ID: 981005002

View in Genome Browser
Species Human (GRCh38)
Location 4:139865772-139865794
Sequence GGTCAGAGGAGGACCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981005002_981005008 18 Left 981005002 4:139865772-139865794 CCTGCTTGGGTCCTCCTCTGACC 0: 1
1: 0
2: 0
3: 28
4: 231
Right 981005008 4:139865813-139865835 GCAAGTAGTCTGCAGAAGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981005002 Original CRISPR GGTCAGAGGAGGACCCAAGC AGG (reversed) Intronic
900266961 1:1762254-1762276 GCTCAGATCATGACCCAAGCCGG + Intronic
901872282 1:12145116-12145138 AGTCAGAGGAGGCCTCAGGCTGG - Intergenic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
902760580 1:18578276-18578298 GGTAAGGGGATGAGCCAAGCAGG + Intergenic
903182755 1:21613310-21613332 GGTCTGGGGAGGAGCCATGCTGG + Intronic
903454310 1:23476532-23476554 GGCCAGGAGAGGACCCAAGGAGG - Intronic
904320777 1:29696760-29696782 GGACAGAGGAGGACACTAACTGG + Intergenic
904594034 1:31631913-31631935 GGTTGGGGGAGGACCCAAGAGGG - Intronic
904824170 1:33264003-33264025 AGACAGAGCAGGCCCCAAGCAGG - Intronic
904916334 1:33973153-33973175 GGGCAGGGGAGGATCCTAGCAGG - Intronic
906193018 1:43910852-43910874 GGCCAGAGGAGGACCACAGTGGG - Intronic
906495568 1:46302272-46302294 GGGCCAAGGAGGCCCCAAGCGGG - Intronic
906680507 1:47722925-47722947 GGTAAACGGAGGTCCCAAGCAGG + Intergenic
907759374 1:57342974-57342996 GCTCAGAAGGGGACCCGAGCGGG + Intronic
907880926 1:58548705-58548727 GGGCAGAGGAGCAGCCAAGGGGG - Intergenic
908524686 1:64976424-64976446 GGTCAGAGGAGCAGCCAAGGTGG - Intergenic
909391614 1:75127182-75127204 GGTAAAAAGAGGACCCAAGATGG - Intergenic
915366473 1:155319724-155319746 GGGCAGAGGAGGAGTGAAGCTGG - Intronic
916596540 1:166249067-166249089 GATCAGGGGAGGAGCCAAGATGG - Intergenic
918680732 1:187349777-187349799 GGATAGAGGAGGAGCCAAGATGG - Intergenic
924712130 1:246538178-246538200 AGAGAGAGGAGGTCCCAAGCAGG - Intergenic
1062881131 10:979304-979326 GGGCAGAGGAAGACACAATCTGG - Intergenic
1066497828 10:35959584-35959606 GGTCAGAGAAGGAAACACGCAGG - Intergenic
1066535860 10:36390622-36390644 GGTCAGAGGAAGACACCAGGGGG + Intergenic
1066827097 10:39608262-39608284 GGTGGGAGGAGGAGCCAAGATGG - Intergenic
1070324968 10:75382904-75382926 GGTCAGAGGAGGAAGTAAGCTGG - Intergenic
1070742318 10:78911191-78911213 GGTAAGAGGATGAGCCAGGCTGG - Intergenic
1073214480 10:101829019-101829041 TGGGACAGGAGGACCCAAGCCGG - Intronic
1073336603 10:102714607-102714629 GGTGAGAGGAGGACCTGGGCTGG - Exonic
1074052564 10:109893522-109893544 CCTCAGAGGAGGACCCAAACAGG - Intronic
1076246531 10:128951199-128951221 AGTCAGAGGAGGACCCCAGGTGG + Intergenic
1077066374 11:642740-642762 GGTCAGAGGAAGGGCCAGGCGGG + Intergenic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1078108071 11:8371074-8371096 GGGCAGAGGAGGAACCATGAAGG + Intergenic
1081041792 11:38222849-38222871 GGTCAGAGGACCATCCAAGTGGG + Intergenic
1081335603 11:41862135-41862157 TGAGAGAGGAGGACCCAAGCAGG - Intergenic
1081731535 11:45375325-45375347 GGTTAGCGGAGCTCCCAAGCTGG + Intergenic
1084401493 11:68946467-68946489 GACCAGACGAGGACCCTAGCAGG - Intergenic
