ID: 980994943

View in Genome Browser
Species Human (GRCh38)
Location 4:139771098-139771120
Sequence TTGGGTAAAGACTTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980994943_980994946 3 Left 980994943 4:139771098-139771120 CCATTCATGAAGTCTTTACCCAA 0: 1
1: 0
2: 1
3: 29
4: 280
Right 980994946 4:139771124-139771146 TACAGCTACAGTTTATAAAATGG 0: 1
1: 0
2: 2
3: 21
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980994943 Original CRISPR TTGGGTAAAGACTTCATGAA TGG (reversed) Intronic
900296424 1:1953879-1953901 TTGAGAAAAGACGTCATAAAGGG + Intronic
900384535 1:2403988-2404010 TTAGGTAAAGACTTTAGTAAAGG - Exonic
900824874 1:4918441-4918463 ATGAGTTAAGACTTCATGATTGG - Intergenic
905539348 1:38747666-38747688 TTAGGTGAAGACTTCAGGATGGG + Intergenic
906040335 1:42784259-42784281 TTGGGTAAGGATTTCAGGCATGG - Intronic
907957561 1:59244817-59244839 TTGGCTATACACTTCATGAAAGG + Intergenic
907972931 1:59402505-59402527 TTTGGTAAAGATTTGTTGAATGG + Intronic
908958094 1:69660616-69660638 TTGAATAAGGACTTAATGAAGGG + Intronic
909103647 1:71381614-71381636 TTGGGCAGATCCTTCATGAATGG - Intergenic
909762261 1:79305125-79305147 TTGGGTAAAGAGTTGATTCACGG - Intergenic
910322615 1:85965708-85965730 TTGAGTAAAGACCTAAAGAAAGG + Intronic
910660435 1:89666212-89666234 TAAGGTAAAGACTGCAAGAAGGG - Intronic
910775638 1:90872025-90872047 TTGAGTAAAGACTTGAAGAAGGG + Intergenic
911385491 1:97170197-97170219 TTGAGTAAGGACTGTATGAATGG + Intronic
911468102 1:98280443-98280465 TTGGGATAAGATTTTATGAAGGG + Intergenic
915397170 1:155594074-155594096 TTGAGTTGAGACTTGATGAATGG + Intergenic
916513515 1:165494634-165494656 TGGGGCAGAGACTTCGTGAATGG + Intergenic
916850890 1:168702507-168702529 TTGCTTAACGAGTTCATGAAGGG + Intronic
918069602 1:181125334-181125356 GTAGGAAAAGACTTCAAGAATGG + Intergenic
918361072 1:183758677-183758699 GAGGGTAGAGTCTTCATGAATGG - Intronic
919428148 1:197459570-197459592 GAGGGTAGAGCCTTCATGAATGG - Intronic
921411914 1:214845106-214845128 TCAGGTAAAGACTTCATCTAAGG - Intergenic
922101677 1:222482274-222482296 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
922262757 1:223957390-223957412 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
922285562 1:224167822-224167844 GAGGGTGAAGTCTTCATGAATGG + Intergenic
923961384 1:239088108-239088130 TTGGGTAAACCCCTCATGAAGGG - Intergenic
924344595 1:243062391-243062413 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
1064455869 10:15487115-15487137 TTCTGTAAAGACTTCATGAGAGG + Intergenic
1064570012 10:16682930-16682952 TTTGGTAGAGAATTCATGAAGGG - Intronic
1064630190 10:17302976-17302998 TTGGGTGAATACTGAATGAAAGG + Intergenic
1064856473 10:19773823-19773845 GAGGGTAAAGCCCTCATGAATGG - Intronic
1066731735 10:38442681-38442703 TTGAGTAAAGACTTGAAGGAGGG + Intergenic
