ID: 980991343

View in Genome Browser
Species Human (GRCh38)
Location 4:139741006-139741028
Sequence AAACCCAGCTTCCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980991343_980991347 9 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991347 4:139741038-139741060 ATGCTGAGGCTCTGAGAGGAGGG 0: 1
1: 0
2: 4
3: 61
4: 483
980991343_980991346 8 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991346 4:139741037-139741059 GATGCTGAGGCTCTGAGAGGAGG 0: 1
1: 0
2: 15
3: 110
4: 702
980991343_980991345 5 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991345 4:139741034-139741056 TGTGATGCTGAGGCTCTGAGAGG 0: 1
1: 0
2: 5
3: 67
4: 496
980991343_980991344 -5 Left 980991343 4:139741006-139741028 CCTGTCTGTGGGAAGCTGGGTTT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 980991344 4:139741024-139741046 GGTTTGACTATGTGATGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980991343 Original CRISPR AAACCCAGCTTCCCACAGAC AGG (reversed) Intronic
902492079 1:16790170-16790192 AGACCCTGCTTCCCAGAGGCAGG - Intronic
902670416 1:17969378-17969400 GAACCCAGCTTCCATCAGAAAGG - Intergenic
903131959 1:21285275-21285297 ACACCCAGCTCCCCACAGCATGG + Intronic
903138700 1:21325997-21326019 AAAGCCCCCTTCCCACAGCCGGG - Intronic
905282150 1:36856131-36856153 AAACTCAGCTTCCCTCAGGCTGG + Intronic
905308697 1:37035163-37035185 AAGTCCAGCTTCCCACAGCAGGG - Intergenic
906216536 1:44044177-44044199 AACCACAGCTTCCCAGAGTCAGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909777377 1:79498707-79498729 GGACCAAGCTTCCCACTGACAGG - Intergenic
910179477 1:84465473-84465495 AAACACAGCTTCCAAAACACAGG + Intergenic
910939554 1:92518441-92518463 AATCCCAGATTCCCTCAGATAGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
915008603 1:152663861-152663883 AATCCCAGCTTCCCTCTGAAAGG + Intronic
915681691 1:157587463-157587485 AAACACAGCTTCCTCCAGAGCGG - Exonic
917494371 1:175526751-175526773 AAACCCAGGTGCTCACAGGCTGG - Intronic
917686632 1:177423244-177423266 AACCCCAGCTGGCCACAGAGAGG - Intergenic
918308853 1:183271043-183271065 AAGCCCAGCATTCCACAGGCTGG - Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919370722 1:196723215-196723237 AAGTCCAGTTTCCAACAGACAGG + Intronic
921159832 1:212464993-212465015 AAACACAGCTCCCCCAAGACAGG + Intergenic
922579087 1:226683768-226683790 AAAGCCAGCTACCCAAGGACAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922852505 1:228745721-228745743 AAGCCTAGCTTTCCACAGATAGG - Exonic
923218877 1:231875152-231875174 AAATTCAGCTTGCCACAGACAGG - Intronic
923528367 1:234792367-234792389 AGACCCTGCTTCCCAGAGGCAGG + Intergenic
923795031 1:237145396-237145418 CAACCCAGTTGTCCACAGACAGG - Intronic
924030386 1:239880076-239880098 AAACCCAACTCTCCAAAGACAGG + Intronic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063065098 10:2600032-2600054 AAACTCAGCCTCCCTCAGCCGGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065356377 10:24846015-24846037 CACCTCAGCTTCCCAAAGACAGG + Intergenic
1066608259 10:37205661-37205683 AAACACAGCTTCACATAGTCAGG - Intronic
1067213330 10:44279997-44280019 AAACCCAGCTTTTCATTGACAGG - Intergenic