1084742208 11:71147030-71147052 GGTCCGGGGAGGACCAGAGCAGG + Intronic
1085076608 11:73597725-73597747 GGTGAGGGTGGGACCCAAGCAGG - Intronic
1085294393 11:75422802-75422824 GGACAGAGGAAGCCCCAGGCTGG - Intronic
1085464758 11:76716104-76716126 GGTCAGATGATGAACCATGCTGG + Intergenic
1087977052 11:104563765-104563787 GAGTAGAAGAGGACCCAAGCGGG + Intergenic
1089587866 11:119521384-119521406 GGTCAGAGGACTCCCCAAACAGG + Intergenic
1091263723 11:134253933-134253955 GGCCGGAGGAGGACCCGGGCAGG - Intronic
1095678852 12:44950955-44950977 TGTCGGAGGAGGAGCCAAGATGG + Intergenic
1095980757 12:47973445-47973467 GGACATAGGAGGGCCCGAGCAGG - Exonic
1096384602 12:51186755-51186777 GGTGGCAGGAGGGCCCAAGCAGG + Intergenic
1100588282 12:95999611-95999633 GACCAGAGGTGGACCCAACCTGG + Intergenic
1101285330 12:103306124-103306146 AGCCAGAGGAGCACCCAAGCAGG - Exonic
1103059498 12:117847420-117847442 AGCCAGAGGAGGGCCCAGGCAGG + Intronic
1103480910 12:121249154-121249176 GATCAGGAGAGGACCCAGGCAGG + Intronic
1105821795 13:24086883-24086905 GGTCAGAGGAGCAGCCCAGGAGG + Intronic
1107563356 13:41577202-41577224 GGTCAGAGGAGGGCCAGAGTGGG + Intronic
1110616528 13:77548042-77548064 GGTCAGAGGAGGACTGAGGTGGG - Intronic
1111998230 13:95186010-95186032 GGTTTGAGAGGGACCCAAGCAGG + Intronic
1113080913 13:106518785-106518807 GGTCAGAGGAAGAAAGAAGCAGG - Intronic
1117063190 14:51983413-51983435 GGTCAGAGGAGGCCTCATGGAGG - Intergenic
1120371226 14:83639294-83639316 TGTCAGGGGAGGAGCCAAGATGG + Intergenic
1120552128 14:85885591-85885613 GTACAGAGGAGGAGCCAAGATGG + Intergenic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1120979797 14:90279752-90279774 TGTCAGCGGAGGTCCCAGGCTGG - Intronic
1121441272 14:93951086-93951108 GGTGAGCGGAGGAGCCAAGGTGG - Exonic
1122354214 14:101113527-101113549 GGTCAGAGGAGGAGACATGACGG + Intergenic
1125290862 15:38145299-38145321 GGTGGAAAGAGGACCCAAGCTGG + Intergenic
1125887075 15:43237086-43237108 GGCCTGAGGAGCACCTAAGCAGG + Intronic
1127841660 15:62837194-62837216 GGTCAGAGAGGGACTCAAGAGGG - Intronic
1128537461 15:68501679-68501701 GGTCAGAGGAGGGCCAGTGCTGG - Intergenic
1128540477 15:68525441-68525463 GGTCATGGGAGGACTCAAGAAGG + Intergenic
1129360322 15:75020268-75020290 GGTCAGAGGAGAAGGCAGGCAGG + Exonic
1129854718 15:78815029-78815051 GGACAGAGGAGGAAGCAGGCAGG - Intronic
1130112432 15:80976936-80976958 GATCAGAAGAGGACCCCAGCAGG - Exonic
1132270477 15:100519937-100519959 GGCCAGAGGAGGGCCAAAGGGGG - Intronic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1133505521 16:6408486-6408508 GGTGAGAAAAGGACCCAGGCAGG - Intronic
1134050131 16:11131556-11131578 GCTCAGAGGAGCAGCCAGGCAGG + Intronic
1135325999 16:21526276-21526298 GGGGAGAGGAGGGCCCAAGGGGG + Intergenic
1137096422 16:36313974-36313996 TTTCAGAGGAGGAGCCAAGATGG - Intergenic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1137833270 16:51565100-51565122 GGACGGAGGAGAACCCAAGATGG + Intergenic
1142039034 16:87880967-87880989 GGGGAGAGGAGGTCCCAAGGGGG + Intergenic
1142713820 17:1737382-1737404 GGTCAGAGGAGGAGCTGACCAGG - Exonic