1067018538 10:42775498-42775520 AAGGGTAGAGCCTTCATGAATGG + Intergenic
1067238552 10:44471706-44471728 TTGGGTAATGACTTCAGCACTGG + Intergenic
1067360865 10:45577051-45577073 GAGGGCAGAGACTTCATGAATGG + Intronic
1069443785 10:68454375-68454397 TTGGGTTAAGACTCCACCAAAGG + Intronic
1069715309 10:70517070-70517092 GTGGGTAAAGACCTCAGAAAAGG - Intronic
1070484096 10:76913269-76913291 TTGGTTAATAACTCCATGAAGGG - Intronic
1071279686 10:84089292-84089314 GTGGGTAGAGCCTTCATGAATGG + Intergenic
1071685469 10:87750290-87750312 TTGGGTATATACTAAATGAAGGG - Intergenic
1072125005 10:92437723-92437745 TTGGTGAAAGACTTCACAAAAGG + Intergenic
1072290024 10:93956126-93956148 TTGGGTAAATGCTCCATGATTGG - Intergenic
1072557917 10:96538470-96538492 TTGGCAAAAGACTTCTTAAATGG + Intronic
1073991282 10:109264874-109264896 TTGGGTACTGACTTCAAGAGAGG + Intergenic
1078712114 11:13803549-13803571 GAGGGTAAAGCCCTCATGAATGG + Intergenic
1079263044 11:18902204-18902226 ATGGGCAATGACTTCATGACTGG + Intergenic
1080090862 11:28347335-28347357 TTGGCTGAAGGATTCATGAATGG + Intergenic
1081121680 11:39274081-39274103 TTGGGTAAAACCCTCATGACTGG - Intergenic
1081798883 11:45843366-45843388 TTGGGTAAATATTTGATGATTGG - Intergenic
1081890038 11:46533546-46533568 TTGGGTGAAGAGCTGATGAACGG - Intronic
1082181642 11:49127322-49127344 TTGGTTAAAGGCTTTATTAAAGG + Intergenic
1084151808 11:67291055-67291077 GTGCGTCAAGACTTGATGAAGGG + Intronic
1085166188 11:74401839-74401861 CTGGGTAAAGAATATATGAATGG + Intergenic
1085550515 11:77366085-77366107 TTGGGTATAGATTTCTTGACTGG - Intronic
1085949732 11:81315445-81315467 GAGGGTGAAGACTTCATGATGGG - Intergenic
1086019032 11:82203668-82203690 TTGGGTAAAGAAATAATGAAAGG + Intergenic
1086683852 11:89707519-89707541 TTGGTTAAAGGCTTTATTAAAGG - Intergenic
1087336205 11:96847902-96847924 GAGGGTAGAGCCTTCATGAATGG + Intergenic
1093942924 12:25074332-25074354 TTGGGAAATGACTCCATGAAAGG - Intronic
1096708335 12:53437399-53437421 ATGGGCAAAGATTTCATGATGGG + Intergenic
1097375158 12:58834742-58834764 TTTGGCACAGACCTCATGAATGG - Intergenic
1099266949 12:80459734-80459756 TTCTGAAAAGACTTCATCAAAGG + Intronic
1099773122 12:87089502-87089524 AAGGGTAGAGTCTTCATGAATGG - Intergenic
1100226908 12:92567179-92567201 ATGGGCAAAGACTTCATGACTGG - Intergenic
1100702467 12:97163044-97163066 TGGGGCAAAGCCCTCATGAATGG + Intergenic
1103015284 12:117489658-117489680 CTGGGTAAAGACTTTAGAAAAGG - Intronic
1105286736 13:19010606-19010628 TTAGGAAAAGATGTCATGAATGG + Intergenic
1105657919 13:22460339-22460361 TTAGGTAAAAAATTAATGAAGGG - Intergenic
1106956569 13:34943836-34943858 GTGGGTAAAGACTAAAGGAAAGG + Intronic
1107786251 13:43960981-43961003 GAGGGTAGAAACTTCATGAATGG + Intergenic
1108123029 13:47210233-47210255 TTGGGAAAAGAATTCAGAAATGG - Intergenic
1108281451 13:48866227-48866249 TAGGGTGATGCCTTCATGAATGG + Intergenic
