ID: 981002440

View in Genome Browser
Species Human (GRCh38)
Location 4:139840659-139840681
Sequence CCTTATGAACAGGTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981002440 Original CRISPR CCTTATGAACAGGTGGAGGT GGG Intronic
901183937 1:7360101-7360123 ACTTATAAAAAGGTGGGGGTTGG - Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
904910356 1:33929990-33930012 CCAAATAAACAGGTGGTGGTAGG - Intronic
905904529 1:41609101-41609123 CCTAGGGAAGAGGTGGAGGTGGG + Intronic
907397238 1:54199887-54199909 GCTTATGAGCAGTTGGAGCTTGG - Intronic
907431770 1:54416358-54416380 CCTTATGGTGAGGTGGAGGGTGG - Intergenic
914196422 1:145450353-145450375 AATGATGAACAGGTGGAGGGAGG + Intergenic
914248707 1:145904619-145904641 CCTACTTAAGAGGTGGAGGTGGG - Intronic
915437840 1:155922443-155922465 CCTTATTAAAATGTTGAGGTGGG - Intronic
915999330 1:160599722-160599744 CATTATAATCAGGAGGAGGTGGG + Intergenic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
919453651 1:197799485-197799507 CCTGGTGAAGAGTTGGAGGTGGG + Intergenic
920805503 1:209230465-209230487 TGGTATGAACAGGTTGAGGTTGG - Intergenic
921068833 1:211642482-211642504 CCTTGGGAACAGGGGGAGGCTGG + Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064701296 10:18024095-18024117 CCTAGTGCCCAGGTGGAGGTGGG + Intronic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067747686 10:48948517-48948539 CCTTAGCAACAGGTAGAGCTGGG - Intronic
1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG + Intergenic
1070112328 10:73497697-73497719 CCTTTTGAACAGATGGAGTCAGG - Exonic
1070597806 10:77844952-77844974 CCCAATGCACAGGGGGAGGTGGG + Intronic
1070989182 10:80716298-80716320 GCTCATGAACAGGGGGAGGGTGG - Intergenic
1072205921 10:93205248-93205270 CCTTATGAAAAGGGGGAATTTGG - Intergenic
1072783412 10:98265194-98265216 CCAAATGAACTGGTGGAGGCAGG - Intronic
1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG + Exonic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1080317891 11:30970766-30970788 CCTGATGAAAAGGTTGAGTTGGG - Intronic
1083205814 11:61148376-61148398 CCTTTTTAACATGTGCAGGTTGG - Intronic
1083337674 11:61934663-61934685 CCTGAAGATCAGGTAGAGGTGGG - Intergenic
1087474432 11:98618839-98618861 ACTGATGAACAGGCAGAGGTTGG - Intergenic
1088683379 11:112264597-112264619 CCTTATGAACTGGGGGACATGGG + Intronic
1088691481 11:112332179-112332201 CCTTATGGATAGGTGCAGGATGG + Intergenic
1090469135 11:126963917-126963939 CGTTATGGACAAGTGCAGGTGGG - Intronic
1090903161 11:131050306-131050328 CCTTCAGATGAGGTGGAGGTGGG - Intergenic
1092236895 12:6816045-6816067 CCTTCTGGAAAGCTGGAGGTGGG - Exonic
1092527553 12:9318398-9318420 CCCTCTGATCAGGTGGGGGTGGG + Intergenic
1092539709 12:9413357-9413379 CCCTCTGATCAGGTGGGGGTAGG - Intergenic
1094524516 12:31222804-31222826 CCCTCTGATCAGGTGGGGGTGGG + Intergenic
1096672251 12:53206989-53207011 GCTTTTGGAGAGGTGGAGGTGGG + Intronic
1096846865 12:54412206-54412228 CTTTATGAACAGGATAAGGTAGG - Intronic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1097965020 12:65569990-65570012 CCTTCTGAAGAGTTGGAGTTGGG - Intergenic