1067539271 10:47140011-47140033 AAAACAAGGTTCCCACAGCCTGG + Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1070537843 10:77392795-77392817 AAACCCACCTCCCCAAATACTGG + Intronic
1071940626 10:90587787-90587809 AACCACAGCTTCCCACACATGGG + Intergenic
1072189866 10:93070448-93070470 CCACCCAGCTTCCAACAGACCGG + Intergenic
1074427277 10:113362633-113362655 AAACCCACCTTCGCAGGGACTGG + Intergenic
1074844458 10:117384957-117384979 ACTCCCATCTTCCCACAGCCAGG + Intergenic
1075209192 10:120476576-120476598 GTCCCCAGCTTCCCACATACTGG + Intronic
1075575297 10:123573175-123573197 TCCCCCAGCTTCCCACGGACAGG - Intergenic
1075919624 10:126199566-126199588 AGCAGCAGCTTCCCACAGACAGG - Intronic
1076163506 10:128263952-128263974 TAGCCCATCTTCCCACAGCCGGG - Intergenic
1077579500 11:3407765-3407787 GATCCCTGCTTCCCACAGCCAGG + Intergenic
1078853074 11:15181547-15181569 AAACCCAGCTCCCCACACACTGG + Intronic
1078853125 11:15181997-15182019 AAACCCAACTCCCCACACACTGG - Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1081914728 11:46723509-46723531 GCCCCCAGCTTACCACAGACAGG - Exonic
1082990722 11:59205261-59205283 AACCCCGGCTTCCCAAAGCCAGG - Exonic
1083400500 11:62419861-62419883 TAACCCAGTTCCCCAAAGACGGG - Intronic
1084019189 11:66407605-66407627 AAACCAAGCAGCCCACAGTCAGG - Intergenic
1084214639 11:67640723-67640745 CAACCCAGCATCCCCAAGACAGG - Intergenic
1084236528 11:67791303-67791325 GATCCCTGCTTCCCACAGCCAGG + Intergenic
1084722260 11:70914453-70914475 AAACCCAGCCTCGCACAGAAAGG + Intronic
1084835896 11:71801690-71801712 GATCCCTGCTTCCCACAGCCAGG - Intergenic
1086993517 11:93330876-93330898 AAGCCCAGCCTCCCGCAGAGCGG - Intronic
1088590701 11:111400116-111400138 AGGCCCAGCCTCCCACTGACTGG + Intronic
1089068080 11:115677415-115677437 AAAGGCAGCTTCCCCCAGGCAGG + Intergenic
1089156035 11:116403268-116403290 AATCACAGGTTCCCAGAGACTGG - Intergenic
1092297077 12:7209225-7209247 AAACCCAGCTTCCCAACAAATGG - Intronic
1093430907 12:19083899-19083921 AATCCCAGCTTCCCAGCTACTGG - Intergenic
1094257637 12:28451868-28451890 AAACCCAGTCTCACACAGATAGG - Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1096615195 12:52828620-52828642 AAATTCAGCTACCCACATACAGG + Intronic
1096879671 12:54657625-54657647 AAAACCAGATTCACACAGCCTGG - Intergenic
1097588608 12:61545489-61545511 AAATCAATCTTCCCTCAGACTGG + Intergenic
1099030639 12:77522245-77522267 AAACAAAGCTTCCAATAGACAGG + Intergenic
1102413847 12:112743446-112743468 AAACCCAGCTCCACACCGTCTGG + Intronic
1103848705 12:123917332-123917354 AAACCCAGGCTTCCACGGACTGG - Intronic
1103908180 12:124337998-124338020 GAACCCTGCTCCCCACAGCCAGG + Intronic
1103953458 12:124564630-124564652 AAATCTCCCTTCCCACAGACAGG + Intronic
1104476200 12:129072621-129072643 AAGCCCAGCCTCACACACACCGG - Exonic
1107295954 13:38907665-38907687 ACACCCAGATTCACTCAGACTGG - Intergenic
1108337109 13:49455204-49455226 AAGACAAGCTTCACACAGACAGG + Intronic
1111430898 13:88147154-88147176 ATACCCAGCTTTCCACATCCAGG + Intergenic
1112072831 13:95873892-95873914 AGACCCAGTTTCCCTCACACAGG - Intronic
