ID: 980994616

View in Genome Browser
Species Human (GRCh38)
Location 4:139768720-139768742
Sequence GCACCATGGGGTGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 583}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980994616_980994624 -2 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994624 4:139768741-139768763 GCTGGCTGATGTATGGGGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 173
980994616_980994622 -8 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994622 4:139768735-139768757 CATGGTGCTGGCTGATGTATGGG 0: 1
1: 0
2: 0
3: 16
4: 129
980994616_980994625 -1 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994625 4:139768742-139768764 CTGGCTGATGTATGGGGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 202
980994616_980994626 15 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994626 4:139768758-139768780 GTCTGGGTAGACAGAAATCAAGG 0: 1
1: 0
2: 1
3: 25
4: 227
980994616_980994621 -9 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994621 4:139768734-139768756 CCATGGTGCTGGCTGATGTATGG 0: 1
1: 0
2: 3
3: 12
4: 166
980994616_980994623 -7 Left 980994616 4:139768720-139768742 CCTGCTGCAGCACCCCATGGTGC 0: 1
1: 0
2: 1
3: 34
4: 583
Right 980994623 4:139768736-139768758 ATGGTGCTGGCTGATGTATGGGG 0: 1
1: 0
2: 0
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980994616 Original CRISPR GCACCATGGGGTGCTGCAGC AGG (reversed) Intronic
900287555 1:1908885-1908907 GCACCCTGCGGGGCCGCAGCCGG + Intergenic
900378637 1:2372972-2372994 GCACCCTGAGGTGCTGGACCTGG + Intronic
901114291 1:6829147-6829169 GCACCTTGGGAGGCTGAAGCGGG - Intronic
901504540 1:9676319-9676341 GCACTATGGGGGGCTGAGGCGGG - Intronic
901583926 1:10270676-10270698 GCACCATGGGAGGCTGAGGCGGG + Intronic
901814132 1:11784450-11784472 GCACCATGAGGCCCAGCAGCAGG + Exonic
902561555 1:17280685-17280707 GAACCGTGAGGTGCTGAAGCGGG + Exonic
902805827 1:18860733-18860755 GAACCATGGAGCGCAGCAGCCGG - Intronic
903209164 1:21806588-21806610 GCTCCTTGGGAGGCTGCAGCAGG - Intergenic
903529535 1:24019585-24019607 GCACTTTGGGGTGCTGAGGCGGG - Intergenic
903627918 1:24744910-24744932 GAGTCCTGGGGTGCTGCAGCGGG + Intergenic
903860746 1:26363055-26363077 GCACCAGGTGGTGCTTCTGCAGG + Exonic
903949170 1:26984647-26984669 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
903976766 1:27155059-27155081 GGACCAGGAGGAGCTGCAGCTGG - Intronic
904372809 1:30060951-30060973 ACACCCTGGGTAGCTGCAGCTGG - Intergenic
904487419 1:30836117-30836139 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
904671303 1:32167917-32167939 GCACCTTGGGAAGCTGAAGCAGG + Intronic
904841081 1:33372357-33372379 GCAGCATGAGGTGCTGCTGCTGG + Exonic
905406081 1:37733331-37733353 GCAACTTGGGATGCTGAAGCAGG - Intronic
905605749 1:39297727-39297749 CCACCATGGAGTCCTGGAGCAGG - Exonic
906108137 1:43306889-43306911 GCACATTTGGGAGCTGCAGCAGG - Exonic
906214711 1:44031813-44031835 GCACTATGGGGGGCTGAGGCTGG + Intergenic
906363996 1:45190065-45190087 GCACTATGGGAGGCTGAAGCAGG + Intronic
906730358 1:48075636-48075658 CCACCATGGGACGATGCAGCAGG - Intergenic
907008461 1:50940156-50940178 GCACCTTGGGGTGCCGAAGTGGG - Intronic
907046502 1:51303171-51303193 GGACTATGGGCTGCTGCAGCTGG - Exonic
907312694 1:53548126-53548148 GTCCCATGGAGTGCGGCAGCTGG - Intronic
907486811 1:54783742-54783764 GCACTTTGGGAGGCTGCAGCTGG + Intronic
908245196 1:62222333-62222355 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
908531647 1:65039966-65039988 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
909440519 1:75690879-75690901 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
909503463 1:76361730-76361752 GCACTTTGGGATGCTGAAGCAGG + Intronic
910758166 1:90712404-90712426 GCACCAGGGGCCGCTGCAGCTGG + Exonic
911435089 1:97845892-97845914 GCTCCATGTGAGGCTGCAGCTGG - Intronic
911494269 1:98611612-98611634 GCACATTGGGGTGCTGAGGCGGG - Intergenic
912008758 1:104933894-104933916 GCTCCATGCGAGGCTGCAGCTGG - Intergenic
913047890 1:115089415-115089437 GCAGCATGGGGCGCTTCCGCGGG - Exonic
913960805 1:143336972-143336994 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
914055159 1:144162544-144162566 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
914123987 1:144803817-144803839 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
915167232 1:153954926-153954948 GCACCATGGGCTGGTGGAACGGG - Exonic
915406676 1:155665169-155665191 GCACTTTGGGATGCTGAAGCAGG + Intronic
915441977 1:155951083-155951105 GCAACATGCGCTGCTGCAGGAGG - Exonic
915637328 1:157195820-157195842 ACAACCTGGGCTGCTGCAGCTGG - Intergenic
916046440 1:161003507-161003529 GCACTTTGGGCGGCTGCAGCGGG - Intronic
916231961 1:162549469-162549491 GCACTTTGGGGGGCTGAAGCTGG + Intergenic
916532644 1:165672688-165672710 GCACCTTGGGAGGCTGAAGCAGG + Intronic
917118408 1:171624828-171624850 GCACCTTGGGATGCTGAGGCAGG - Intergenic
917665971 1:177226207-177226229 GCACCAAGGGGTGAAGTAGCTGG + Intronic
917691106 1:177470111-177470133 GCACCATTGTGTGCTGGAGCTGG - Intergenic
918422051 1:184374091-184374113 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
919080436 1:192859179-192859201 GCACTTTGGGATGCTGAAGCAGG + Intergenic
919301582 1:195775303-195775325 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
919655934 1:200197267-200197289 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
919967993 1:202548569-202548591 GCACCTTGGGATGCTGAGGCAGG - Intronic
919999002 1:202781067-202781089 GCACTTTGGGCTGCAGCAGCAGG + Intronic
920244563 1:204578002-204578024 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
920393028 1:205622628-205622650 GCACTTTGGGAGGCTGCAGCAGG - Intronic
920799358 1:209173029-209173051 GCACCTTGAAGTGCTGCACCTGG - Intergenic
921062340 1:211596243-211596265 GCTCTGTGGGGGGCTGCAGCAGG - Intergenic
921097458 1:211899561-211899583 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
