ID: 981001547

View in Genome Browser
Species Human (GRCh38)
Location 4:139833563-139833585
Sequence CAAGATCATCACAACCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981001546_981001547 -2 Left 981001546 4:139833542-139833564 CCGAGAAACAACACTTTCTGGCA 0: 1
1: 0
2: 4
3: 26
4: 251
Right 981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 108
981001543_981001547 28 Left 981001543 4:139833512-139833534 CCAAGGGGAAAGAGAAAAGACAG 0: 1
1: 0
2: 10
3: 70
4: 642
Right 981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981001547 Original CRISPR CAAGATCATCACAACCCTAG TGG Intronic
904956139 1:34285388-34285410 CAAGATCATGACCAGCCAAGTGG - Intergenic
905372693 1:37492992-37493014 CAAGTTCACCACAGCACTAGAGG + Exonic
906898089 1:49801467-49801489 CAATATAATCACAAACATAGTGG - Intronic
906944811 1:50286619-50286641 CAAGCTCACCACAACCCTTTAGG - Intergenic
909283880 1:73790355-73790377 GAACATCACCACCACCCTAGGGG - Intergenic
913700920 1:121373847-121373869 CAATATCCTCACACCCCTAAGGG - Intronic
914041470 1:144054314-144054336 CAATATCCTCACACCCCTAAGGG - Intergenic
914136616 1:144906176-144906198 CAATATCCTCACACCCCTAAGGG + Intronic
916764384 1:167846105-167846127 CAAGACCCTGGCAACCCTAGTGG - Exonic
920488339 1:206392565-206392587 CAATATCCTCACACCCCTAAGGG - Intronic
923208860 1:231784974-231784996 CAAGATCATCTGAAGTCTAGAGG + Intronic
923741640 1:236660029-236660051 CAATAGCATCAGAACCCAAGAGG + Intergenic
1064103198 10:12480565-12480587 CAAGATCATCTGAGCCCAAGTGG - Intronic
1067340157 10:45394486-45394508 TAAAACCATCAAAACCCTAGAGG + Intronic
1067825032 10:49565108-49565130 CAACTTCATCTCAGCCCTAGGGG - Intergenic
1075169527 10:120100625-120100647 CTAGAGCATCACAAACCCAGGGG + Intergenic
1081453935 11:43202338-43202360 TAAAACCATCAAAACCCTAGAGG - Intergenic
1083769772 11:64860094-64860116 CAAGATCATCAACACCCCCGAGG - Exonic
1089148978 11:116350291-116350313 CAGGAGCATCTCAACCCTAGTGG - Intergenic
1091708598 12:2719123-2719145 AAGGAACATCACATCCCTAGAGG + Intergenic
1092481231 12:8860874-8860896 CATCATCAACACCACCCTAGAGG - Exonic
1098705038 12:73676411-73676433 TAAAATCATAAAAACCCTAGAGG + Intergenic
1099658314 12:85523777-85523799 CAATCTCATAACAACCCTATGGG + Intergenic
1101086985 12:101246261-101246283 CATCATCATCAGAATCCTAGTGG - Intergenic
1101560665 12:105854740-105854762 AAACATCATAACAACCCTATGGG - Intergenic
1102151248 12:110690007-110690029 ACAGATCACCACAAACCTAGTGG + Intronic
1105477897 13:20744793-20744815 CCAAATCATAAAAACCCTAGAGG - Intronic
1113162274 13:107395341-107395363 CAAGATCTTCCCAACACTAAAGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127931411 15:63599866-63599888 CAGGCTCCTCACAACCCCAGTGG + Intronic
1129009652 15:72403884-72403906 CAAGATCCTCACAACTCTGAAGG - Intronic
1133538917 16:6729571-6729593 GAATATTATCAAAACCCTAGAGG + Intronic
1133554752 16:6895176-6895198 CTAGAACATCACAAAACTAGAGG - Intronic
