intergenic
992667557 5:79026028-79026050 TTTCTGAGGGGCAGGGTTGATGG - Intronic
993542791 5:89173100-89173122 CATCTGATGAGTAGAGATCAGGG + Intergenic
993673074 5:90785654-90785676 TCTCTGATGACCAGGGATGACGG - Intronic
994695727 5:103071236-103071258 TTTCTGATGATTAGCAATGTTGG + Intergenic
994777204 5:104049748-104049770 TTTCTGCGGAGAAGGGATGCGGG - Intergenic
994955694 5:106528626-106528648 TTTCTGATTACTTGGGATGAAGG + Intergenic
996362507 5:122665665-122665687 TTTCTGAAGAGAAGGGAGGAGGG + Intergenic
997091369 5:130862895-130862917 TTTTTGCTGAGTAGTAATGAAGG - Intergenic
998281451 5:140811737-140811759 TCTCTGATGACCAGTGATGATGG + Intronic
999705169 5:154265925-154265947 TTTCTGATGAGAGTGGAGGAAGG - Intronic
999955185 5:156693401-156693423 TTTCTGAAGTCTGGGGATGAAGG - Intronic
1002876326 6:1213776-1213798 TATTTGATGAGTTTGGATGATGG - Intergenic
1003764485 6:9219858-9219880 TCTCTGATGACCAGTGATGATGG - Intergenic
1005277631 6:24237099-24237121 TCTCTAATGATTAGTGATGATGG - Intronic
1007211978 6:40200159-40200181 TTTCTGATGATTAATGATGTTGG + Intergenic
1008863170 6:56176516-56176538 TCTCTGATGATTAGTGATGTTGG - Intronic
1009997695 6:70915143-70915165 TCTCTGATGACCAGTGATGATGG + Intronic
1010080132 6:71852023-71852045 TATCTGGTGAGTAGGGTTGATGG + Intergenic
1010843883 6:80680849-80680871 TTGCTGAGGAGTTGGGTTGATGG - Intergenic
1010893971 6:81344106-81344128 TTTCTGATGGGCAGGGGTGGGGG + Intergenic
1010979844 6:82359446-82359468 TTTCTGAGGGGCAGGGTTGATGG - Intergenic
1011704577 6:89988171-89988193 TTTGTGTTGAATAGGAATGATGG - Intronic
1011941644 6:92850098-92850120 TTTGTAATAAGTAGTGATGAGGG + Intergenic
1012502772 6:99907910-99907932 TCTCTGATGACTAGTGATGTTGG - Intergenic
1012612542 6:101233486-101233508 TTTCTGATGAGGCAGCATGACGG + Intergenic
1012624133 6:101385838-101385860 TTTCTGATGACTTTGCATGAAGG + Intergenic
1013655027 6:112237709-112237731 TGTTTGAAGAGTAAGGATGAAGG - Intronic
1014013773 6:116506267-116506289 TCTCTGATGAACAGTGATGATGG - Intronic
1015121542 6:129706485-129706507 TTTCTGATAAAGAGGGATAATGG + Intronic
1015186822 6:130426624-130426646 TCACTGATGAGTTGGCATGAAGG + Intronic
1016325461 6:142896357-142896379 TATCAGATGAGTTGGGATGCTGG - Intronic
1018714884 6:166524564-166524586 GTTCTGCTGAATAGGGATGTGGG - Intronic
1019825103 7:3278024-3278046 TCTCTGTTGAATAGTGATGATGG - Intergenic
1020875302 7:13685798-13685820 TTGCTGATGAGAAGAGATGAAGG - Intergenic
1022347773 7:29533806-29533828 TCTCTGATGACCAGTGATGATGG - Intergenic
1024297503 7:47857134-47857156 TCTCTGGTGAGCAGGGAGGATGG + Intronic
1024343738 7:48292172-48292194 TTTCAGATGAGTAAAGTTGAGGG - Intronic
1024735137 7:52296458-52296480 TTTCTGATCAGCAGGGTTCAGGG + Intergenic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1026133497 7:67639643-67639665 TCTCTGATGATTAGTGATGCTGG - Intergenic
1027886515 7:83913839-83913861 TCTCTGATGATTAGTGATGCTGG + Intergenic
1030587529 7:111439208-111439230 TTTCTGAGAAGCAGAGATGAAGG - Intronic
1031610005 7:123814621-123814643 TTTCTGACCAATAAGGATGATGG - Intergenic
1031930829 7:127684079-127684101 TTTCTGATATTTAGAGATGAGGG + Intronic
1032335833 7:131023522-131023544 TTAATGATGAGTAGGAGTGATGG + Intergenic
1032771365 7:135061131-135061153 TCTCTGATGATTAGTGATGTAGG + Intronic
1032856581 7:135838677-135838699 TTTCTGATGGATTGGGTTGAAGG + Intergenic
1033646162 7:143306200-143306222 TTTCAGATAAGCAGGGATAAAGG - Exonic
1036289140 8:7471929-7471951 TTTCTGATGCTTAGGTATCAAGG + Intronic
1036332335 8:7839598-7839620 TTTCTGATGCTTAGGTATCAAGG - Intronic
1036994635 8:13641335-13641357 TTTTTAATGAGTAGAGATGAAGG + Intergenic
1037493613 8:19418742-19418764 TTTCTGGTTTGTAGGGAAGAAGG - Exonic
1037926588 8:22848312-22848334 TTTGTGAGGAGTAGGGAGGCAGG + Intronic
1038472911 8:27840015-27840037 TTTCCCATGAGTAGGGGTTATGG - Intergenic
1039256741 8:35727006-35727028 TTTCTGGTGAGCAACGATGAGGG + Intronic