922421985 1:225466309-225466331 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
922726972 1:227927193-227927215 CCACCAAGAGGTGCTGCAGAGGG + Intronic
923959149 1:239057185-239057207 GCACAATGAGGTCCTGCTGCTGG - Intergenic
924237655 1:242012791-242012813 GCTACTTGGGGGGCTGCAGCAGG - Intergenic
924355628 1:243172386-243172408 GCACCATGGGAGGCTGAGGCGGG + Intronic
1063380920 10:5585298-5585320 GCACCATGGGCTGGTGCATGTGG - Intergenic
1063686419 10:8241075-8241097 GCACCCTGGAGTCCTGCAGATGG - Intergenic
1064249397 10:13695385-13695407 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1064413416 10:15127654-15127676 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1065486107 10:26237759-26237781 GCACTTTGGGATGCTGAAGCAGG + Intronic
1065582139 10:27182498-27182520 GCACTTTGGGAGGCTGCAGCTGG + Intronic
1065913308 10:30329478-30329500 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1065928944 10:30462069-30462091 GCACTTTGGGATGCTGAAGCGGG + Intergenic
1066370984 10:34817943-34817965 GCACTATGGGAGGCTGAAGCGGG - Intergenic
1066622328 10:37370410-37370432 GCACTTTGGGGTGCTGAGGCAGG - Intronic
1067030569 10:42876781-42876803 GAAACATGTGGTGCTGCATCTGG + Intergenic
1067061523 10:43080342-43080364 CCCCCATGGGGTGCTACTGCTGG - Intronic
1067724516 10:48759768-48759790 ACACCAGGGGATGCTGCAGAGGG + Intronic
1068130162 10:52886510-52886532 GCACCATGGTATGGTGGAGCAGG - Intergenic
1068740684 10:60466038-60466060 GGACCATGGTGTGATGCAGGAGG - Intronic
1069042483 10:63709965-63709987 GCACATTGGGAGGCTGCAGCAGG + Intergenic
1069532099 10:69227168-69227190 CCACCAAGGGGTGCTGCTGGGGG - Intronic
1070011531 10:72479771-72479793 GCACCTTGGGGAGCTGAGGCAGG - Intronic
1070180712 10:74010921-74010943 GCACTCTGGGGTGCTGAGGCAGG + Intronic
1070569391 10:77629882-77629904 GCACCATGAGTGTCTGCAGCAGG - Intronic
1070662406 10:78316739-78316761 GCTCCATGAGCTGATGCAGCAGG - Intergenic
1070898955 10:80011006-80011028 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1071682744 10:87723376-87723398 TCTCCATGGGTTGCTGCAGGGGG - Intronic
1071822755 10:89294726-89294748 GCACTTTGGGATGCTGAAGCAGG + Intronic
1072347832 10:94526183-94526205 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1072745741 10:97938001-97938023 GCATCTTGGGATGATGCAGCGGG - Intronic
1073540964 10:104315901-104315923 GCACCAGGAGAAGCTGCAGCTGG - Exonic
1073845183 10:107545817-107545839 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
1073983950 10:109186917-109186939 GCTCTGTGGGCTGCTGCAGCAGG - Intergenic
1074367298 10:112869398-112869420 GCACTTTGGGGTGCTGAGGCGGG - Intergenic
1075048175 10:119162620-119162642 GCACCATTGGGGGCAGCTGCTGG - Intronic
1075369044 10:121919310-121919332 GCACTTTGGGGGGCTGAAGCGGG + Intronic
1075380221 10:122012812-122012834 GCACCATGTGGGGGTGCTGCAGG + Intronic
1075490003 10:122858650-122858672 GCACCTTCGGGTCCTGAAGCAGG + Intronic
1075510555 10:123069230-123069252 GCACCATGGTGAGCTGTAACTGG - Intergenic
1076215578 10:128690965-128690987 TGGCCATGGGGTGCTGCAGAGGG + Intergenic
1076786189 10:132751258-132751280 GGACCATGGGCTCCTGCAGCAGG - Intronic
1077181986 11:1220843-1220865 CCACCGTGCCGTGCTGCAGCGGG + Intergenic
1078916992 11:15787609-15787631 GACCAATGGGGAGCTGCAGCAGG - Intergenic
1079560053 11:21811061-21811083 GCACCAAGGAGTGCAGCTGCAGG + Intergenic
1080869781 11:36227257-36227279 GCAGCACAGGGTGCTGCAGCCGG - Exonic
1081010894 11:37811647-37811669 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
1081212713 11:40355670-40355692 GCACCATGCTGTGCTGCTGAGGG + Intronic
1082026112 11:47573514-47573536 ACACCAGGGTGTGCTGGAGCCGG + Exonic
1082084666 11:48040033-48040055 GCACTCTGGGAAGCTGCAGCGGG - Intronic
1083174614 11:60941806-60941828 GCAGCATGGGGGTGTGCAGCTGG + Intronic
1083365450 11:62139207-62139229 GCAGCATGGGGGGCTGTGGCTGG + Intronic
1083417489 11:62535110-62535132 GCCCCATGGTGTTCAGCAGCTGG + Exonic
1083569869 11:63754041-63754063 GCACTTTGGGATGCTGAAGCGGG + Intronic
1083678809 11:64342077-64342099 GCACCATCTGGCCCTGCAGCTGG + Exonic
1083787887 11:64963589-64963611 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1084727368 11:70950435-70950457 GCACTTTGGGGGGCTGAAGCGGG - Intronic
1085624853 11:78064091-78064113 GGACCATGGGCTGCTGCCGCGGG + Exonic
1086119054 11:83286500-83286522 GCACCAGAGGGTGAAGCAGCAGG - Intergenic
1087145874 11:94811244-94811266 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1087426452 11:97993129-97993151 GCACTATGGGAGGCTGCGGCAGG + Intergenic
1087534302 11:99424557-99424579 GCTCCATGTGAGGCTGCAGCTGG + Intronic
1088302311 11:108372437-108372459 GCACTTTGGGGTGCTGAGGCGGG - Intronic
1088651251 11:111959405-111959427 GCTCCCTGCGATGCTGCAGCTGG - Intronic
1088837630 11:113591273-113591295 GTGCCCGGGGGTGCTGCAGCAGG - Intergenic
1089642949 11:119859616-119859638 CCACCCTGGGGTGCTGAGGCTGG + Intergenic
1089784549 11:120898662-120898684 GCACCCCAGGATGCTGCAGCTGG - Intronic
1090086394 11:123654404-123654426 GCTCCCTGGGGAGGTGCAGCGGG + Exonic
1090255758 11:125282903-125282925 GCACTTTGGGGTGCTGAGGCGGG + Intronic
1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG + Exonic
1092465294 12:8726092-8726114 GCACCATGGGATGCTGAGGCGGG - Intronic
1093021837 12:14211164-14211186 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1094197094 12:27760684-27760706 GCACTATGGGATGCTGAGGCAGG - Intergenic
1094279327 12:28718049-28718071 GCACTTTGGGATGCTGAAGCAGG + Intergenic
1094714093 12:32994489-32994511 GCAGCATGGGGTGCTGTAAGGGG + Intergenic
1095226291 12:39681023-39681045 GCACTTTGGGATGCTGAAGCAGG + Intronic
1095812176 12:46383235-46383257 CCAGCCTGGGGCGCTGCAGCGGG + Intergenic
1096344841 12:50836811-50836833 GCACCATGGGAGGCTGAGGCAGG - Intergenic
1097768109 12:63548524-63548546 GCACAGTGGGGTCCTGCAGTAGG - Intergenic
1097784469 12:63743590-63743612 GCACAGTGGGGTCCTGCAGTAGG - Intergenic
1097992437 12:65849963-65849985 GCACTATGGGAGGCTGAAGCAGG - Intronic