1142899909 17:3005397-3005419 GGGCAGAGGTGGACCAAAGGTGG - Exonic
1144765765 17:17731614-17731636 GATCAGAAGAGGACCCAGGTGGG + Intronic
1144837017 17:18161847-18161869 GGGCAGAGGTGGGCCCAAGCTGG + Intronic
1145987942 17:29060238-29060260 GGTCAGAGGAGGACTCACAGAGG + Intergenic
1146652754 17:34616620-34616642 TGCCAGAGGAGAACCCAGGCTGG + Intronic
1148153451 17:45409923-45409945 GGCCAGAGGAGGAGCCAAGAGGG + Intronic
1151287208 17:73121517-73121539 GGTCAGAGGAAGAGCCAAGTGGG - Intergenic
1151747083 17:76017567-76017589 GGTCAGTGGAGGAGCCAGGAGGG + Intronic
1152241754 17:79164682-79164704 GGGCAGTGGAGGTCCCAAGTGGG + Intronic
1152897816 17:82923415-82923437 GGTCAGAGAAGGACCTGACCAGG - Intronic
1157434948 18:47660367-47660389 GACCAGAGGAGGAGCCAAGATGG + Intergenic
1159946499 18:74447928-74447950 GGACCAAGGAGGACCCATGCAGG + Intronic
1160224153 18:76999164-76999186 GGTGAGGGGAGGACGCAAGCTGG + Intronic
1161289464 19:3485216-3485238 GGCCAGAGGAGGAGCCAGGAGGG + Intergenic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1164340265 19:24387596-24387618 GTTCAGGGGAGGAGCCAAGATGG - Intergenic
1167667787 19:50832790-50832812 GGTCAGAGAAGGCCTCAAGGAGG - Intronic
1168047585 19:53805095-53805117 AGTCAGAGGAGGGCAGAAGCAGG + Intronic
926019591 2:9483535-9483557 GGCCACAGGAGGACCTATGCTGG - Intronic
926736688 2:16078799-16078821 GGTCAGCTGAGGAACCAGGCTGG + Intergenic
927251292 2:20996964-20996986 AGTCAGAGAAGGGGCCAAGCTGG - Intergenic
929070194 2:38021373-38021395 GTGCAGAGGGGGACCCCAGCAGG - Intronic
930100147 2:47596986-47597008 GGTCAGACCAGGACCCACCCTGG + Intergenic
931434430 2:62234846-62234868 GGTCAGAGGAGCAGCCCACCTGG + Intergenic
931906687 2:66850376-66850398 GGTGAGAGTAGGAGCCACGCGGG - Intergenic
933164719 2:79063581-79063603 GGTTAGAGCAGGACCTAAGAAGG + Intergenic
933726209 2:85429209-85429231 GATAAGAGGAAGAGCCAAGCTGG - Intronic
936055445 2:109258807-109258829 GGTCAGAGCAGGACCCATCCAGG + Intronic
937216998 2:120319117-120319139 GGAGAGAGGAGGGCACAAGCAGG + Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938070341 2:128305104-128305126 GGTCAAATGGGGACCCAGGCAGG - Intronic
938310098 2:130284118-130284140 GGCCAGAGGAGGCCCCAACCTGG - Intergenic
938444822 2:131368251-131368273 GGCCAGAGGAGGCCCCAACCTGG + Intergenic
938548146 2:132353339-132353361 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
942210293 2:173663335-173663357 GATCAGAGGGGGACCACAGCAGG - Intergenic
944872672 2:203930414-203930436 GGTCATAGGAGGGACCAAGTGGG + Intergenic
945451355 2:210000029-210000051 GCTCAGAAGGGGACCCAAGCCGG + Intergenic
946905542 2:224412743-224412765 GGTGGGAAGAGGACCCGAGCTGG + Intergenic
948934757 2:241156101-241156123 GGTGAGAGGAGGAGCCAGGCTGG + Intronic
1169200517 20:3706956-3706978 GGTCAAGGGAGGGCCCAATCGGG - Intronic
1169226862 20:3862316-3862338 GGTCAGAGGAGGACTCCAGGGGG - Exonic
1170880552 20:20293241-20293263 AGTCAGAGGAGGAGCCAAAAGGG + Intronic
1171427920 20:25060014-25060036 GTCCAGAGGAGGACCCTGGCTGG + Intergenic
1171851596 20:30312359-30312381 TGACAGAGGAGGACCAAAGATGG - Intergenic