1108838667 13:54583935-54583957 TTGCCTAATGCCTTCATGAAAGG + Intergenic
1108849471 13:54709942-54709964 AAGTGTAAAGACTGCATGAATGG + Intergenic
1109052832 13:57506695-57506717 TTGGGTCAAGACTTCATATAAGG - Intergenic
1110183142 13:72641390-72641412 GTGGGGAATCACTTCATGAAGGG - Intergenic
1110537909 13:76673206-76673228 TTGGTTAAGGACTTCGAGAAGGG - Intergenic
1110804771 13:79741486-79741508 TTAGGTAAAGAATTCATTACAGG - Intergenic
1110820358 13:79908384-79908406 TTGGGTAAAGAGCTCAGGAGAGG + Intergenic
1111086578 13:83382756-83382778 TGGGATAAAGACTTTATGAAGGG + Intergenic
1112240480 13:97676692-97676714 GTGGGTGGAGCCTTCATGAATGG - Intergenic
1112758461 13:102667363-102667385 TTGAGCAAATACTTCATGTAAGG + Intronic
1116010947 14:39351587-39351609 GGGGGTGGAGACTTCATGAATGG + Intronic
1116108785 14:40548063-40548085 TTGGGTAGATACTTCAGGAAAGG - Intergenic
1116459349 14:45154098-45154120 TTGGCTAAAGACATATTGAAGGG + Intronic
1116627900 14:47290240-47290262 AAGGGTAGAGACCTCATGAATGG + Intronic
1116978713 14:51144561-51144583 TTGGGTCAATTCTTCATCAAGGG - Intergenic
1117714274 14:58564416-58564438 TTGGGTGAAAAATACATGAAAGG + Intergenic
1118355604 14:65011126-65011148 TGAGGTAAAGACTACATGAAGGG + Intronic
1120002745 14:79321934-79321956 GTGAATTAAGACTTCATGAAAGG + Intronic
1120041606 14:79759684-79759706 TTGGGTAAAAACTTTATGTCAGG - Intronic
1120430462 14:84407286-84407308 TTCGGTAAATTCTTCATGTATGG - Intergenic
1120670185 14:87354110-87354132 TAGGGTAGAGCCCTCATGAATGG + Intergenic
1122390892 14:101382691-101382713 TTGGGCAGAGCCCTCATGAATGG + Intergenic
1122868897 14:104625048-104625070 TAAGGCAAAGACTGCATGAAAGG + Intergenic
1123777140 15:23591052-23591074 TTGGGAAAAGGCATCAGGAAAGG - Intronic
1125454387 15:39842543-39842565 TTGGGCAGAGTCCTCATGAATGG + Intronic
1125873173 15:43120912-43120934 GAGGGTAAAGCCCTCATGAATGG - Intronic
1126368940 15:47925490-47925512 TTGCCTAAAGACATCAGGAAAGG + Intergenic
1128469842 15:67943048-67943070 GAGGGTAAAGCCCTCATGAATGG + Intergenic
1130804471 15:87304385-87304407 TTGGGTAACAATTTCATGAAAGG - Intergenic
1131451639 15:92545413-92545435 TAAGGGAAAGACTTCAAGAATGG - Intergenic
1131802538 15:96086088-96086110 ATGGGTGAAGACTTCATATATGG - Intergenic
1136310582 16:29406415-29406437 TTGTATAAACACGTCATGAATGG + Intergenic
1137989409 16:53138173-53138195 TAGGTTGAAGACTTCAAGAAGGG + Intronic
1138123387 16:54418961-54418983 CTGAGTACAAACTTCATGAAGGG + Intergenic
1138232302 16:55347415-55347437 CTGGAGAAAGGCTTCATGAAAGG + Intergenic
1138669714 16:58603749-58603771 TTGAGTAAAGACTTAAAGAGAGG - Intronic
1139093458 16:63676781-63676803 TAAGGTAAAGACCTCATGAATGG + Intergenic
1140807653 16:78547779-78547801 TGAGGCAAAGCCTTCATGAATGG - Intronic
1142512725 17:407772-407794 TTGGGTCAGGAATTCAGGAAAGG + Intergenic