1098580895 12:72097695-72097717 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1098899041 12:76093938-76093960 GAACCATGGGGTGCTGGATTAGG + Intergenic
1099203527 12:79702573-79702595 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1099615772 12:84933580-84933602 GCTACATGGGGTGCTGAGGCAGG - Intergenic
1100855961 12:98757434-98757456 ACACCATGCGATGCTGCAGAAGG + Intronic
1102296999 12:111744932-111744954 GCTCCATGAAGTGCTTCAGCCGG - Exonic
1102963834 12:117111559-117111581 GCCCCACGGGGCGATGCAGCTGG + Intergenic
1103312501 12:120022315-120022337 GCACTTTGGGATGCTGAAGCAGG + Intronic
1103360270 12:120349478-120349500 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1103638189 12:122326431-122326453 GCACCTTGGGAAGCTGAAGCAGG + Intronic
1104664041 12:130634843-130634865 GCACTTTGGGAAGCTGCAGCAGG - Intronic
1105734412 13:23253133-23253155 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1106915142 13:34505892-34505914 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1109536656 13:63730706-63730728 GCACTTTGGGATGCTGAAGCGGG + Intergenic
1109687893 13:65844540-65844562 GCACCATGCGAGGCTGCAGCTGG - Intergenic
1111243844 13:85509037-85509059 GCACATTTGGCTGCTGCAGCGGG - Intergenic
1111487697 13:88926258-88926280 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
1112409361 13:99149060-99149082 GCACCATGGGAGGCTGAGGCGGG - Intergenic
1113660270 13:112103011-112103033 GGACCATGGGGTGAAACAGCAGG + Intergenic
1113714859 13:112496347-112496369 GCACCAGGGGGTGCAGCAGGCGG + Intronic
1115813060 14:37132069-37132091 CCACCATGGGATGATGCAGCAGG - Intronic
1116514588 14:45789507-45789529 GCACCTTGGGAGGCTGAAGCCGG - Intergenic
1116768779 14:49103060-49103082 GCAGCATGGGGTGCTGATGCAGG - Intergenic
1117160002 14:52979910-52979932 GCACCTTGGGGAGCTGAAGCTGG - Intergenic
1117832121 14:59762098-59762120 GGAGCATGGGATGATGCAGCAGG + Intronic
1118191671 14:63586355-63586377 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1118252802 14:64178822-64178844 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1118625265 14:67653033-67653055 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1119303342 14:73588244-73588266 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1119480268 14:74954359-74954381 GCGCCATGAGCTGGTGCAGCCGG + Intronic
1119539141 14:75427737-75427759 GCACCGTGGGGTGGCGGAGCCGG + Intronic
1120422307 14:84303243-84303265 GCTCCATGTGAAGCTGCAGCTGG - Intergenic
1121368760 14:93337914-93337936 GCTCCATGTGAGGCTGCAGCTGG - Intronic
1122139003 14:99651000-99651022 GCACTATGGGAGGCTGAAGCGGG + Intronic
1122298710 14:100719813-100719835 GCAGCAGGGGGTGCTGGAGATGG + Intergenic
1122495804 14:102153937-102153959 GCACTTTGGGATGCTGAAGCAGG + Intronic
1122831798 14:104401652-104401674 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1124137509 15:27048114-27048136 CCAGCAAGGGGTGCTGCAGGGGG + Intronic
1125811392 15:42544574-42544596 GCACCTTGGGAGGCTGCGGCGGG + Intronic
1125961061 15:43830314-43830336 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1125970017 15:43903995-43904017 GAGCCATGGGGTCCTGCACCTGG + Intronic
1126711090 15:51456923-51456945 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1126770546 15:52051625-52051647 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1127072130 15:55297476-55297498 GCACCATGGGGTGATCAAGAAGG + Intronic
1127519909 15:59733640-59733662 CCACCATGGAATGATGCAGCAGG + Intergenic
1129062530 15:72871778-72871800 GGACCATGTGGTGATGCTGCAGG + Intergenic
1129158025 15:73731003-73731025 GCACCAAGGGGAGCGTCAGCAGG - Intergenic
1129529365 15:76250781-76250803 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1129816773 15:78562107-78562129 GCACCTTGGGATGCTGAGGCAGG + Intergenic
1132339198 15:101067330-101067352 ACACTGTGGGGAGCTGCAGCTGG - Intronic
1132994978 16:2818105-2818127 GCCCCAGGCTGTGCTGCAGCCGG + Intronic
1133192155 16:4142064-4142086 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1133299299 16:4772452-4772474 GCACTTTGGGAAGCTGCAGCAGG + Intergenic
1133315972 16:4884301-4884323 GCAGAAGGTGGTGCTGCAGCAGG - Exonic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133762403 16:8809696-8809718 GCACTTTGGGATGCTGCGGCGGG - Intronic
1134243473 16:12522920-12522942 GCTACATGGGTGGCTGCAGCAGG - Intronic
1134977725 16:18584261-18584283 ACACCTTGGGAGGCTGCAGCAGG + Intergenic
1135335220 16:21596125-21596147 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1135701206 16:24634026-24634048 GCACTTTGGGGGGCTGAAGCGGG - Intergenic
1135770861 16:25217368-25217390 GGACACTGGGCTGCTGCAGCCGG + Exonic
1136629625 16:31482307-31482329 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1137599530 16:49746849-49746871 GCACCGTGAGGTGCTGCTTCGGG - Intronic
1137709924 16:50559556-50559578 GAACTATGTGGTGCAGCAGCAGG + Intronic
1137731753 16:50694911-50694933 GCAGGATGGGGTGCTGGGGCTGG + Intronic
1137765543 16:50975071-50975093 TTCCCATGGGGTGCTGCTGCTGG + Intergenic
1137999413 16:53259622-53259644 GCAACATGGGAGGCTGCGGCAGG - Intronic
1138110496 16:54320063-54320085 GCACTTTGGGGTGCTAAAGCAGG - Intergenic
1138147779 16:54627745-54627767 CCACCATGGGGCGTTCCAGCAGG - Intergenic
1138151434 16:54661209-54661231 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1138224454 16:55280872-55280894 CCCCCAGGGTGTGCTGCAGCTGG + Intergenic
1138370622 16:56523809-56523831 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1138394904 16:56696333-56696355 GCAACTTGGGATGCTGAAGCAGG - Intronic
1138644165 16:58411144-58411166 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1139148093 16:64346240-64346262 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
1139165472 16:64560263-64560285 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
1139923475 16:70473441-70473463 GGACCATGAGGTGCTCAAGCAGG + Intronic