1171877017 20:30586111-30586133 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
1172007691 20:31828801-31828823 TGACAGAGGAGGACACAAACAGG + Intronic
1173156716 20:40619318-40619340 AGTCAGGGGAGGAGCCAAGATGG + Intergenic
1173554391 20:43955299-43955321 GGTCACAGGAGGGCCCATGGGGG + Intronic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1176009456 20:62884862-62884884 GGGCAGAGGAGGAGGGAAGCAGG + Intronic
1176038399 20:63051459-63051481 GGACAAAGGAGGAACCAAGGAGG - Intergenic
1180115982 21:45705343-45705365 GGTCACAGTAGGACCCAGACTGG + Intronic
1180137208 21:45869469-45869491 GGTCAGCAGAGGACCCTGGCAGG + Intronic
1180210265 21:46291597-46291619 GGTGTGAGGAGCACCCAGGCTGG + Intronic
1181139337 22:20792644-20792666 GGGAAGAAGCGGACCCAAGCTGG + Intronic
1181164010 22:20973915-20973937 GGTCTGGGGAGGAGCCAAGCTGG - Intronic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1182897883 22:33873799-33873821 GGGCAGGGCAGGACCCAAGTGGG - Intronic
1183277114 22:36905601-36905623 GGTCAGAGGAGGATCCACAGAGG - Intergenic
1183622711 22:38983845-38983867 GGCCAGAGTTGGACCCGAGCTGG + Intronic
1185107826 22:48884455-48884477 TGTCTGACCAGGACCCAAGCTGG + Intergenic
949561627 3:5208002-5208024 GGGCAGAGGAGAGCCCAGGCAGG + Intronic
950261340 3:11544958-11544980 GGTCGCAGGAGGAACCAAGAGGG + Intronic
951589042 3:24243513-24243535 GGTGAGGGAGGGACCCAAGCAGG - Intronic
955027725 3:55186614-55186636 GATGAGAGGAGGAGCCAAGCTGG + Intergenic
958576129 3:95951312-95951334 GGGTAGAAGGGGACCCAAGCGGG + Intergenic
960011846 3:112842153-112842175 GGTCAGGAGAGCACACAAGCTGG + Intronic
961369655 3:126421740-126421762 AGTTGGAAGAGGACCCAAGCTGG + Intronic
962882407 3:139590952-139590974 ACTCAGAGGAGGAGCCAAGATGG + Intronic
965220079 3:165918019-165918041 GAGCAGAGGGGGACCCCAGCAGG + Intergenic
965266847 3:166554326-166554348 GGTCAGAGCAGCAACCAAGGGGG + Intergenic
967453386 3:189652121-189652143 TGTGAGAGGAGGACCCAAAATGG + Intronic
968353460 3:198081197-198081219 CGGCAGAGGAGGAGCCGAGCGGG - Intergenic
968359466 3:198137239-198137261 GGTCAGAGGAGGTGCAGAGCAGG - Intergenic
971375587 4:26053348-26053370 GGAGAGAGCAGGATCCAAGCAGG + Intergenic
971465128 4:26949759-26949781 GATAAGAGGAGGAGCCAAGGAGG - Intronic
971496652 4:27273915-27273937 GGAGAGAGGAGAACCCAAGATGG + Intergenic
972361021 4:38325460-38325482 TCTCAGAAGGGGACCCAAGCAGG + Intergenic
972372551 4:38438645-38438667 AGTCAGAGGAGGGGCCAAGATGG - Intergenic
972681130 4:41307836-41307858 GGTGAGAGAAGGCTCCAAGCAGG + Intergenic
973387655 4:49524261-49524283 TGACAGAGGAGGAGCCAGGCCGG + Intergenic
975805258 4:78105731-78105753 GATGAGAGGAGGAGCCAAGATGG + Intronic
976005944 4:80431000-80431022 GGTCAGAGGAGGTCTCACGAAGG - Intronic
976620329 4:87120672-87120694 GGGCCGTGGAGGAACCAAGCCGG - Intronic
976778962 4:88737609-88737631 GGTCAGAGGAGGCCGAGAGCTGG - Intronic
978201092 4:106024286-106024308 GGCCAGGGGAGGACTAAAGCTGG - Intergenic
979485942 4:121270503-121270525 GGTAAGGAGAGGACCCAAGGGGG - Intergenic