1098909370 12:76193557-76193579 CGTGAAGAAAAGGTGGAGGTTGG + Intergenic
1100159987 12:91846815-91846837 CCTTAAGGACAGCTGCAGGTGGG - Intergenic
1100951122 12:99851372-99851394 CATGATGATCAGGTGGGGGTAGG - Intronic
1101940022 12:109093002-109093024 TCTGATGCACAGGTGGACGTGGG - Intronic
1102482950 12:113236460-113236482 ACTTAGGAAGAGGTGGAGTTTGG + Intronic
1103173920 12:118845161-118845183 CCTTATAAAAAAGTGGAGATTGG + Intergenic
1103859434 12:124000359-124000381 CTCTATGAACAGGCGAAGGTAGG - Intronic
1104182745 12:126398518-126398540 CCTTAAAGACAGGTGGAGATGGG - Intergenic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1108612611 13:52098908-52098930 CCTCATGAACATGTGCAGATAGG + Intronic
1109990261 13:70045804-70045826 TCTTATGAAAGAGTGGAGGTGGG - Intronic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1116600148 14:46910986-46911008 CCTATTGAAGGGGTGGAGGTTGG + Intronic
1119424871 14:74528625-74528647 CCTCATGGACAGGCGGATGTCGG + Exonic
1119556498 14:75557468-75557490 CCTGATAAAAAGGTGGAGTTTGG - Intergenic
1120721267 14:87891928-87891950 CATTAGGAAATGGTGGAGGTTGG + Intronic
1121555990 14:94837753-94837775 TCTTATGCACTTGTGGAGGTAGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1130386593 15:83417397-83417419 GCTGGGGAACAGGTGGAGGTGGG - Intergenic
1131251880 15:90836421-90836443 TCTTCTGAACAGCTGGAGTTGGG + Intergenic
1131325006 15:91434410-91434432 CCGTAGGAATAGGTGGGGGTTGG + Intergenic
1137589210 16:49683106-49683128 TCTTATGAACAGGTGGCAGAGGG + Intronic
1138344005 16:56308913-56308935 CCTGATGAAAAGGTGGGGGTGGG - Intronic
1139349191 16:66324804-66324826 CTTTAGGAAGAGGTGGAGGTGGG + Intergenic
1139708165 16:68756364-68756386 CTTTATGAACAGGTGGGGTGGGG + Intronic
1141053210 16:80792072-80792094 CCTTGGGAACAGGTGGATGGGGG + Intronic
1143052756 17:4140145-4140167 CCTTATGAAAATGTCCAGGTAGG - Intronic
1143713840 17:8753288-8753310 CCATATGAGGAGGTGGGGGTGGG - Intronic
1146138281 17:30342389-30342411 CCAGAGGAACAGGTGTAGGTTGG - Intergenic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1152560365 17:81075637-81075659 GCTGGTGGACAGGTGGAGGTAGG - Intronic
1154204165 18:12323319-12323341 CCATATGAACAGATGCACGTAGG - Intronic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1156124276 18:33883992-33884014 CGTCATGAAAGGGTGGAGGTGGG + Intronic
1156991164 18:43409505-43409527 CCCCATGAACATGTGGAGTTAGG + Intergenic
1158298528 18:56026772-56026794 CCTTAGAAACATGTGGAGGAGGG - Intergenic
1158334652 18:56402736-56402758 CCTTATGAAACGGAGAAGGTTGG + Intergenic
1158372503 18:56824902-56824924 CTTAATGAGCAGGTGGAAGTTGG + Intronic
1162456991 19:10791386-10791408 CCTTATAAAAAGGGGGAGTTGGG - Intronic
1164834174 19:31346901-31346923 CCTAATGGACATGTGGAGGAGGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166982466 19:46639338-46639360 CCCTAGGAAGAGGTGGAGGTGGG + Intergenic
1167885862 19:52499456-52499478 ACTTATGGACAGCTGAAGGTGGG - Intronic
1168497854 19:56869282-56869304 CCTTATGAAAAGGAGGAATTTGG - Intergenic
926307577 2:11649762-11649784 CCTTAAGAACAGTTGGATCTAGG + Intergenic