1140399209 16:74656702-74656724 GCACTTTGGGGGGCTGAAGCAGG - Intronic
1140440202 16:74982007-74982029 GCACTTTGGGAAGCTGCAGCAGG + Intronic
1141971556 16:87487504-87487526 CCAGCCTGGGGAGCTGCAGCTGG - Intronic
1142368663 16:89665239-89665261 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1142504362 17:353449-353471 TCCCCATGGGGAGCAGCAGCAGG + Intronic
1142633593 17:1242580-1242602 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1143643827 17:8216642-8216664 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1143953412 17:10651473-10651495 GAAGCATGGGATGCTGGAGCAGG - Intronic
1144013918 17:11175660-11175682 GCACCATGAGGTTGTGCACCAGG - Intergenic
1144957119 17:19024352-19024374 GCACCTTGAAGTGCTGCACCTGG + Exonic
1146781813 17:35680939-35680961 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1146900647 17:36584582-36584604 GCACTATGGGCAGCTGAAGCAGG - Intronic
1147061424 17:37882109-37882131 GCAACTTGGGAGGCTGCAGCAGG + Intergenic
1147514769 17:41105486-41105508 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147516602 17:41123775-41123797 GCAGCAAGTGGTCCTGCAGCAGG + Exonic
1147516646 17:41124015-41124037 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147517984 17:41140248-41140270 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518007 17:41140380-41140402 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518903 17:41149480-41149502 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518906 17:41149495-41149517 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518937 17:41149660-41149682 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147519825 17:41160254-41160276 GCAGCAGGTGGTTCTGCAGCAGG + Exonic
1147519856 17:41160419-41160441 GCAGCATTGGGGTCTGCAGCAGG + Exonic
1147519871 17:41160509-41160531 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147519885 17:41160584-41160606 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147520534 17:41168053-41168075 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147521547 17:41178057-41178079 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147522723 17:41189978-41190000 GCAACAGGGTGTGCTGCTGCAGG - Exonic
1147522738 17:41190065-41190087 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147522748 17:41190122-41190144 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147524868 17:41212966-41212988 GCAGCAAGTGGTCCTGCAGCAGG - Intronic
1147524873 17:41213023-41213045 GCAGCAGGGTGTGCTGCAGCAGG - Intronic
1147526250 17:41226689-41226711 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147526261 17:41226746-41226768 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147526285 17:41226890-41226912 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147526818 17:41232722-41232744 GCAGCAGGGTGTGCTACAGCAGG - Exonic
1147527300 17:41238128-41238150 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147527320 17:41238257-41238279 ACAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528424 17:41249812-41249834 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528445 17:41249941-41249963 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528944 17:41255462-41255484 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528957 17:41255549-41255571 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147528967 17:41255606-41255628 GCAGCAGGTTGTGCTGCAGCAGG - Exonic
1147529841 17:41265412-41265434 GCAGCAAGTGGTCCTGCAGCAGG - Exonic
1147529850 17:41265469-41265491 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147529864 17:41265556-41265578 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147529874 17:41265613-41265635 GTAGCAGGGTGTGCTGCAGCAGG - Exonic
1147530446 17:41271489-41271511 GCAGCAGGTGGTCCTGCAGCAGG - Intergenic
1147530845 17:41275774-41275796 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147530859 17:41275861-41275883 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147530869 17:41275918-41275940 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147531312 17:41280752-41280774 GCAGCAGGGTGGGCTGCAGCAGG - Intergenic
1147535093 17:41315633-41315655 GGACCATGGGGTGCTGCCCGGGG - Exonic
1147767616 17:42847290-42847312 GCAGCATGGGCTGCTGCTGTGGG + Intronic
1147841994 17:43378534-43378556 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1147989059 17:44322404-44322426 GCACCATGGTGAGGAGCAGCTGG - Exonic
1148341598 17:46876570-46876592 GCAGCACAGGCTGCTGCAGCTGG - Exonic
1148834616 17:50459487-50459509 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1148878253 17:50705770-50705792 GCTACTTGGGATGCTGCAGCAGG - Intronic
1149731496 17:58951217-58951239 GCTCCTTGGGAGGCTGCAGCAGG + Intronic
1150359392 17:64517778-64517800 GCACTCTGGGAGGCTGCAGCAGG - Intronic
1151213316 17:72560808-72560830 GCAGGATGGGGTGATGGAGCTGG - Intergenic
1151251352 17:72838035-72838057 GCACTATGGGAGGCTGAAGCAGG + Intronic
1152448614 17:80361795-80361817 GCTCCATGGAGAGCCGCAGCAGG + Exonic
1152569184 17:81114074-81114096 GCTCCATGGGGGGCTGAAGTGGG - Intronic
1152638987 17:81441921-81441943 ACCCCATGGGCTCCTGCAGCCGG + Exonic
1152719151 17:81914398-81914420 GCACAATGGTGTCCCGCAGCTGG + Exonic
1153666233 18:7369748-7369770 GAGCCATGGCTTGCTGCAGCGGG - Intergenic
1154936311 18:21061324-21061346 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1155010814 18:21776018-21776040 GCACCATGGGAGGCTAAAGCAGG + Intronic
1156997684 18:43486915-43486937 GCACCAGGGAGTGCAGCTGCAGG + Intergenic
1157031483 18:43914756-43914778 GCATCACGGGATGCTGCAACTGG - Intergenic
1157230635 18:45912423-45912445 GCACGATGGGGAGCTTCAGCTGG + Exonic
1158362724 18:56693816-56693838 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1158442711 18:57491351-57491373 CCACAATGGGGTGCTGTAGGGGG - Intergenic
1158479192 18:57805229-57805251 GCACCTTGGGGGGCTGAGGCAGG - Intergenic