1112545518 13:100365395-100365417 GAACCCATTTTCCCACAGAAAGG - Intronic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1118238283 14:64032008-64032030 ACACGCAGCTTCTCACAGTCAGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119732016 14:76957039-76957061 CAACACAGATGCCCACAGACAGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1122855927 14:104560030-104560052 GACCCCGGCTTCACACAGACAGG + Intronic
1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG + Intergenic
1122980147 14:105187972-105187994 ATACCCAGGTCCCCACAGTCAGG + Intergenic
1124105263 15:26731938-26731960 AAGACCAGCTTCTCACAGATAGG + Intronic
1125538999 15:40459055-40459077 AGACCCAGCTCCCAAGAGACTGG + Exonic
1126361631 15:47852445-47852467 AAACTCGACTTCCAACAGACTGG - Intergenic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1129923770 15:79343833-79343855 AAACTCTCCTTCCCACAGTCAGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131731057 15:95281882-95281904 AAGTCAAGCTTCCAACAGACTGG + Intergenic
1132113681 15:99120464-99120486 AAGCCCAGCTGCCCAGAGACGGG - Intronic
1132719924 16:1310529-1310551 AAACCGAACTCCCCAAAGACAGG - Intronic
1132986464 16:2770063-2770085 CAGCCCTGCTTCCCACACACGGG + Intronic
1133348118 16:5083825-5083847 GATCCCTGCTTCCCACAGCCAGG + Intronic
1137274823 16:46926524-46926546 CAACACTGCTTCCCACACACTGG - Intronic
1137420333 16:48327953-48327975 CTACCCAGCATCCCACAGACAGG - Intronic
1138066080 16:53942587-53942609 AAAAACAGCTGCCTACAGACTGG - Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139260134 16:65583986-65584008 ATACCCAGAATACCACAGACTGG + Intergenic
1140043967 16:71427410-71427432 AGACCCAGCTTCCAAGAGCCAGG + Intergenic
1140311021 16:73848425-73848447 AAACAGTGCTTCCCACAGCCTGG + Intergenic
1141798433 16:86290495-86290517 AAACCCAGATTCCCAGAATCTGG - Intergenic
1141948442 16:87325487-87325509 AGACCCTGCCCCCCACAGACTGG - Intronic
1141953437 16:87353840-87353862 AAACCCACTTTCTCACAGGCTGG - Intronic
1142070082 16:88087061-88087083 TCACCCATCTTCCCACAGCCCGG - Intronic
1143282782 17:5767091-5767113 ACTCCCAGCCTCCCACAAACTGG - Intergenic
1143734540 17:8901208-8901230 CAACCCAGCTTCCCAAGGAAAGG - Intronic
1144375961 17:14641776-14641798 AAACCCATCTCCTCACAGTCAGG - Intergenic
1145018412 17:19413194-19413216 AGACCCAGCTTCCCCCAGGCAGG - Intronic
1145320432 17:21764247-21764269 AAAGCCAGCTTCCCCCAGGAGGG - Intergenic
1147447259 17:40482128-40482150 AAACTCACCATCCCACAGAGAGG - Exonic
1149651034 17:58276609-58276631 AGACTCAGCTGCCCACAGCCTGG - Intronic
1149800080 17:59559142-59559164 AAACCCAGCTTGCCACCTTCAGG + Intergenic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1152912578 17:83013554-83013576 GAGCCCAGCTCCCCACAGAGTGG - Intronic
1157558443 18:48628994-48629016 AGACCCAACTTCTCAAAGACAGG - Intronic
1158327181 18:56324865-56324887 AAACACAGATTCCCATAGAAAGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160510346 18:79450004-79450026 AATCCAAGTTTCCCGCAGACAGG + Intronic
1161035800 19:2083719-2083741 AAACCCAACCTGCCACAGCCTGG + Intronic
1163669841 19:18620936-18620958 AGACCCAGCTTCTGAGAGACAGG + Exonic
1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG + Intergenic
1164785467 19:30926953-30926975 AAACCCAGCTTCCCTGCGCCTGG + Intergenic