979561865 4:122110089-122110111 GGGCGGAGGAGGAGCCAAGATGG + Intergenic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981540671 4:145843526-145843548 GGTAAGAGGAGGCCCCAAGTTGG - Intronic
981777427 4:148386022-148386044 GATAAGGGGAGGACCCAAGGTGG + Intronic
982198032 4:152935952-152935974 GGCGAGAGGAGGCGCCAAGCTGG - Intergenic
982691323 4:158550582-158550604 GGTCAGGGGTGGAGCCAAGATGG - Intronic
983312124 4:166077957-166077979 GGCCAGACAAGTACCCAAGCAGG + Exonic
983391893 4:167142284-167142306 GGTGAGATGAGAACCCAGGCTGG + Intronic
986755549 5:10832655-10832677 GGCCAGAGGAGGACATAACCAGG - Intergenic
987482020 5:18471812-18471834 CATCAGAGGAGGAGCCAAGATGG + Intergenic
987488695 5:18551260-18551282 GTGCAGAAGGGGACCCAAGCTGG + Intergenic
988020397 5:25614088-25614110 GCACAGAAGGGGACCCAAGCGGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989153514 5:38322420-38322442 GGCTAGAGGAGGATCCAAACTGG + Intronic
992895670 5:81243111-81243133 GGTAAGGGGAGGAGCCCAGCAGG + Intronic
992902754 5:81315363-81315385 GGTCATAGAAAGACTCAAGCTGG - Intergenic
994334278 5:98546661-98546683 AGTCAGAGGAGGAGCCAAGATGG + Intergenic
995419002 5:111941493-111941515 GCGCAGAGGAGGACACAAACAGG - Intronic
996704832 5:126486605-126486627 GGTCAGAGCCAGACCCAAGTTGG - Intronic
998364718 5:141621940-141621962 AGTCTGAGGAGGAGCTAAGCAGG + Intronic
999288334 5:150407346-150407368 GGTCAGAGGAGGATCCACAGTGG + Intronic
1001554127 5:172624741-172624763 GGTCAGAGGGGGACGAAGGCCGG - Intergenic
1002133085 5:177093132-177093154 GGGCAGAGGAGGACCCCACATGG + Exonic
1002160386 5:177311308-177311330 GGGCAGAGGAGGGCCCGACCAGG + Intronic
1002172623 5:177383946-177383968 TGTGAGATGAGGACCTAAGCTGG - Intronic
1003239871 6:4334742-4334764 TTTCAGAGGAGGAGCCAAGATGG - Intergenic
1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG + Intergenic
1006840462 6:37025349-37025371 GGTCAGGAGAGGACAAAAGCTGG + Intronic
1007268041 6:40612003-40612025 GGTCAGAGGAGAAGCCAGGGAGG + Intergenic
1007751916 6:44076199-44076221 GGTCAGAGCAAGACCCAAAGTGG + Intergenic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1008472069 6:51895650-51895672 GGTCACCGGAGGAGCCAAGATGG + Intronic
1009383495 6:63062051-63062073 TGTCACAGGAGGAACCAAGTGGG + Intergenic
1013621054 6:111889539-111889561 GGTCAGAGATGGACCTCAGCAGG + Intergenic
1013916213 6:115340204-115340226 GGTCAGATGATGACCCAAGGTGG - Intergenic
1015171480 6:130259662-130259684 GGTCAGAGGAGCACAAAACCTGG + Intronic
1017627271 6:156361248-156361270 GGTCGGAGGAGGAGCCAAGATGG + Intergenic
1017641529 6:156498806-156498828 GGCGAGAGGAGGACTGAAGCAGG + Intergenic
1018333072 6:162753601-162753623 TGTCAGAGGAGGAACCTAGTGGG + Intronic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1018579512 6:165296611-165296633 GTCCAGAGCGGGACCCAAGCGGG - Intronic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1020341286 7:7113918-7113940 AGGCAAAGGAGGACACAAGCAGG - Intergenic
1021939503 7:25665711-25665733 GCTCAGAGGAGAGCCTAAGCTGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024996954 7:55279428-55279450 TCTCAGAGCAGGACCCAGGCTGG + Intergenic
1025635133 7:63314953-63314975 TAACAGAGGAGGACCCAGGCTGG + Intergenic