1160015374 18:75136050-75136072 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1160072895 18:75643689-75643711 TCACCATGGAGAGCAGCAGCAGG - Intergenic
1160632541 18:80256908-80256930 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1161476381 19:4488215-4488237 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1161556702 19:4946820-4946842 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1161628618 19:5340308-5340330 GCAGCCCGGGGTGGTGCAGCCGG + Intronic
1161776529 19:6265732-6265754 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1161859868 19:6789957-6789979 GCACCTTGGGATGCTGAGGCGGG + Intronic
1162313084 19:9919088-9919110 GCACCTTGGGAAGCTGAAGCGGG + Intronic
1162836393 19:13321278-13321300 GCACTTTGGGAGGCTGCAGCGGG - Intronic
1163155523 19:15438161-15438183 GCCCCAGGGGGTTCTGAAGCTGG + Intronic
1163259696 19:16181171-16181193 GCACCTTGGGATGCTGAGGCGGG - Intergenic
1163642851 19:18471419-18471441 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1163946498 19:20540512-20540534 GCACCGTGGGAGGCTGAAGCAGG + Intronic
1163951821 19:20595575-20595597 GCTACATGGGAGGCTGCAGCAGG + Intronic
1164011958 19:21211565-21211587 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1165411193 19:35662785-35662807 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1166010692 19:39939900-39939922 GCACTTTGGGGTGCTGAGGCGGG + Intergenic
1166309598 19:41955520-41955542 GCACTATGGGAGGCTGCAGGGGG + Intergenic
1166663871 19:44665398-44665420 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1166734835 19:45077974-45077996 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1166775691 19:45311162-45311184 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1166845171 19:45722812-45722834 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1166855086 19:45779367-45779389 GCACCCGGAGGAGCTGCAGCCGG + Intronic
1167232322 19:48292742-48292764 GCACCTTGGGGGGCTGAGGCAGG - Intergenic
1167394975 19:49222590-49222612 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1167490276 19:49788988-49789010 GAACCCTCGTGTGCTGCAGCTGG - Intronic
1167840838 19:52118189-52118211 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1167852188 19:52210736-52210758 GCACTATGGGAGGCTGAAGCGGG - Intronic
1167885541 19:52496881-52496903 GCACCTTGGGAAGCTGAAGCAGG - Intronic
1167956845 19:53072603-53072625 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1168339783 19:55616288-55616310 GCACCACGCGGTGCTGCCGCAGG - Exonic
1168398393 19:56067797-56067819 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1168474106 19:56663797-56663819 GCACGATGTGGTGCTGGATCAGG + Exonic
1168546335 19:57253554-57253576 GGACCATGTGGTGCTGCAGGAGG - Exonic
1202694641 1_KI270712v1_random:115221-115243 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
925560227 2:5183587-5183609 GCACTAGGCGGTGCTGCAGTGGG - Intergenic
925680075 2:6411268-6411290 GCACTTTGGGATGCTGCGGCAGG + Intergenic
925716711 2:6790886-6790908 GCACTTTGGGATGCTGAAGCAGG + Intergenic
925884435 2:8382313-8382335 GCGCCAGGGGCTGCTGGAGCTGG - Intergenic
927814493 2:26202492-26202514 GCACTTTGGGAGGCTGCAGCAGG + Intronic
930605692 2:53490768-53490790 GCACCAGGGAGTGCAGCTGCAGG - Intergenic
931301825 2:60987674-60987696 GCACTTTGGGATGCTGAAGCGGG + Intronic
932041475 2:68304140-68304162 GCACTTTGGGATGCTGCAGCAGG + Intronic
932129517 2:69175361-69175383 GCACCTTGGGAGGCTGAAGCAGG + Intronic
932264852 2:70358885-70358907 GCACTTTGGGATGCTGAAGCGGG - Intergenic
932332349 2:70904910-70904932 GCACAATGGCGTGCAGCCGCCGG + Intronic
933067236 2:77812990-77813012 GCACTTTGGGGAGCTGAAGCAGG + Intergenic
933151382 2:78919226-78919248 GCACTTTGGGGGGCTGAAGCTGG + Intergenic
933697398 2:85229894-85229916 GCTACATGGGCTGCTGCGGCAGG + Intronic
934050287 2:88204664-88204686 GCACCTTGGGAGGCTGGAGCAGG - Intergenic
934275810 2:91572267-91572289 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
934732438 2:96668089-96668111 GCACTTTGGGGGGCTGAAGCGGG - Intergenic
935898998 2:107770517-107770539 GCCCCACTGGGTGCTACAGCTGG - Intergenic
938303883 2:130236669-130236691 GCACTTTGGGATGCTGAAGCGGG - Intergenic
939479210 2:142728024-142728046 GCACCATGCGGAGCCGAAGCAGG + Intergenic
940138833 2:150470773-150470795 GCACCATGAGGCGCTGGAACAGG - Intronic
940801703 2:158139920-158139942 GCAACAAGGGATGATGCAGCTGG - Intergenic
941472098 2:165901011-165901033 GCTCCTTGGGGTGCTGAGGCAGG - Intronic
941929058 2:170923303-170923325 GCTCCATGTGACGCTGCAGCTGG + Intergenic
942563757 2:177246842-177246864 GCACCTTGGGAGGCTGAAGCCGG - Intronic
943735616 2:191351126-191351148 GCACCATGGGATGGTGAGGCAGG - Intronic
944178431 2:196860283-196860305 GCACTTTGGGAGGCTGCAGCAGG + Intronic
944449131 2:199823094-199823116 GCACTTTGGGAGGCTGCAGCTGG - Intronic
944540977 2:200753260-200753282 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
944664106 2:201945456-201945478 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
944801046 2:203238513-203238535 GCACCTTGGGAGGCTGAAGCGGG - Intronic
945253247 2:207782377-207782399 GCACTTTGGCCTGCTGCAGCAGG - Intergenic
946606100 2:221406950-221406972 GCACTTTGGGGGGCTGAAGCGGG - Intergenic
946728782 2:222688758-222688780 GCGCTATGGGCTGATGCAGCAGG - Intronic
947761865 2:232609305-232609327 GCACCTTGGGAGGCTGAAGCAGG - Intronic
948334819 2:237199833-237199855 GCTCCATGTGAGGCTGCAGCTGG + Intergenic
948483036 2:238262232-238262254 GCTCCATGGGTTGATGAAGCTGG + Exonic
948601311 2:239108912-239108934 GCAGCCTGGGGCTCTGCAGCAGG + Intronic
1168813191 20:719671-719693 GCTCCTGGGGGAGCTGCAGCTGG + Intergenic
1169390270 20:5185172-5185194 GCACTATGGGATGCTGAGGCAGG + Intronic
1170595962 20:17806131-17806153 GCACCATGGGAGGCCGAAGCAGG + Intergenic
1170807078 20:19641627-19641649 GCCTCATGGGGTGCAGCAGGAGG + Intronic
1171014275 20:21525607-21525629 GCACAATGGGGAGCTGAAGATGG + Intergenic