1040360884 8:46663268-46663290 TCTCTGATGATTAGTGATGCTGG + Intergenic
1040732090 8:50460221-50460243 TCTTTGATGATTAGTGATGATGG + Intronic
1042585047 8:70327623-70327645 GTTTTGATTAGTAGTGATGATGG - Intronic
1042827398 8:72992792-72992814 TTTCAGATGACTAGAGATAAAGG + Intergenic
1043021034 8:75000003-75000025 TTTCAGTTGAGTAAGTATGAGGG + Intronic
1043221801 8:77674710-77674732 TTTCTGATGAATATGCATCAGGG + Intergenic
1043290655 8:78596104-78596126 TTTCTAATGATTAGTGATGTTGG + Intronic
1044128641 8:88491727-88491749 TCTCTGATGACCAGTGATGATGG - Intergenic
1045274203 8:100687512-100687534 TTACTGATGACTAGGGATTCTGG - Intronic
1046234959 8:111411713-111411735 TGTCTAATGATTAGAGATGATGG + Intergenic
1046704750 8:117437566-117437588 TCTCTGATGACCAGTGATGATGG - Intergenic
1047472946 8:125196938-125196960 TCTCTGATGACCAGTGATGATGG + Intronic
1047535621 8:125717180-125717202 CTTCTGAAGCCTAGGGATGAGGG + Intergenic
1047963155 8:130025533-130025555 TTCTTGAAGAGAAGGGATGAAGG + Intergenic
1049423187 8:142525815-142525837 TTTCTGCAGAGTGGGGATGCAGG + Intronic
1051669250 9:19493815-19493837 GTTCCGATGAGGAGGGAAGATGG + Intergenic
1052258431 9:26486706-26486728 ATTCTGAAGAGTAGAGAAGAAGG - Intergenic
1052279545 9:26717112-26717134 TTTCTTGTGAGGAGGGAGGAAGG + Intergenic
1052605918 9:30700477-30700499 TCTCTAATGATTAGTGATGATGG + Intergenic
1052753401 9:32515712-32515734 TTTCTGTGGAATAGGGATGAAGG - Intronic
1053295412 9:36909548-36909570 TTTCTGTTGGGCAGGAATGAAGG + Intronic
1053704202 9:40733335-40733357 TCTCTGATGACCAGTGATGATGG + Intergenic
1053750546 9:41249927-41249949 TCTCTGATGATTAGTGATGTTGG - Intergenic
1054256051 9:62814270-62814292 TCTCTGATGATTAGTGATGTTGG - Intergenic
1054335256 9:63801342-63801364 TCTCTGATGATTAGTGATGTTGG + Intergenic
1054414286 9:64856941-64856963 TCTCTGATGACCAGTGATGATGG + Intergenic
1055619357 9:78107643-78107665 TTTATTAAGAGTAGGGATAATGG + Intergenic
1056395061 9:86174419-86174441 TTGCTGAGGAGTAGGCATGGGGG - Intergenic
1056533157 9:87505090-87505112 TTCCAGATGATTAGGGGTGAGGG + Intronic
1056927704 9:90848873-90848895 TTTCTGCTGCGTGGGGAGGATGG + Intronic
1058065968 9:100548538-100548560 ATTCAGATGAGTTGGGAAGATGG + Intronic
1058821982 9:108740717-108740739 TCTCTGATGACTAAGGATGTTGG - Intergenic
1059965560 9:119610150-119610172 TTTCTGATAAGAAGGAAGGAAGG - Intergenic
1060525504 9:124318559-124318581 TCTCTGATGATTAGTGATGTTGG + Intronic
1188080357 X:25831415-25831437 TCTCTGATGATTAGTGATGATGG + Intergenic
1188487842 X:30702895-30702917 TTTTTGAGGAGGAGGGATGTGGG + Intronic
1188938293 X:36204606-36204628 TATCTGATGGGTAGATATGAAGG + Intergenic
1189592765 X:42532652-42532674 TCTCTGATGATTAGTGATGTTGG + Intergenic
1190682931 X:52844215-52844237 TCTCTGATGACCAGTGATGATGG + Intergenic
1190940334 X:55034067-55034089 CTTGTGATGAGTGGGGATTAAGG + Intergenic
1191837212 X:65477160-65477182 TTCCTGATGATTAGGGGTAATGG + Intronic
1193624897 X:83806254-83806276 TCTCTGATGTCTAGTGATGATGG + Intergenic
1194125464 X:90011193-90011215 TCTCTGATGATCAGTGATGATGG + Intergenic
1194844764 X:98791509-98791531 TCTCTGATGATTAGTGATGTGGG - Intergenic
1195459038 X:105102875-105102897 TTGCTGATGGGTTGGAATGAGGG + Intronic
1195572517 X:106412407-106412429 TCTCTGATGACCAGTGATGATGG - Intergenic
1196514415 X:116552692-116552714 TTTAGGATGAGTATGGATAAAGG - Intergenic
1197494635 X:127162481-127162503 TCTCTGATGATTAGTGATGATGG + Intergenic
1199136462 X:144259299-144259321 TCTCTGAGGATTAGTGATGATGG + Intergenic
1199675360 X:150184448-150184470 TATCTGCTAAGCAGGGATGAAGG + Intergenic
1200250613 X:154551930-154551952 TTTCTGCTGGGTAAGGATGTGGG + Intronic
1201405669 Y:13647197-13647219 TCTCTGATGACCAGGGATTATGG + Intergenic
1202056781 Y:20842819-20842841 TCTCTGATGACCAGTGATGATGG + Intergenic
1202059763 Y:20874105-20874127 TTTCTAATGACTAGTGGTGATGG - Intergenic