1142728029 17:1830474-1830496 TGGGTTAAAGAGTTGATGAAAGG - Intronic
1144009849 17:11136564-11136586 AAGGGTAGAGACTTCATGAATGG - Intergenic
1144242629 17:13328273-13328295 TTGAGAAAAGACTTGAAGAAAGG + Intergenic
1150182180 17:63134717-63134739 TTGGTTGAAGACTACATGATAGG + Intronic
1151069624 17:71193903-71193925 TTGGGAGAAAACTTCCTGAATGG - Intergenic
1151382342 17:73734525-73734547 TTAGGAAAAGACTTCTTGACAGG - Intergenic
1151838886 17:76603236-76603258 TGGGGTAGATCCTTCATGAATGG - Intergenic
1152354911 17:79802094-79802116 TTGAGGAAAGAATTCAAGAAAGG + Intergenic
1152840826 17:82566991-82567013 TTGAGTAAATACTTGTTGAATGG + Intronic
1153912160 18:9713915-9713937 GAGGGTAGAGCCTTCATGAATGG - Intronic
1157423312 18:47563919-47563941 GAGGGTAAAGCCTTCATGAATGG + Intergenic
1158090975 18:53713254-53713276 TAGGGTAGAGCCTTCATGAATGG + Intergenic
1159564490 18:70033046-70033068 TGGGGTAGATCCTTCATGAATGG + Intronic
1161977264 19:7613443-7613465 TTGGGTAAGGACTTCCACAAGGG + Intronic
1161977828 19:7615886-7615908 TTGGGTAAAGACTTCCATAGGGG + Intronic
1165593181 19:36988593-36988615 AGGGGTGAATACTTCATGAATGG - Intronic
1166079608 19:40435348-40435370 TTGGGTAAAAACCTGAAGAAGGG - Intergenic
1166756377 19:45194808-45194830 AGGGGTAATGACTGCATGAAGGG + Intronic
1167182517 19:47915677-47915699 TTGGGTAAAGACTGAATTTAAGG + Intergenic
1167183186 19:47921028-47921050 TTGGGTAAAGACTGAATTTAAGG + Intergenic
1167184482 19:47931429-47931451 TTGGGTAAAGACTGAATTTAAGG + Intergenic
1167185154 19:47936778-47936800 TTGGGTAAAGACTGAATTTAAGG + Intergenic
1167185808 19:47942171-47942193 TTGGGTAAAGACTGAATTTAAGG + Intergenic
1167929759 19:52854563-52854585 TTTGGTAGAGATTTCCTGAAGGG - Intronic
927057429 2:19378883-19378905 TTGGGTAAAGATGTTATGCATGG - Intergenic
928361371 2:30664722-30664744 TGGGGTGGAGCCTTCATGAATGG + Intergenic
928719186 2:34099578-34099600 TGAGGCAAAGCCTTCATGAATGG + Intergenic
928776785 2:34774884-34774906 TTGGGTCAACACTTCATGTCTGG + Intergenic
929130886 2:38569803-38569825 TTGGGAAAAGACTTAATGTTTGG - Exonic
929922679 2:46183758-46183780 TTGGGCTAAGACTTGAGGAATGG - Intronic
930311154 2:49740991-49741013 TTGTGTAAACACTTCATGAACGG - Intergenic
933144714 2:78837430-78837452 TTCAGTAAATATTTCATGAATGG + Intergenic
934126715 2:88900716-88900738 TAGGGTAAAGCCCTCATGAATGG + Intergenic
934944695 2:98531069-98531091 GAGGGTAGAGTCTTCATGAATGG - Intronic
935629145 2:105197520-105197542 TTGGCTAAAGACCTCCTGCAAGG - Intergenic
935671781 2:105562265-105562287 TTGTAAAAAGCCTTCATGAATGG + Intergenic
936659488 2:114526752-114526774 GAGGGTAGAGACTTCATAAATGG - Intronic
936702036 2:115023086-115023108 TTAGACAAAGACTTCATGACCGG + Intronic
937287934 2:120764973-120764995 CTGGGCAAATACTGCATGAATGG - Intronic
937651573 2:124325114-124325136 GAGGGTGAAGCCTTCATGAATGG + Intronic