1173572397 20:44085865-44085887 GCTCCATGGGGTCCTGGACCTGG - Intergenic
1173577906 20:44124859-44124881 GCACTATGGGATGCTGAGGCGGG + Intronic
1173826824 20:46053108-46053130 TCACCTTGTGGTGCCGCAGCAGG - Exonic
1173838393 20:46140284-46140306 GCCCCATGGGGCTCTGCAGGGGG + Intergenic
1174329430 20:49806211-49806233 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1174440361 20:50546779-50546801 GGACCATGGAGGGCAGCAGCTGG + Intronic
1175275713 20:57769241-57769263 GCACTTTGGGGAGCTGCAGTGGG - Intergenic
1175893663 20:62326682-62326704 TCACCGTGGGCAGCTGCAGCTGG - Exonic
1176033461 20:63025013-63025035 GGACCACGGGAAGCTGCAGCTGG - Intergenic
1177258049 21:18691851-18691873 GCACTTTGGGGGGCTGAAGCAGG + Intergenic
1177910370 21:27023609-27023631 GCACCATGGGAGGCTGAGGCAGG + Intergenic
1178255598 21:31049572-31049594 GCACTTTGGGATGCTGAAGCAGG + Intergenic
1178363760 21:31971316-31971338 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1178561449 21:33642743-33642765 GGACCACGGGCGGCTGCAGCGGG + Intronic
1178643734 21:34367212-34367234 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1178893248 21:36537892-36537914 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1179490381 21:41737281-41737303 GCACCTTGGTTTGCTCCAGCCGG + Intergenic
1180053372 21:45344113-45344135 GTTCCATGCGGTGCTGCAGAGGG + Intergenic
1180178971 21:46109525-46109547 GCACCATGGATGGCTGCAGGAGG - Intronic
1180225764 21:46391234-46391256 GCACCGTCTGGTGCTGGAGCTGG + Exonic
1181319154 22:21991411-21991433 GCCCCATGGTGTGCTCCAGCAGG + Intergenic
1181433879 22:22899221-22899243 ACACCATGGGGTGGTGCAGAGGG - Intergenic
1181434815 22:22904591-22904613 ACACCATGGGGTGGTGCAGAGGG - Intergenic
1181574092 22:23783039-23783061 GCACCCTGGAGTCCTGGAGCTGG - Intronic
1181788853 22:25247381-25247403 GCACCATGGGGTGATCAAGAAGG - Intergenic
1181867021 22:25866592-25866614 GCACTATGGGAGGCTGAAGCAGG + Intronic
1182201405 22:28574256-28574278 GCACCCTGGGAGGCTGAAGCAGG - Intronic
1182468466 22:30532491-30532513 CCACCCTGGGCAGCTGCAGCCGG - Intronic
1182672735 22:32010859-32010881 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
1182847483 22:33443465-33443487 GCACCAGAGGGTTCTGCAGAGGG - Intronic
1183296767 22:37034310-37034332 GCTCCAGGGAGAGCTGCAGCAGG + Intergenic
1183457883 22:37932633-37932655 GCACCGTGGGGTGCTGCTGGAGG + Exonic
1183519281 22:38287161-38287183 GGACCTTGGGGAGCTGCTGCTGG - Intergenic
1183624770 22:38995059-38995081 GCACTATGGGAGGCTGAAGCAGG - Intergenic
1184387304 22:44183353-44183375 CCCCCTTGGGGAGCTGCAGCAGG - Exonic
1185010852 22:48313158-48313180 GCACGGTGGTGGGCTGCAGCGGG - Intergenic
1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG + Intergenic
949530612 3:4951599-4951621 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
951511130 3:23503435-23503457 GCACCTTGGGAGGCTGAAGCAGG - Intronic
951520056 3:23603070-23603092 GAACCCTGCGGTGCGGCAGCTGG - Intergenic
951536794 3:23747298-23747320 GCACCTTGGGGGGCTGAGGCGGG - Intergenic
951726653 3:25767864-25767886 GCACTTTGGGGGGCTGAAGCAGG + Intronic
952793449 3:37218302-37218324 GCTCCCTGGGAGGCTGCAGCTGG - Intergenic
953766530 3:45747358-45747380 GCACCATGGATGGCTGCAGGAGG + Intergenic
953980633 3:47411215-47411237 CCACCTTGGTGGGCTGCAGCAGG - Exonic
954236201 3:49259157-49259179 GCACTTTGGGATGCTGAAGCGGG - Intergenic
954303911 3:49715591-49715613 CCGCCATGTGCTGCTGCAGCAGG - Exonic
954423540 3:50431368-50431390 ACAGCCAGGGGTGCTGCAGCAGG + Intronic
954477666 3:50763527-50763549 GCACTTTGGGGGGCCGCAGCAGG - Intronic
955070716 3:55570509-55570531 GGGCCAGGGGGAGCTGCAGCCGG + Intronic
955117862 3:56023707-56023729 CAACAATTGGGTGCTGCAGCTGG - Intronic
955357973 3:58247248-58247270 GCACCTTGGGAGGCTGAAGCAGG - Intronic
955942960 3:64164124-64164146 GCACCTTGGGGGGCTGAGGCGGG + Intronic
956605804 3:71071820-71071842 GCACCTTGGGAGGCTGAAGCAGG - Intronic
957768020 3:84650729-84650751 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
959725188 3:109534281-109534303 GCACCATGGGGCGCTGAGACAGG - Intergenic
960871398 3:122253487-122253509 GCACTATGGGGAGCTGAGGCAGG - Intronic
961616409 3:128185671-128185693 GCACTTTGGGATGCTGAAGCAGG - Intronic
961689715 3:128660179-128660201 GCACTCTGGGAGGCTGCAGCGGG + Intronic
961933132 3:130554792-130554814 GCAACATGGGAGGCTGCAGTGGG + Intergenic
964083851 3:152791857-152791879 GCTCCCTGGGGGGCTGAAGCGGG + Intergenic
964978736 3:162651193-162651215 GCACTATGGGGGGCTGACGCAGG - Intergenic
965115137 3:164478414-164478436 GCTCCATGCGATGCTGCAGCAGG - Intergenic
966309026 3:178573253-178573275 GCACTTTGGGATGCTGAAGCAGG - Intronic
966880940 3:184350681-184350703 GCACTTTGGGAGGCTGCAGCAGG - Intronic
966905195 3:184518760-184518782 GCACCTGGGGGTGTGGCAGCAGG - Intronic
966913005 3:184569617-184569639 GGACCAGGGGCTGCGGCAGCGGG + Intronic
966913393 3:184571546-184571568 GGACCATGAGGTGCTTCAGAGGG - Intronic
967373541 3:188775295-188775317 GCACCTTGGGAGGCTGAAGCAGG - Intronic
967935739 3:194726023-194726045 GCACCATGGGGAGCCGCTGAGGG - Intergenic
969650505 4:8464913-8464935 GCAACATGGGGTGCAGCTGGAGG + Intronic
970835093 4:20394561-20394583 GCTCCATGAGGTCCTGCAGTTGG - Intronic
971335042 4:25714816-25714838 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
971474056 4:27056053-27056075 TCACCAGGGGTAGCTGCAGCTGG + Intergenic
972544112 4:40064042-40064064 GCACCTTGGGAGGCTGAAGCAGG - Intronic
972891299 4:43559388-43559410 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
973667072 4:53172116-53172138 GCTACATGGGAGGCTGCAGCAGG - Intronic
974761709 4:66285214-66285236 GCTCCATGCGAGGCTGCAGCTGG + Intergenic
975776562 4:77793902-77793924 GCACTATGGGAAGCTGCGGCGGG + Intronic
975988817 4:80235400-80235422 GCACTTTGGGATGCTGCGGCAGG - Intergenic
976206055 4:82624588-82624610 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
977612919 4:99055142-99055164 GCACCTTGGGAGGCTGAAGCAGG + Intronic