1137335256 16:47542106-47542128 CAAAACCATAAAAACCCTAGAGG - Intronic
1141319617 16:82995117-82995139 AATTATCATCACAACCCAAGTGG + Intronic
1146630324 17:34464878-34464900 CAAGTTCTTCCCAATCCTAGGGG - Intergenic
1147865205 17:43547263-43547285 CCAGATCATCAGAACCTTTGGGG - Intronic
1149819262 17:59758994-59759016 GAAGATCACCAGAACTCTAGAGG + Intronic
1158255474 18:55543156-55543178 CATCATCATCACAACCCTACTGG + Intronic
1158373839 18:56840727-56840749 GAAGATCATCTGAACCCGAGAGG + Intronic
1158385675 18:56988279-56988301 TGAGATAATCACACCCCTAGAGG - Intronic
1166245298 19:41521431-41521453 CACGTTCATCACAACGCTTGAGG - Intergenic
1167960605 19:53102062-53102084 CAACATCGTCAGAATCCTAGGGG - Intronic
930535243 2:52637715-52637737 GAAGATTATAACAAACCTAGTGG + Intergenic
930722034 2:54647097-54647119 GGAGAACATCACAACCATAGCGG - Intronic
932072847 2:68637880-68637902 CAATATCATGACAGACCTAGAGG + Intergenic
933308126 2:80627817-80627839 AAAAATCATAAAAACCCTAGAGG - Intronic
937018220 2:118626143-118626165 CAAAATCTTCACAATCTTAGCGG - Intergenic
937023951 2:118682094-118682116 CAAGCTCATCACAGCCCCAGGGG - Intergenic
938725820 2:134108218-134108240 CAAAATTACCACAAACCTAGTGG - Intergenic
941554528 2:166960170-166960192 CAAGAATATCACAACCTTGGAGG + Intronic
942801350 2:179879915-179879937 CAAAGTGATCACAACCCCAGTGG - Intergenic
946612004 2:221468868-221468890 CAAGATGACAACAACCATAGTGG - Intronic
948236225 2:236393237-236393259 GAAGGTCATCAGAACCCTAAAGG - Intronic
1177260454 21:18723283-18723305 CTAGATAATCACAACTCTACCGG + Intergenic
1177341630 21:19810710-19810732 CAAGCTCATAACAACTCTAAAGG - Intergenic
1182419970 22:30244290-30244312 CATCATCATCACCACCCTAAGGG + Intronic
1185376298 22:50484043-50484065 CATGATCACCCCAACTCTAGAGG + Exonic
949518024 3:4824799-4824821 CAACCACTTCACAACCCTAGGGG + Intronic
949667969 3:6363527-6363549 CAAAACCATAAAAACCCTAGAGG + Intergenic
951459148 3:22930429-22930451 CAAAACCATAAAAACCCTAGAGG + Intergenic
962240126 3:133745208-133745230 CAAGCTCATATCAAGCCTAGTGG - Intergenic
965260398 3:166476105-166476127 CAAAATAATCACTACCCCAGAGG + Intergenic
972762316 4:42118993-42119015 CTAGATCAAGACAACCTTAGGGG - Intronic
972939241 4:44177288-44177310 CCAGATCATCACATTCCTGGGGG - Intronic
973942384 4:55924045-55924067 CTACCTCATCTCAACCCTAGTGG + Intergenic
975415202 4:74097937-74097959 AAAGAGCATCCCAAGCCTAGAGG - Intronic
976432516 4:84979174-84979196 CAATATCATCACTAACGTAGTGG - Intergenic
977818580 4:101444683-101444705 CAAAACCATAAAAACCCTAGAGG + Intronic
981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG + Intronic
981598552 4:146456667-146456689 CAAGATGCTCACAAACCAAGAGG + Intronic
981601630 4:146495517-146495539 CAAGATCATCACAGTCCAAATGG - Intronic
987746520 5:21980610-21980632 TAAGTTCATTACAACCCCAGAGG - Intronic
989633956 5:43514972-43514994 GAAAAAAATCACAACCCTAGAGG + Exonic
992351077 5:75929447-75929469 CATGATAATCACATTCCTAGAGG - Intergenic