937848016 2:126602596-126602618 TTGGGCAATGACAACATGAAAGG - Intergenic
939139938 2:138342846-138342868 TTGGGGAGATCCTTCATGAATGG + Intergenic
939412877 2:141854135-141854157 TTTGGAAATTACTTCATGAAAGG - Intronic
940327138 2:152437122-152437144 ATGGGTAAAGCCCTTATGAATGG - Intronic
941595167 2:167467303-167467325 TTGGGTTATTACTTCATGTAGGG + Intergenic
941613695 2:167694097-167694119 GAGGGTAAAGCCCTCATGAATGG - Intergenic
943800934 2:192056770-192056792 GGGGGTGAAGCCTTCATGAATGG + Intronic
944814280 2:203359755-203359777 TTAGGCAGAGCCTTCATGAATGG - Intronic
945084777 2:206119948-206119970 TGGGGCAAATCCTTCATGAATGG + Intronic
948842553 2:240661379-240661401 TGGGGTAGATTCTTCATGAATGG - Intergenic
1169182065 20:3578196-3578218 TGGGGTAAAAACTGCAAGAATGG - Intronic
1169635842 20:7690453-7690475 TGGGGTAGATCCTTCATGAATGG + Intergenic
1169842537 20:9955750-9955772 GTGGGGGAAGACATCATGAAAGG - Intergenic
1169995178 20:11547984-11548006 AAGGGTGAAGCCTTCATGAATGG - Intergenic
1171232663 20:23500155-23500177 TTGGGTAGATCCCTCATGAATGG - Intergenic
1171273746 20:23836713-23836735 TTGGGAAAAGATTAGATGAATGG + Intergenic
1173773026 20:45680257-45680279 GGGGGTAAATCCTTCATGAATGG + Intergenic
1174939787 20:54913631-54913653 TTGGGAAGAGCCTTGATGAAGGG + Intergenic
1177506699 21:22028506-22028528 AAGGGTGAAGCCTTCATGAATGG + Intergenic
1177666429 21:24165845-24165867 GGGGGTGAAGACTTCATGATTGG + Intergenic
1177867409 21:26528637-26528659 TTCTGTAAAGACTTGAGGAAGGG - Intronic
1178905749 21:36634604-36634626 TGGGGGAAAGTCCTCATGAATGG - Intergenic
1179027005 21:37687137-37687159 TTGGGTTAAAACTGCATGACAGG + Intronic
1179899828 21:44384575-44384597 CAGGGCAAAGCCTTCATGAATGG - Intronic
1181427699 22:22855173-22855195 TGGGGTAAAGACTCCATTCACGG - Intronic
1182084494 22:27551913-27551935 TGGGGTAGATCCTTCATGAATGG + Intergenic
1182884738 22:33763745-33763767 TTTGGTAAGCACTTCATTAAAGG - Intronic
1182915327 22:34024134-34024156 GAGGGTGAAGCCTTCATGAATGG - Intergenic
950840856 3:15967059-15967081 CTGGGTCAAGACTTCAGGCAAGG + Intergenic
953063702 3:39449851-39449873 AAGGGAGAAGACTTCATGAATGG + Intergenic
953201158 3:40779870-40779892 TTGGGTAAAGAAGTATTGAAAGG + Intergenic
955491251 3:59485312-59485334 GTGGGTGGAGGCTTCATGAATGG + Intergenic
955563968 3:60224395-60224417 TTGTGAAAAGAATTCAAGAAGGG + Intronic
956520635 3:70099988-70100010 TTTGGTGAAGCCTTCCTGAATGG + Intergenic
956953862 3:74314033-74314055 TGGGGTAAAGCCCTCATGAATGG - Intronic
959141694 3:102493665-102493687 TAGGGCAAAGCCCTCATGAATGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960343297 3:116501555-116501577 GTGGGCAAAGATTTCATGACAGG + Intronic
960347853 3:116556776-116556798 TTAGGTATACCCTTCATGAAAGG - Intronic
961683719 3:128615924-128615946 GAGGGTAGAGCCTTCATGAATGG + Intergenic
962066339 3:131985191-131985213 GAGGGTAGAGTCTTCATGAATGG - Intronic