978725197 4:111961194-111961216 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
978927018 4:114258999-114259021 CCACCCTGGGGTGATGCAGTGGG + Intergenic
979094588 4:116531170-116531192 CCACTATGGGATGATGCAGCAGG - Intergenic
979946909 4:126843681-126843703 GCTCCATGTGAGGCTGCAGCTGG - Intergenic
980049134 4:128021415-128021437 GCACCTTGGGATGCTGAAGTGGG + Intronic
980049793 4:128027648-128027670 GCACTTTGGGGAGCTGAAGCAGG - Intronic
980468744 4:133221448-133221470 GCACTTTGGGATGCTGAAGCGGG - Intergenic
980669323 4:135983647-135983669 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
980994616 4:139768720-139768742 GCACCATGGGGTGCTGCAGCAGG - Intronic
981709213 4:147692335-147692357 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
982243011 4:153319480-153319502 GCACCTTGGGAGGCCGCAGCGGG + Intronic
982943572 4:161589562-161589584 GCACCTTGGGTGGCTGAAGCAGG - Intronic
983272958 4:165584768-165584790 GCTCTTTGGGGTGCTGCACCTGG + Intergenic
983451754 4:167920506-167920528 GCACTTTGGGAGGCTGCAGCGGG - Intergenic
984959864 4:185086232-185086254 GCAGCTTGGGGAGCGGCAGCAGG + Intergenic
985492807 5:189207-189229 GGAGCATGGGGGTCTGCAGCTGG - Exonic
986123090 5:4860449-4860471 GCATCATTGAGTGCTGCAGAGGG + Intergenic
987322754 5:16785621-16785643 GCACCATGGGAGGCTGAGGCGGG + Intronic
987430701 5:17829289-17829311 GCACTTTGGGGGGCTGAAGCGGG + Intergenic
988142616 5:27263539-27263561 GCACCAGAGGCTGGTGCAGCTGG - Intergenic
988726646 5:33933084-33933106 GCACTTTGGGGTGCTGAGGCAGG - Intergenic
989595456 5:43152247-43152269 GCACTTTGGGATGCTGAAGCAGG - Intronic
989750516 5:44887438-44887460 GCACTTTGGGATGCTGAAGCAGG + Intergenic
990972876 5:61528832-61528854 GCACTCTGGGATGCTGAAGCGGG - Intronic
991374143 5:65948421-65948443 GCACTTTGGGATGCTGCAGCAGG - Intronic
992003938 5:72460257-72460279 TCATCATGTGGTTCTGCAGCTGG + Exonic
992419701 5:76590838-76590860 GCACTTTGGGAGGCTGCAGCGGG + Intronic
993327041 5:86553357-86553379 GCACAATGGGAGGCTGAAGCAGG + Intergenic
994083977 5:95738620-95738642 CCACCATGGGACGATGCAGCAGG + Intronic
994570435 5:101506998-101507020 GACCCATGGGTTGCTGCTGCTGG - Intergenic
995782821 5:115796056-115796078 GCACTCTGGGGAGCTGAAGCAGG + Intergenic
995803698 5:116027887-116027909 GTACCATGGGATGATACAGCAGG - Intronic
996304741 5:122034068-122034090 GCACCATGGGAGGCTGAGGCGGG - Intronic
996740811 5:126797033-126797055 GCACTTTGGGAGGCTGCAGCGGG - Intronic
997062765 5:130526826-130526848 GCACCATGTGAAGCTGTAGCAGG - Intergenic
997122274 5:131187730-131187752 GCACTTTGGGGGGCTGAAGCAGG - Intronic
997855963 5:137373057-137373079 CCACCATGTGATGATGCAGCAGG + Intronic
997910677 5:137870040-137870062 GCACCAAGGGGGGCTGAGGCGGG + Intronic
998087671 5:139340019-139340041 GCACCTTGGGAAGCTGAAGCGGG + Intergenic
998589894 5:143465771-143465793 GCGCCATGTTGTGGTGCAGCAGG - Intergenic
1000956271 5:167547315-167547337 GCACTTTGGGGTGCTGAGGCGGG - Intronic
1001182439 5:169533179-169533201 GCTCCTTGGGATGCTGAAGCAGG - Intergenic
1001649982 5:173309454-173309476 GCACCTAGAGGTGCTGGAGCAGG + Intergenic
1001964305 5:175899779-175899801 GCTCCATGGGATGAGGCAGCAGG - Intergenic
1002375237 5:178784100-178784122 GCACTATGGGAGGCTGAAGCGGG - Intergenic
1002603738 5:180370114-180370136 ACCTCATGGGGTGCTGCAGGTGG + Intergenic
1002623020 5:180503509-180503531 GCACTTTGGGGTGCCGAAGCAGG - Intronic
1002911402 6:1493821-1493843 GCACCTTGGGGGGCTGAGGCAGG - Intergenic
1003209996 6:4054146-4054168 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1004304453 6:14487555-14487577 GCACCATGGAGGGCAGCAGGAGG + Intergenic
1004394143 6:15233576-15233598 GCACTATGGGGTGCTGAGGTGGG - Intergenic
1004452134 6:15757117-15757139 GCTACATGGGAGGCTGCAGCAGG + Intergenic
1004586737 6:17009650-17009672 GCACTTTGGGATGCTGAAGCGGG + Intergenic
1005075464 6:21902444-21902466 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
1005749221 6:28867787-28867809 GCACTTTGGGGGGCTGAAGCTGG - Intergenic
1006728667 6:36218703-36218725 GCACTTTGGGATGCTGCGGCGGG - Intronic
1006824795 6:36926838-36926860 GCACCATGCCGTGATGCCGCAGG - Intronic
1006889870 6:37417312-37417334 GCTACATGGGAGGCTGCAGCAGG + Intergenic
1007015542 6:38463040-38463062 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1008657935 6:53634817-53634839 GCACTTTGGGATGCTGAAGCGGG - Intergenic
1010220942 6:73448714-73448736 GCACCATGGGAGGCTGAGGCGGG - Intronic
1010953392 6:82063225-82063247 GCTACTTGGGGGGCTGCAGCAGG - Intergenic
1012471365 6:99576224-99576246 GCACCATGTGCTGCTCCAACAGG + Intergenic
1012512897 6:100024893-100024915 GCACCCTGGAGAGCTGCAGAGGG + Intergenic
1014231863 6:118912814-118912836 CTGCCATGGGGTGCTGCTGCAGG - Intronic
1016353652 6:143194796-143194818 GAGCCTTGGGGTGCTGCTGCGGG - Intronic
1017022575 6:150152325-150152347 GCACCGTGGGGAGCTGGAGCAGG - Intronic
1018363502 6:163096239-163096261 GCACCCTGGGGTGCTGCTATGGG - Intronic
1019443161 7:1057511-1057533 CCGCCATGTGGAGCTGCAGCTGG + Exonic
1019611201 7:1937532-1937554 GCACCATGCAGCCCTGCAGCAGG + Intronic
1019675309 7:2308419-2308441 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1020063012 7:5166736-5166758 GCACTTTGGGAGGCTGCAGCAGG - Intergenic
1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG + Intergenic
1021232851 7:18106698-18106720 GCACACTGGGAGGCTGCAGCAGG - Intronic
1022832185 7:34079071-34079093 GCACGGTGAGGTGCTGCTGCAGG - Exonic
1023190485 7:37575594-37575616 GCACTCTGGGAGGCTGCAGCCGG + Intergenic
1024058659 7:45682459-45682481 GGACCCCGGGGTGCTGCAGGTGG + Intronic
1024271576 7:47646316-47646338 GCACTTTGGGGGGCTGAAGCAGG + Intergenic
1024856940 7:53793844-53793866 GCACTATGTGAGGCTGCAGCAGG + Intergenic
1024970302 7:55063077-55063099 GCAACATGAGGTCCTGGAGCAGG - Intronic
1025729083 7:64094037-64094059 GCACCGTGGGAGGCTGAAGCGGG + Intronic
1026024237 7:66732229-66732251 GCCCCATGGCTAGCTGCAGCTGG - Intronic