1167038290 19:47007261-47007283 CAACCCAGCTTAGCACAGAGCGG - Intergenic
1167676229 19:50887830-50887852 ACTCCCAGCCTCCCACAGTCTGG + Intergenic
1168717802 19:58539375-58539397 ACACCCTGCTTCCCTCAGACAGG + Intergenic
1168717867 19:58539684-58539706 ACACCCCACTTCCCTCAGACAGG + Intergenic
1168718131 19:58540767-58540789 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718368 19:58541735-58541757 ACACCCCGCTTCCCTCAGACAGG + Intergenic
1168718424 19:58541966-58541988 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718566 19:58542549-58542571 AGACCCTGCTTCCCTCAGACAGG + Intergenic
925436303 2:3840880-3840902 TCACCAAGCTTCCCACTGACAGG + Intronic
926957778 2:18320242-18320264 AACCACAGCTACCCACAGTCAGG + Intronic
927037089 2:19189143-19189165 TAAGGCAGCTCCCCACAGACTGG - Intergenic
927523440 2:23716787-23716809 AAGCCCACATTCACACAGACTGG + Intergenic
928405624 2:31012266-31012288 TAACCCTGGTTCCCACACACTGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
930142337 2:47965052-47965074 AAACCCAACTTTCCACACCCAGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
935459235 2:103309370-103309392 GATCCCAGCTTCCACCAGACAGG + Intergenic
936460275 2:112709186-112709208 ACTCTCAGCTTCTCACAGACAGG + Intergenic
942902341 2:181136741-181136763 GAACCCACATTCCAACAGACAGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944186411 2:196953639-196953661 AAAGCCAGCTTCCCACCTAATGG - Intergenic
946385533 2:219382156-219382178 AAGCCCAGATTCCCAGAGTCAGG - Intronic
947095112 2:226557852-226557874 AAACCCAGCATCCAAAAGACAGG + Intergenic
947856764 2:233329296-233329318 CTCCCCAGCTTCCCACAGATGGG + Intronic
948689748 2:239694426-239694448 AAACGGTGCTTCCCACAGGCTGG + Intergenic
948915628 2:241033908-241033930 AACCCCTGCTCCCCACAGCCAGG + Intronic
1170472047 20:16677358-16677380 ACACCCATGTTCCCAGAGACAGG - Intergenic
1174079573 20:47961435-47961457 CAGCCCAGCTTCCCCCAGGCAGG - Intergenic
1175051079 20:56156161-56156183 AAACCTAACTTCCCCCAGAGAGG + Intergenic
1176193735 20:63826918-63826940 AAACCCTGCTTCCCGGAGAGTGG - Intronic
1177319509 21:19501892-19501914 AAACACAACTTCACAGAGACAGG - Intergenic
1178927260 21:36786402-36786424 AAACCCAGGTTCAGACACACTGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1181184949 22:21096555-21096577 TAACCCAGTTTCCAACAGAAGGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1184724083 22:46332958-46332980 AAACTCAGCTGCCCAGATACTGG + Intronic
1185133558 22:49055580-49055602 AACCCCAGCTTCCAGGAGACAGG - Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
951215030 3:20015638-20015660 AACCCCAGCTTCCCAGAGTGGGG + Intergenic
953625671 3:44568757-44568779 AGGCCCTGCTTCCCACAGTCTGG - Intronic
955951919 3:64251154-64251176 ATAACCAGCCTCCCTCAGACTGG - Intronic
957052473 3:75421087-75421109 GATCCCTGCTTCCCACAGCCAGG + Intergenic
960904657 3:122588044-122588066 AAATGCATCTTTCCACAGACTGG - Intronic
961302375 3:125930467-125930489 GATCCCTGCTTCCCACAGCCAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
963085646 3:141433778-141433800 AAATCCAGCTTCTCACAAATAGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964031249 3:152141616-152141638 GAACCCAGGTTCCCAAAGAAAGG + Intergenic