1025647562 7:63433217-63433239 TAACAGAGGAGGACCCAGGCTGG - Intergenic
1026039923 7:66859726-66859748 GGTCTGAGGAGGAATCAAACAGG - Intergenic
1027741831 7:82018408-82018430 GGTAAGAGCAGGACCAAAACTGG + Intronic
1028200602 7:87956262-87956284 TTTCAGAGGAGGAGCCAAGATGG - Intronic
1028871459 7:95774751-95774773 GGACAGAGCAGCACCCAGGCTGG - Intronic
1029515699 7:101021755-101021777 GGTCAGAGGCTGCCCAAAGCTGG - Intronic
1029538703 7:101170670-101170692 GGGCAGAGGTGGACACCAGCAGG - Exonic
1030588016 7:111445690-111445712 GGGAAGAGGAGGAGCCAAGATGG + Intronic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1033442790 7:141395527-141395549 GCTCAGAGGAGGAGCAGAGCTGG + Intronic
1035888435 8:3318711-3318733 GGTCACAGGAGTTCCCTAGCTGG + Intronic
1038660651 8:29493803-29493825 GTTTAGGGGAGGACCCAGGCAGG - Intergenic
1039190956 8:34973627-34973649 GGCAAGGGGAGCACCCAAGCAGG - Intergenic
1039733454 8:40304996-40305018 GGAGACAGGAGGACCCAGGCTGG + Intergenic
1040661187 8:49577715-49577737 GGTCAGAGAAGTATTCAAGCAGG - Intergenic
1044190263 8:89308088-89308110 GGTCAGATTAGGACCCAACATGG + Intergenic
1044936188 8:97295596-97295618 GGTCGGAGGAGGAGCCAAGATGG + Intergenic
1045599597 8:103697631-103697653 GGTGGGAGGATGACCTAAGCTGG + Intronic
1048186766 8:132249196-132249218 GTGCAGAAGGGGACCCAAGCAGG + Intronic
1048983156 8:139714162-139714184 GGTCAGAGGAGGCCCCAGAGAGG + Intergenic
1049553594 8:143271716-143271738 GAGCAGAGGAGGTCCCAAGTAGG + Intronic
1049671789 8:143873277-143873299 GGACAGAGGTGGACCTCAGCAGG - Exonic
1049806668 8:144544096-144544118 GTGCAGAGGAGGACCAGAGCAGG - Intronic
1051259571 9:15249718-15249740 GGTCAGAGGGGAAGCCAAGCAGG + Intronic
1053833236 9:42106799-42106821 GGTCACAGCAGGATCCAAGAAGG + Intronic
1054597315 9:67080610-67080632 GGTCACAGCAGGATCCAAGAAGG - Intergenic
1054827957 9:69591616-69591638 GCCCAGAGGAGGCACCAAGCTGG + Intronic
1059432591 9:114259058-114259080 GCCCAGAGGAGGACCCTACCTGG + Intronic
1059435164 9:114271670-114271692 GGTCAGAGCGGGGCCCAAGACGG - Intronic
1061199828 9:129131393-129131415 TGTCAGAACAGGAACCAAGCTGG + Intronic
1061394879 9:130338326-130338348 GGTCAGAGGGGAACCCATGAAGG + Intronic
1061450889 9:130666509-130666531 GGTCTGGGCAGGACCGAAGCCGG + Intronic
1061488667 9:130933526-130933548 GGTCACTCGAGGAACCAAGCTGG - Intronic
1061512754 9:131070995-131071017 GGTGACAGGAGGAATCAAGCTGG + Intronic
1062137663 9:134938245-134938267 GGTCAGGGCAGGACCCAGACAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1187710199 X:22045703-22045725 GGCCAGAGGAGGGCCAAAGTAGG - Intronic
1192167449 X:68834781-68834803 GGTCAGAGAATGACCAAAGGGGG - Intronic
1192212080 X:69134058-69134080 GGTCCGAGGAGGACGCACTCTGG - Intergenic
1193582826 X:83286293-83286315 AGTCAGAGGAGGAGCCAAGATGG + Intergenic
1199421842 X:147653731-147653753 TGTCGGAGGAGGAGCCAAGATGG + Intergenic
1199622577 X:149713453-149713475 GGTCCTTGGAGGCCCCAAGCAGG + Intronic
1199998152 X:153039868-153039890 GGGCAGAGGAGGAACAAAGAGGG + Intergenic
1200397242 X:155998445-155998467 GGGGAGAGGAGGATCCAAGCAGG - Intronic