1026097455 7:67357757-67357779 GCACCTTGGGATGCTGAGGCAGG - Intergenic
1026130597 7:67617434-67617456 GCACTTTGGGGAGCTGCGGCGGG - Intergenic
1026225864 7:68439845-68439867 GCACTTTGGGATGCTGAAGCAGG + Intergenic
1026423020 7:70260117-70260139 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1026541610 7:71284440-71284462 GCACTTTGGGGTGCTGAGGCCGG - Intronic
1026619865 7:71940856-71940878 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1026686529 7:72514872-72514894 GCTACTTGGGGTGCTGAAGCAGG + Intergenic
1026818344 7:73529705-73529727 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1026965287 7:74435440-74435462 GGACCATGAGGTTCTCCAGCAGG - Intergenic
1027001037 7:74654558-74654580 GCACCTTGGGGGGCTGAGGCAGG + Intergenic
1027172012 7:75879193-75879215 GCGCCAGGGGCTGCTGCAGCAGG - Exonic
1029216343 7:98953217-98953239 GCAGCGTGGCGTACTGCAGCAGG - Exonic
1029436231 7:100565471-100565493 TCAGCAGGGGGTGCTGCAGGAGG - Exonic
1029603720 7:101585480-101585502 GCACTTTGGGAAGCTGCAGCAGG + Intergenic
1029643281 7:101834750-101834772 GCACTTTGGGATGCTGAAGCGGG + Intronic
1029703570 7:102263560-102263582 GCACTATGGGAGGCTGAAGCGGG - Intronic
1030685942 7:112487236-112487258 GCACTATGGGCTTCTGCAGTGGG - Intronic
1031132993 7:117855029-117855051 GCACTTTGGGGAGCTGAAGCAGG - Intronic
1032768585 7:135024257-135024279 CCACCATAGAGTGCTGCTGCAGG + Intronic
1033090369 7:138379917-138379939 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1034314040 7:150113094-150113116 GAGCTGTGGGGTGCTGCAGCTGG - Intergenic
1034443652 7:151100971-151100993 GCTCCATGGGGGGCTGCAGGTGG - Intronic
1034501415 7:151453209-151453231 GCTCCAGGGGCTGCGGCAGCTGG + Intergenic
1034792860 7:153987698-153987720 GAGCTGTGGGGTGCTGCAGCTGG + Intronic
1035898357 8:3430558-3430580 GCACCTTGGGAAGCTGAAGCGGG + Intronic
1036431286 8:8693226-8693248 GCACTTTGGGGTGCTGAGGCAGG - Intergenic
1036863862 8:12377566-12377588 GCACATTGGGGTGCTTGAGCAGG + Intergenic
1038461072 8:27717536-27717558 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1039697932 8:39932034-39932056 GCACTATGGGAGGCTGAAGCGGG + Intergenic
1040365405 8:46710111-46710133 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1041937154 8:63346421-63346443 GCACTTTGGGATGCTGAAGCGGG - Intergenic
1042025853 8:64422937-64422959 GGACCATGGAGTGCAGGAGCAGG - Intergenic
1042659278 8:71135677-71135699 ACACCATGGAGTGCTTCAGGTGG + Intergenic
1045371731 8:101530982-101531004 GCACTTTGGGATGCTGAAGCAGG + Intronic
1045655968 8:104386872-104386894 GCACTTTGGGATGCTGAAGCGGG - Intronic
1045746886 8:105432851-105432873 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1045747520 8:105440903-105440925 GCACCATGGGAGGCTGAGGCGGG + Intronic
1047338554 8:123958354-123958376 GGCCAATGGGGTGCTCCAGCAGG + Intronic
1048013679 8:130479145-130479167 GCCCCATGGGGTACTAAAGCAGG + Intergenic
1048334494 8:133492472-133492494 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1048478125 8:134761453-134761475 GCACTTTGGGATGCTGAAGCCGG + Intergenic
1048868980 8:138781734-138781756 GCACCAAGTGGTGTTGGAGCTGG - Intronic
1049038723 8:140096938-140096960 GCACTGTGAGGTGCTGCAGGAGG - Intronic
1049186227 8:141255467-141255489 GCACATTGGGGGGCTGAAGCAGG + Intronic
1050166818 9:2773267-2773289 ACACAGTGGTGTGCTGCAGCTGG + Intronic
1050888236 9:10791407-10791429 GCTCCATGTGAAGCTGCAGCTGG - Intergenic
1051779324 9:20671830-20671852 TCACTATGGAGTGCTGCCGCTGG + Intronic
1053243445 9:36515702-36515724 GCACTTTGGGAGGCTGCAGCGGG + Intergenic
1056551180 9:87653938-87653960 GCACATTGGGGGGCTGAAGCGGG - Intronic
1057381186 9:94568949-94568971 GAACCATGGGGTGTTGCATAAGG - Intronic
1057744434 9:97740127-97740149 GAGCCATGGGATGCTGGAGCAGG + Intergenic
1058487576 9:105457871-105457893 GCTCCATGCGAGGCTGCAGCTGG + Intronic
1059982956 9:119793347-119793369 GCAGCATAGGGTGCTACTGCTGG + Intergenic
1060804655 9:126567103-126567125 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1061241192 9:129373758-129373780 GCACTATGGGAGGCTGAAGCAGG + Intergenic
1061563837 9:131424186-131424208 GCACTTTGGGGAGCTGAAGCAGG - Intronic
1061629420 9:131862613-131862635 TTCCAATGGGGTGCTGCAGCCGG - Intronic
1061896449 9:133651003-133651025 TGACCATGGGGTGCTGCAGCTGG - Intronic
1062423756 9:136496781-136496803 GCACCATGCCGCTCTGCAGCCGG + Exonic
1062682828 9:137791977-137791999 GCACCATGGGAGGCTGAGGCGGG - Intronic
1185781910 X:2855118-2855140 GTTCCATGGCGTGCTGTAGCAGG - Exonic
1186341074 X:8646683-8646705 GCACTTTGGGAGGCTGCAGCGGG + Intronic
1186430446 X:9500163-9500185 GCAACATGGGAGGCTGAAGCAGG + Intronic
1187090876 X:16095392-16095414 GCACTTTGGGATGCTGAAGCAGG - Intergenic
1187275282 X:17811344-17811366 GCACCCTCAGGTGCTGCTGCTGG + Intronic
1187319129 X:18224845-18224867 GCACTTTGGGATGCTGAAGCTGG - Intergenic
1190068824 X:47262509-47262531 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1190075980 X:47317532-47317554 GCACTTTGGGGGGCTGAAGCAGG - Intergenic
1190745724 X:53320901-53320923 GCACCGCGGGGAGCTGCACCGGG - Exonic
1192781191 X:74295395-74295417 CCACCATGGGATGATGTAGCAGG - Intergenic
1194146785 X:90276208-90276230 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1194970158 X:100334034-100334056 GCACTTTGGGATGCTGGAGCAGG - Intronic
1195692757 X:107641602-107641624 GCACTTTGGGAGGCTGCAGCAGG - Intronic
1195892366 X:109709858-109709880 GCACTTTGGGAGGCTGCAGCAGG + Intronic
1195900169 X:109789365-109789387 GCACCTTGGGAGGCTGCAGCTGG - Intergenic
1197342805 X:125293593-125293615 CCACCATGGGATGATGCAGCAGG - Intergenic
1199754461 X:150851446-150851468 GCAGCACGGGGTCATGCAGCTGG + Intronic
1200211249 X:154347551-154347573 GCAGCTTTGGGTGCTGCAGTTGG + Intergenic
1200600111 Y:5195193-5195215 GCACTATGAGGTGCTGCACTAGG - Intronic
1201565948 Y:15365524-15365546 GCACTTTGGGAGGCTGCAGCAGG + Intergenic
1201633216 Y:16093020-16093042 GCACTTTGGGATGCTGAAGCAGG + Intergenic