996392321 5:122974769-122974791 CAAAAACATCACATCCCTGGAGG - Intronic
997989733 5:138534323-138534345 AAAGATCTTCACAAACCCAGTGG + Intronic
1000463847 5:161551374-161551396 TAAGATCATAAAAACCCTAGAGG - Intronic
1000922047 5:167149857-167149879 CAAGATACTCACAAGCCTAGTGG - Intergenic
1003822098 6:9910103-9910125 CAAGATAATCAAAACCTTGGAGG + Intronic
1004674740 6:17830687-17830709 CAAGATCAACACAAGCCTAAAGG - Intronic
1007328450 6:41082652-41082674 CAAAATAATCAGATCCCTAGAGG - Intronic
1008179838 6:48314849-48314871 CAAGATGATCACACCACAAGAGG + Intergenic
1010202243 6:73292632-73292654 CAATATTATCACAACCTTTGGGG - Intronic
1010517051 6:76785973-76785995 TAAAATCATAAAAACCCTAGAGG + Intergenic
1010899550 6:81409189-81409211 TAAAATCATAAAAACCCTAGAGG + Intergenic
1015796149 6:137013465-137013487 AATTATCATAACAACCCTAGGGG + Intronic
1015995476 6:138991941-138991963 CAAAATCATCACAAACATGGTGG + Intergenic
1017688041 6:156933101-156933123 AAAGATCATTACAACTATAGTGG - Intronic
1023015072 7:35959455-35959477 CAAGATCATCAAAATGCTACCGG + Intergenic
1024065875 7:45735240-45735262 CAAGATCATCAAAATGCTACTGG - Intergenic
1027509614 7:79063479-79063501 CAAAATCCTAACACCCCTAGTGG + Intronic
1028442973 7:90884967-90884989 CAAAATCATAAAAACCCTAGAGG + Intronic
1029972068 7:104799630-104799652 CAGGATCATCAATACCCAAGAGG - Intronic
1033868917 7:145725434-145725456 CAAGATCATGGCAAGCCTTGTGG + Intergenic
1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG + Intergenic
1034581575 7:152048430-152048452 AAAGAACATCCCAAACCTAGAGG - Intronic
1046838934 8:118836459-118836481 CATGACCATCAAAACCCTAGGGG + Intergenic
1050694126 9:8260339-8260361 CAACTTCATCACAACCCTGAGGG + Intergenic
1050818534 9:9847557-9847579 CAAGAATATGACAAACCTAGGGG - Intronic
1051822615 9:21185284-21185306 CAAAACCATAAAAACCCTAGAGG - Intergenic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1057937899 9:99256336-99256358 CAATATCACCACATCCCTGGAGG - Intergenic
1058970728 9:110080455-110080477 CTAGACCATCAAAACCATAGAGG + Intronic
1059837298 9:118170306-118170328 CAAATTCATCACCACCCCAGTGG - Intergenic
1062285943 9:135772512-135772534 CAACATCATCGCCACCCCAGAGG + Intronic
1187285645 X:17900635-17900657 CATGATGAACACAACCCTATTGG - Intergenic
1187659678 X:21528452-21528474 CAAGTTCCTCACTACCCAAGAGG - Intronic
1189239000 X:39511373-39511395 CAAGATCATCACAAAGTGAGGGG + Intergenic
1189730121 X:44011413-44011435 ACAGATGATCACAAACCTAGTGG + Intergenic
1192573507 X:72224891-72224913 CAATATCACCTCAACCCTAATGG + Intronic
1194133904 X:90114905-90114927 AATGTTCATCATAACCCTAGCGG + Intergenic
1194861879 X:99009526-99009548 CTGAATCATCACAACCCTTGAGG - Intergenic
1195041824 X:101021672-101021694 GCAGACCATCACATCCCTAGTGG + Intronic
1195573571 X:106424097-106424119 CCAAATTATCACATCCCTAGAGG - Intergenic
1196093664 X:111775154-111775176 ATATATCATAACAACCCTAGTGG - Exonic
1199243627 X:145576755-145576777 CCAGATCATCAGTTCCCTAGGGG - Intergenic