ID: 980991343

View in Genome Browser
Species Human (GRCh38)
Location 4:139741006-139741028
Sequence AAACCCAGCTTCCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980991343_980991345 5 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991345 4:139741034-139741056 TGTGATGCTGAGGCTCTGAGAGG No data
980991343_980991346 8 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991346 4:139741037-139741059 GATGCTGAGGCTCTGAGAGGAGG 0: 1
1: 0
2: 15
3: 110
4: 702
980991343_980991344 -5 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991344 4:139741024-139741046 GGTTTGACTATGTGATGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 275
980991343_980991347 9 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991347 4:139741038-139741060 ATGCTGAGGCTCTGAGAGGAGGG 0: 1
1: 0
2: 4
3: 61
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980991343 Original CRISPR AAACCCAGCTTCCCACAGAC AGG (reversed) Intronic