927512446 2:23652841-23652863 CCTGATAAAAAGGAGGAGGTGGG - Intronic
928199226 2:29236572-29236594 CCTTTAGATCAGGTGGGGGTGGG + Intronic
931377630 2:61721587-61721609 CCTGATCAGCAGGTGGAGGCAGG + Intergenic
932750853 2:74370825-74370847 CCTGAGGAAGAAGTGGAGGTGGG + Exonic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
939714384 2:145565393-145565415 CCTAAGACACAGGTGGAGGTAGG + Intergenic
942699695 2:178691620-178691642 CATTATGAAGAGGTGGAGACAGG - Intronic
943496180 2:188623479-188623501 CCTAATGAACAAGTGGATTTAGG + Intergenic
946380517 2:219345576-219345598 CCTAAAGAACAGGTGTTGGTCGG - Intergenic
946550360 2:220794381-220794403 CCCTATGAAATGGTAGAGGTAGG + Intergenic
948350917 2:237340193-237340215 CCTTATGACTAGGTGGCGCTTGG + Intronic
1170781200 20:19427160-19427182 CCATCTGAACACGTGGAGTTTGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176429811 21:6568606-6568628 CCCTATGATCAGGTGCAAGTGGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1178708656 21:34895241-34895263 CCTTTTAAACTAGTGGAGGTGGG - Intronic
1179193664 21:39144621-39144643 CCATGTGAACAAGTGGAGGCTGG + Intergenic
1179705205 21:43176068-43176090 CCCTATGATCAGGTGCAAGTGGG + Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1183006709 22:34909115-34909137 CCTTGTGAAAAGGGGAAGGTTGG - Intergenic
1183751606 22:39724148-39724170 TCTTATGGCCATGTGGAGGTGGG - Intergenic
1184234007 22:43173607-43173629 CCTTATGGACAGGTCCAGGCTGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
951657791 3:25028723-25028745 CCTTAAGCACAGGAAGAGGTGGG - Intergenic
952832456 3:37576511-37576533 CCTGATGGAAAGGTTGAGGTGGG + Intronic
956576089 3:70754281-70754303 CCTCATGAAAAGGTGCAGCTAGG + Intergenic
958029296 3:88087813-88087835 CCTTACGGACAGGTTGGGGTGGG + Intronic
958160932 3:89816163-89816185 CCTGAGTAACAGGTGGAGGTTGG - Intergenic
960249438 3:115436106-115436128 CCTTATGATTTGATGGAGGTTGG - Intergenic
962164388 3:133033924-133033946 CCATATGTACAGGAGGAGGGAGG + Intergenic
962234767 3:133698624-133698646 CCTCATGAAAAGGGGGAGTTTGG - Intergenic
962526002 3:136237992-136238014 CCTTGCGTCCAGGTGGAGGTGGG + Intergenic
965132116 3:164714472-164714494 CCTCATAAACAGGTGCAGTTTGG - Intergenic
966649603 3:182284888-182284910 CCTGCTGAACAGGTGAAGGAAGG - Intergenic
966831702 3:184015953-184015975 CCTTTTTAAAAGGTGGGGGTTGG + Intronic
970400024 4:15708462-15708484 CCTGATGATCTGGTGGAGGCTGG - Intronic
977762707 4:100758913-100758935 CATTGTGGGCAGGTGGAGGTAGG + Intronic
980533895 4:134090087-134090109 CATTAAGAAAAGGTGGAGTTGGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981295194 4:143123686-143123708 CCTGATCAACAGGGAGAGGTAGG + Intergenic
982273923 4:153620434-153620456 CCAAATTAACAGGTGAAGGTTGG + Intronic
982687599 4:158509848-158509870 CTTTAGGACAAGGTGGAGGTGGG - Intronic
985177573 4:187218121-187218143 CCTTATGAACTTTTAGAGGTTGG - Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
987192847 5:15497030-15497052 CCTTATAGCCAGGTGGGGGTGGG + Intergenic
988536510 5:32073818-32073840 CCTTGTGAGCTGGTGGAGGTGGG - Exonic