962399535 3:135046412-135046434 TTTGGTAAATATTTAATGAATGG + Intronic
963392276 3:144680770-144680792 CAGGGTAGAGACCTCATGAAGGG - Intergenic
968437445 4:601348-601370 TTGGGTAAAGACATGAAGAGGGG - Intergenic
968676206 4:1881812-1881834 TTTGGGAAAGACTTCCTGATGGG + Intronic
969074772 4:4569240-4569262 TTGAGTAAAGACTTAGTGCAAGG - Intergenic
970006164 4:11412919-11412941 GAGGGTGAAGACGTCATGAATGG + Intronic
970296236 4:14633731-14633753 ATGGGTAAACACTTCTTGAGTGG + Intergenic
971431681 4:26574613-26574635 TTTGGTGAAGACCTCATGAAGGG + Intergenic
972436024 4:39036225-39036247 TTGGGTAAATATTTTTTGAATGG - Intergenic
979258121 4:118625308-118625330 TTGAGTAAAGACTTGAAGGAGGG + Intergenic
979330225 4:119415260-119415282 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
979792119 4:124797914-124797936 TTGGGTAGAGAGTTCCTAAAGGG - Intergenic
979977683 4:127217218-127217240 TTTGGTCAAGAATTCAGGAAAGG - Intergenic
980994943 4:139771098-139771120 TTGGGTAAAGACTTCATGAATGG - Intronic
981710749 4:147707092-147707114 TGGGTTCAAGACTTCATTAAAGG - Intergenic
982325445 4:154124837-154124859 GAGGGTAGAGACCTCATGAATGG - Intergenic
983468474 4:168125235-168125257 CTGGGTAAATGCCTCATGAACGG + Intronic
983488299 4:168357851-168357873 TTGGGTGGTGACTTAATGAACGG - Exonic
983546054 4:168965837-168965859 ATGGGCAAAGAATTCATGACTGG + Intronic
983873687 4:172851671-172851693 TTGGGCAATGACTTCATTATAGG + Intronic
984559583 4:181252701-181252723 GTGGGTGAAGCCCTCATGAATGG - Intergenic
985372505 4:189301307-189301329 TAGGGAATGGACTTCATGAAGGG + Intergenic
988103302 5:26709789-26709811 TGGGGTGAAGTTTTCATGAATGG - Intergenic
989651269 5:43693205-43693227 TTGAGAAAAGACATGATGAATGG - Intronic
990404123 5:55470762-55470784 TTAGGTGTAAACTTCATGAAAGG - Intronic
991395986 5:66205981-66206003 GAGGGTAAAGCCCTCATGAATGG - Intergenic
991965523 5:72086584-72086606 TTGGGTAAGGAATTCACCAAGGG - Intergenic
993850965 5:93008571-93008593 TGGGGTAGAGCCTTCCTGAAGGG + Intergenic
993972764 5:94440680-94440702 TTGGGTAATCATTTCATCAAAGG + Intronic
994673837 5:102796232-102796254 TTGGAGACTGACTTCATGAAGGG - Intronic
994897507 5:105724293-105724315 TTGGGTGGAGACTTCTGGAAAGG - Intergenic
996106482 5:119510519-119510541 TTGGGAAAAGACTTCTGGAATGG + Intronic
997942289 5:138168907-138168929 GTGGGTAAGGAGTTCATAAAAGG - Intronic
998795009 5:145809341-145809363 GTGTGTCAAGACTTGATGAAGGG - Intronic
999670119 5:153952337-153952359 TTGGGTAAATCCTTCCTGAATGG - Intergenic
1002851355 6:999436-999458 TAGGGTTAGGGCTTCATGAAAGG - Intergenic
1003269166 6:4592030-4592052 ATGGGGATAGATTTCATGAAAGG - Intergenic
1005314288 6:24589192-24589214 GAGGGTAAAGCCTTCATAAATGG + Intronic
1005382289 6:25248556-25248578 TTGGGTAATGACTTTATAAGAGG - Intergenic
1005419283 6:25632189-25632211 TTGGAAAATCACTTCATGAATGG + Intergenic