968818724 4:2834792-2834814 ATACCCAGCTGTCCCCAGACTGG - Exonic
968995276 4:3941461-3941483 GATCCCTGCTTCCCACAGTCGGG + Intergenic
969209104 4:5672582-5672604 AGACCCAGCCTCCCACAGTGTGG - Intronic
969758711 4:9167331-9167353 GATCCCTGCTTCCCACAGCCAGG - Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
972533729 4:39982345-39982367 AACCCCTGCTTCCCAGAGTCAGG - Intergenic
972605843 4:40612918-40612940 AAACTCAGCTTCTCTCAGCCAGG + Intronic
975114335 4:70662424-70662446 CAACCCAGATTCCCATAGACTGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976618250 4:87100224-87100246 CAGCCCAGCATCCCACAGAGAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978524961 4:109655793-109655815 AAGCCCAGCTTCTCACAGTGTGG + Intronic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983303490 4:165956963-165956985 ACAACCAGCTAACCACAGACAGG + Intronic
983676601 4:170301839-170301861 AAATCCAGCCTCCTCCAGACAGG - Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
985534349 5:455209-455231 GAATCCAGCTTCCCACTCACTGG - Intronic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
985810266 5:2078076-2078098 AAACCCAGATTCCGAGAGAGAGG - Intergenic
986241068 5:5960678-5960700 AACCCCACCTTCCCACACAGGGG + Intergenic
986318500 5:6608246-6608268 AACCTCAGCTTCCCCCAGAGGGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
990692837 5:58382869-58382891 AATCCCAGCTCCTCACAGAGGGG - Intergenic
993001734 5:82387878-82387900 AGAACTACCTTCCCACAGACAGG - Intergenic
993901956 5:93590183-93590205 AACCCCAGCTTCCCTGACACTGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996894824 5:128468328-128468350 CAACCCAGATGGCCACAGACTGG - Intronic
998757886 5:145400674-145400696 ACACCCTCCTTCCCACAGACTGG - Intergenic
999400985 5:151264063-151264085 AAAACCAGGGTCCCACAGGCTGG - Intronic
999465903 5:151804120-151804142 AAACCCTGGTTCCAACAGAATGG + Exonic
1000981211 5:167819015-167819037 CAACCCAGCTACCCAAAAACTGG - Intronic
1001311649 5:170615253-170615275 AAAGCCACTTTCCCACAGCCTGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1001903063 5:175446637-175446659 ACACACAGCGTCCAACAGACTGG + Intergenic
1002336219 5:178480273-178480295 AAACTCTGCCTCCCTCAGACAGG + Intronic
1003281816 6:4699525-4699547 AAACATAGCTTCCCATTGACGGG + Intergenic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004225293 6:13779279-13779301 AAACCCAGATCCCCACCGAATGG - Intergenic
1004256351 6:14068344-14068366 CAAACAAGCTGCCCACAGACTGG + Intergenic
1006219774 6:32478786-32478808 AACCCATGGTTCCCACAGACAGG - Intergenic
1006229050 6:32566533-32566555 AACCCATGGTTCCCACAGACAGG - Intronic
1010615900 6:78011963-78011985 AAACCCAACTCCCTACAGAAAGG - Intergenic
1010653271 6:78479831-78479853 TATCCCTGCTTCCCACATACTGG - Intergenic
1011239138 6:85252353-85252375 AAACCCACCTCCCCAAAGATGGG + Intergenic
1011397721 6:86927489-86927511 AACCCCAGTTTGCCACATACTGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017399420 6:154042132-154042154 AAACCCAGCCTGCCACAGGTGGG - Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018610280 6:165641848-165641870 AAACACCGCTTGCCAGAGACGGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019277218 7:182150-182172 CAACCCAGCATCCCACACTCTGG + Intergenic