990333548 5:54750407-54750429 CCTTATGAAAAGGGGAAAGTTGG + Intergenic
991405281 5:66295204-66295226 CCTGATGAAGGGGTGGAGGGAGG + Intergenic
991904230 5:71492429-71492451 CCTTCTGAACAGGTAGAAGGTGG + Intronic
995859817 5:116629421-116629443 CCTGATGATCAGGAGGAGGTGGG + Intergenic
1000249687 5:159482213-159482235 GCTTATTAGCAGGTGGAGGGTGG - Intergenic
1002019355 5:176352738-176352760 TCTCTTGAACAGGTGGAGGAAGG - Exonic
1002357360 5:178641621-178641643 CCTGATGATCAGGAGGAGGCCGG - Intergenic
1004504898 6:16239455-16239477 CCTAAGGAACAGGTGGAGACCGG + Intronic
1005819413 6:29585263-29585285 CCTGATGTACAAGTGGAGGCTGG + Intronic
1005948447 6:30613036-30613058 GCTTAGGATGAGGTGGAGGTAGG - Intronic
1017569664 6:155731133-155731155 CCTTAGGAACAGGGGAAGGATGG + Intergenic
1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG + Intronic
1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG + Intronic
1021774288 7:24036901-24036923 GCTCATGAACATGTGGATGTTGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026079571 7:67205623-67205645 CATTATAACCAGGTGAAGGTGGG + Intronic
1026697275 7:72606359-72606381 CGTTATAACCAGGTGAAGGTGGG - Intronic
1027858519 7:83544690-83544712 GCCTATAAACAGGTAGAGGTGGG + Intronic
1034900640 7:154906112-154906134 CCTTATGAAAAGGGGGAATTGGG - Intergenic
1035921025 8:3676320-3676342 TCTGAAGAGCAGGTGGAGGTGGG + Intronic
1037642384 8:20758253-20758275 CCTGGGGAAAAGGTGGAGGTGGG - Intergenic
1039071625 8:33654150-33654172 ACATATGAACTGGTGGGGGTGGG - Intergenic
1042326585 8:67534944-67534966 ACTTATGAACATGTGGTGTTTGG + Intronic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1050216930 9:3337075-3337097 CCTTATGGGTAGGAGGAGGTAGG + Intronic
1051143539 9:14003520-14003542 CCTGATCATCAGGTGGAGGTAGG - Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054963575 9:70996844-70996866 TCCTATGAACAGGTAGATGTGGG + Intronic
1058982666 9:110184603-110184625 ACTTGTGAACAGCAGGAGGTCGG - Intergenic
1062570611 9:137183383-137183405 ACCTGTGAACAGGTAGAGGTGGG - Intronic
1062698310 9:137886482-137886504 AATGATGAACAGGTGGAGGGAGG - Intronic
1185673193 X:1827488-1827510 CCTTATGAAAAGGGGGAAATGGG + Intergenic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1187770839 X:22693959-22693981 CCTATTGAAAAGGTGGAGGGTGG - Intergenic
1189155891 X:38756430-38756452 CCTTAAGGCCAGGTGGAGATTGG + Intergenic
1190559624 X:51673981-51674003 CCTTATGGACAGCTCGGGGTTGG + Intergenic
1190564667 X:51719340-51719362 CCTTATGGACAGCTCGGGGTTGG - Intergenic
1191053050 X:56214574-56214596 CCTTATGAAAAGGGGAAGTTTGG + Intergenic
1192058439 X:67797842-67797864 ACTTATGAAAAGGTGGAAGTGGG + Intergenic
1193661225 X:84260949-84260971 CCTAATGAAAAGGTGGAGGGGGG + Intergenic
1195202047 X:102561561-102561583 CCTTCTGAAGATGGGGAGGTGGG - Intergenic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196902690 X:120401437-120401459 CCTGATTATCAGGAGGAGGTAGG + Intergenic
1198068854 X:133128029-133128051 CCTAATAAACAGGTGGAGGCCGG + Intergenic
1201483642 Y:14468806-14468828 CCTTATAAAAAGGGGGAGTTTGG + Intergenic