1006227637 6:32553758-32553780 TTGGGGAAAGACTTTATCCAGGG + Intronic
1008157276 6:48031695-48031717 TTGGGGAAATGCTTCATCAATGG - Intronic
1010069497 6:71726636-71726658 GAGGGTGGAGACTTCATGAATGG - Intergenic
1011769652 6:90661322-90661344 GAGGGTAAAGGCCTCATGAACGG + Intergenic
1012479071 6:99648076-99648098 ATAGGAAAGGACTTCATGAAAGG - Intergenic
1013875903 6:114827952-114827974 TTGGGTAATAAATACATGAAAGG - Intergenic
1014051830 6:116963853-116963875 TTGGGAAAAGGCTTTCTGAAAGG + Intergenic
1014487359 6:122016080-122016102 TGGGGGAAATCCTTCATGAACGG - Intergenic
1014748150 6:125224032-125224054 GTGTGTAAAGACTTCAGAAAAGG - Intronic
1014769869 6:125448452-125448474 TTTGGAAAAGACTTCATATAAGG - Intergenic
1016667809 6:146663484-146663506 GAGGGTAAAGCCCTCATGAATGG - Intronic
1018288691 6:162268287-162268309 TGGGGCAGAGCCTTCATGAATGG + Intronic
1019341141 7:509602-509624 TAGGGTAGAGGCTTCATGAATGG + Intronic
1021063011 7:16137149-16137171 AAGGGTAGAGACTTCATGAATGG + Intronic
1023400106 7:39786601-39786623 TTGAGTAAAGACTTGAAGGAGGG + Intergenic
1023559080 7:41453427-41453449 TGGGGCAGAGCCTTCATGAATGG + Intergenic
1024073035 7:45802351-45802373 TTGAGTAAAGACTTGAAGGAGGG + Intergenic
1024614748 7:51101951-51101973 GTTGGTGAAGCCTTCATGAATGG + Intronic
1024650298 7:51397833-51397855 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
1024748004 7:52430034-52430056 TGGAGTATAAACTTCATGAAAGG - Intergenic
1024827262 7:53405933-53405955 GAGGGCAAAGCCTTCATGAATGG + Intergenic
1024952216 7:54876253-54876275 ATGGGTAAAGCCATCATAAATGG + Intergenic
1025054441 7:55753486-55753508 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
1025132493 7:56383638-56383660 TTGAGTAAAGACTTGAAGGAGGG - Intergenic
1026995661 7:74614374-74614396 GAGGGTGAAGCCTTCATGAATGG + Intergenic
1027842453 7:83330357-83330379 TTGGGTAAAGAGGTCAGGAGTGG + Intergenic
1028837208 7:95388069-95388091 ATGGGCAAAGACTTCACAAATGG + Intronic
1029643857 7:101839092-101839114 TAGGGTAAAGCCCTCATGATGGG - Intronic
1029985355 7:104917753-104917775 TGGGGTCAAGACCTAATGAAGGG - Intergenic
1031036629 7:116794485-116794507 TTGGGCAAAGAAGTCATTAATGG + Intronic
1031806690 7:126316283-126316305 TTGGGGAAAGACTTGGTGAGAGG - Intergenic
1031848999 7:126841202-126841224 GTGGGTCAAGAATTCAGGAAGGG + Intronic
1032050422 7:128646046-128646068 TTGAGTAAAGACTTGAAGGAGGG + Intergenic
1032433872 7:131884534-131884556 TAGGGTAGAAACCTCATGAATGG + Intergenic
1033486923 7:141799716-141799738 GAGGGTAGAGCCTTCATGAACGG + Intergenic
1033775205 7:144601757-144601779 GAGGGTGGAGACTTCATGAATGG - Intronic
1034184006 7:149160436-149160458 TGGGGTTAAGACTGCATGTAGGG - Intronic
1034209446 7:149350093-149350115 TGGGGTAAGGACCTCATGAGAGG - Intergenic
1035113105 7:156500922-156500944 ATGGGCAAAGACTTCATGGCTGG - Intergenic