1021526642 7:21595476-21595498 AAACAGAGTTTCCCAAAGACTGG + Intronic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1023719710 7:43080257-43080279 TAAAACATCTTCCCACAGACTGG + Intergenic
1024362760 7:48485979-48486001 GAACCCAGCTGTCCACAGGCAGG - Intronic
1026010480 7:66631933-66631955 ACCCCAAGCTTCCCAAAGACAGG - Intronic
1026318542 7:69248844-69248866 AGACACAGTTTCCCAGAGACTGG + Intergenic
1026390677 7:69898502-69898524 ACACCAAGGTTCCAACAGACTGG - Intronic
1027216701 7:76188427-76188449 AGCCCCAGCTACCCAGAGACAGG - Intergenic
1028313741 7:89373391-89373413 AGATGCAGCTTCCCAAAGACAGG - Intergenic
1028752183 7:94394219-94394241 CAACCCAGCCCTCCACAGACAGG + Intergenic
1029312349 7:99679074-99679096 AATCCTAGCCTCCCAGAGACGGG + Intronic
1029891380 7:103933690-103933712 AAGTTCAGCTTCCCACAGAATGG + Intronic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1032464482 7:132135345-132135367 AAACCCAGGTTCCCATGGAAAGG + Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1036847800 8:12181633-12181655 GATCCCTGCTTCCCACAGCCAGG + Intergenic
1036869168 8:12423948-12423970 GATCCCTGCTTCCCACAGCCAGG + Intergenic
1037949621 8:23010425-23010447 ACACCCAGGCTCCCCCAGACGGG - Intronic
1038579573 8:28735984-28736006 ACTCCCACCTTCCCACAGCCCGG - Intronic
1040770889 8:50973551-50973573 AATCCCAGCTACTCAGAGACAGG + Intergenic
1040982313 8:53256250-53256272 AAACTCAACTTCCTACAAACTGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1047224846 8:122947686-122947708 AAAGTCAGCCTCCCACAGAGAGG - Intronic
1047787610 8:128168920-128168942 ACACCCAGCCTGCCCCAGACTGG + Intergenic
1048605863 8:135968336-135968358 AAACCCAGCTCCCCAAGGAAAGG + Intergenic
1049719918 8:144111053-144111075 AGACCCAGGTTCCCCCAGCCAGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1055748735 9:79480170-79480192 TACCCCAGTTTCCCATAGACGGG - Intergenic
1056231831 9:84554406-84554428 AGAGGGAGCTTCCCACAGACAGG - Intergenic
1057125673 9:92614171-92614193 CAGCCCACCTTCCCACGGACTGG + Exonic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1059405429 9:114096149-114096171 AAGCACAGCTTCCCACCAACAGG + Exonic
1062148832 9:135007108-135007130 AAGCCCGGCTCCCCACAGCCAGG + Intergenic
1062327876 9:136021085-136021107 AAAACAAGCTAGCCACAGACTGG + Intronic
1062369618 9:136231131-136231153 AAACGCAGGATCCTACAGACGGG + Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186528188 X:10268789-10268811 AAACGTTGCTTCCTACAGACGGG - Intergenic
1186541972 X:10410110-10410132 AAATCCAGCTTCCCAGACATGGG - Intergenic
1188937289 X:36192498-36192520 AAACCCAGGATCACACAGAGTGG - Intergenic
1194589726 X:95784995-95785017 ACACCCAGCTTTCCAAAGATTGG - Intergenic
1195365911 X:104125192-104125214 TTCCCCAGCTTCCCACAGTCTGG + Intronic
1196180096 X:112680030-112680052 AAACCCAGCCTCAGACATACAGG + Exonic
1199460676 X:148081219-148081241 TAACCCAGCAATCCACAGACAGG - Intergenic
1200749438 Y:6931270-6931292 AATCCCAGCTTCTCCCAGCCTGG + Intronic
1202050884 Y:20779419-20779441 AAAACCAATTTACCACAGACAGG - Intronic