1036751375 8:11445574-11445596 TTTGGTAAAGACTTCAGCTATGG + Intronic
1037097221 8:15000327-15000349 TGGGATAAAGCCTTCATGAATGG + Intronic
1037196182 8:16193244-16193266 TTGAGTAAAGACTCCATGTTTGG + Intronic
1037555588 8:20018966-20018988 GGGGGTAGAGTCTTCATGAATGG + Intergenic
1042350207 8:67769355-67769377 TAGGGTAGAGACCTCTTGAATGG - Intergenic
1043066638 8:75579513-75579535 TTGGGCAGAGCCTTCATGAATGG + Intergenic
1045010430 8:97954096-97954118 CTGGGTAACGACTTCAAGTAAGG - Intronic
1046913267 8:119652238-119652260 GAGGGTAGAGGCTTCATGAATGG - Intronic
1047012435 8:120686494-120686516 TGAGGTTAATACTTCATGAATGG - Intronic
1049530218 8:143150764-143150786 TTGTATAAAGACATCCTGAACGG + Intergenic
1050288778 9:4131458-4131480 TGGGATAGAGCCTTCATGAATGG + Intronic
1051056563 9:12994481-12994503 CTTGGAAAAGACTTCATGAGCGG - Intergenic
1052401987 9:28012094-28012116 TTGGTTTAGGACTTCATAAAAGG + Intronic
1053088887 9:35254438-35254460 AAGGGTGGAGACTTCATGAATGG - Intronic
1055856943 9:80699996-80700018 TTGGTTAAAGAGTGCAGGAATGG - Intergenic
1058629546 9:106972401-106972423 TTGGGTCCAGGCTTCATGGAAGG + Intronic
1060776524 9:126378682-126378704 GTGTGTAAAGGCATCATGAAGGG - Intronic
1186157117 X:6737439-6737461 TTGAGCAAAGACCTCAAGAAGGG + Intergenic
1186595315 X:10975040-10975062 TTTTATAAAGACTCCATGAATGG + Intergenic
1187129439 X:16488255-16488277 GAGGGTAGAGACTTCATGAATGG - Intergenic
1187221251 X:17328207-17328229 GTGGGCAGAGCCTTCATGAAAGG - Intergenic
1187471595 X:19574611-19574633 TGGGGCAAAGCCCTCATGAATGG - Intronic
1187608634 X:20915580-20915602 GAAGGTGAAGACTTCATGAACGG - Intergenic
1188017176 X:25118198-25118220 ATGGGCAAGGACTTCATGACTGG - Intergenic
1188111590 X:26200340-26200362 CTGGGTATAAGCTTCATGAAAGG + Intergenic
1190412579 X:50151544-50151566 GAGGGTAGAGCCTTCATGAATGG + Intergenic
1191756413 X:64597335-64597357 ATGGGCAAGGACTTCATGACTGG + Intergenic
1191788227 X:64940459-64940481 ATGGGCAAAGACTTCATGACTGG - Intronic
1192964860 X:76166520-76166542 TGGGGTAGAGCCCTCATGAATGG - Intergenic
1194828471 X:98592400-98592422 TTATTTAAAGACTTTATGAAAGG - Intergenic
1198169287 X:134090055-134090077 TGGGGTGAATCCTTCATGAATGG - Intergenic
1199183591 X:144888566-144888588 TAGGGTAGAGCCCTCATGAATGG - Intergenic
1199234612 X:145476569-145476591 TTATTTAAAGACTTTATGAAAGG - Intergenic
1199503451 X:148535539-148535561 TTGAGTAGAGACTTCAGAAATGG - Intronic
1200414056 Y:2889759-2889781 TGGGGCAAAGAATTCATGGAAGG - Intronic
1200499529 Y:3928735-3928757 TTTGGTGAAGACTTCATGCCTGG + Intergenic
1200909928 Y:8522934-8522956 TTGGGAAAAGGATTCATGAGGGG + Intergenic
1201451639 Y:14121860-14121882 GAGGGAAAAGCCTTCATGAATGG + Intergenic
1202183715 Y:22161086-22161108 TTGGGAAAAGGCTTCTGGAAGGG - Intergenic
1202207644 Y:22425315-22425337 TTGGGAAAAGGCTTCTGGAAGGG + Intergenic