ID: 981008116

View in Genome Browser
Species Human (GRCh38)
Location 4:139896567-139896589
Sequence CCTCATTTAGTGTGGCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981008111_981008116 0 Left 981008111 4:139896544-139896566 CCATAATGGCTCCAGCGCAAGTC 0: 1
1: 0
2: 0
3: 5
4: 47
Right 981008116 4:139896567-139896589 CCTCATTTAGTGTGGCTTGATGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981008116 Original CRISPR CCTCATTTAGTGTGGCTTGA TGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
912146843 1:106804523-106804545 ACTAATTTAGAGTGGCTTTATGG - Intergenic
914209240 1:145563137-145563159 CCTTCTTTGGTGTTGCTTGAGGG + Intergenic
914368937 1:147005359-147005381 CCTTCTTTGGTGTTGCTTGAGGG - Intergenic
919665326 1:200285843-200285865 CAGCAGTTAGTGTAGCTTGATGG + Intergenic
923763019 1:236864402-236864424 CCGCATTTAATGAGCCTTGAAGG - Intronic
1063388834 10:5635343-5635365 CCTCAGTGATTTTGGCTTGAAGG - Intergenic
1076466382 10:130685113-130685135 CCTCAGCTGGAGTGGCTTGATGG + Intergenic
1078456793 11:11482006-11482028 CATAATTCAGTGTGGCTAGAGGG - Intronic
1084331685 11:68434019-68434041 CACCAGGTAGTGTGGCTTGAAGG + Intronic
1085572924 11:77574953-77574975 CCTCATTTTTTGTAGCTTGCTGG - Intronic
1091397483 12:162977-162999 CCTCATTTACTGTGGCTCAGTGG + Intronic
1091409088 12:227493-227515 CCTCGTCTAGCGTGGCTGGAAGG + Intronic
1096020028 12:48316330-48316352 CCTGTTTTTGTATGGCTTGAGGG - Intergenic
1102359606 12:112273127-112273149 CCTGTTTTAGTGTTGCTTTACGG + Intronic
1103323363 12:120104242-120104264 GCTCCTTTAGAGTGGCTAGATGG + Intronic
1105359523 13:19694377-19694399 CCTCCTTTAATGTGGCTTCTAGG - Intronic
1105776905 13:23670791-23670813 CCTCATTTAGTGCTGCTGGGAGG - Intronic
1108148272 13:47502431-47502453 CCACAGTTAATGAGGCTTGAGGG + Intergenic
1110358637 13:74599121-74599143 CTTCCTTTAGGGTGTCTTGATGG - Intergenic
1111184598 13:84716308-84716330 TATCATTTAGATTGGCTTGAAGG - Intergenic
1112590091 13:100755026-100755048 GCACATTTCATGTGGCTTGAAGG - Intergenic
1113666227 13:112143556-112143578 CCTCACTTAGTGAGGAATGAGGG + Intergenic
1115546401 14:34468359-34468381 CTTCATTGAATTTGGCTTGAAGG - Intergenic
1123929341 15:25154153-25154175 CATGTTTTTGTGTGGCTTGATGG - Intergenic
1124651726 15:31479025-31479047 CCTGTTTTAGTGTGGCTGGCCGG - Exonic
1127158988 15:56160557-56160579 CCTGAATCAGTGTCGCTTGAGGG - Intronic
1128108693 15:65062676-65062698 GCTCATTTGGTGAGCCTTGAGGG - Intronic
1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG + Intergenic
1138272752 16:55707808-55707830 CCTCATTTAGTTTGGGGTGAAGG - Intergenic
1140050325 16:71475056-71475078 AATCATTAACTGTGGCTTGAGGG + Exonic
1140930518 16:79623379-79623401 CCTCACTTCGTGTGGATTGATGG + Intergenic
1144284909 17:13764452-13764474 TCTCATTTAGTGGGTCTTGGTGG - Intergenic
1150064522 17:62097863-62097885 CAGAATTGAGTGTGGCTTGAGGG - Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1155843245 18:30672280-30672302 CCTCAATTTGTGTGGCTGAAGGG - Intergenic
1157466221 18:47948325-47948347 TCTCTTTTAGTGAGGTTTGAGGG - Intergenic
1158443048 18:57494292-57494314 CCTCCTTAAGTGGGGCTAGAAGG + Intergenic
1159687870 18:71446011-71446033 CTTCTTTTAGAGTGGCTTGTTGG - Intergenic
1160363203 18:78301858-78301880 CCTCCTTTCGTGTTGCTTGATGG + Intergenic
1164683665 19:30152714-30152736 TCTCCTTTCGTGTGGCCTGAAGG - Intergenic
1202709081 1_KI270714v1_random:6747-6769 CCTTCTTTGGTGTTGCTTGAGGG - Intergenic
925704611 2:6672191-6672213 CCTCATTTATTATGTCTTGCAGG + Intergenic
928862896 2:35880912-35880934 CCTAATTTAATTTGTCTTGATGG - Intergenic
931077455 2:58732361-58732383 TCTCATTTATTGTGTCTTTATGG + Intergenic
934683041 2:96299491-96299513 GCTAATTTAGGGTGACTTGAGGG - Intronic
937895541 2:126974527-126974549 CCTCATTTCGTTTGGGTTTAAGG - Intergenic
945727356 2:213488537-213488559 CATCATTTAGTCTGTTTTGAAGG - Intronic
1171023536 20:21608389-21608411 CCTCATTTTGTGTGGCTAAAGGG - Intergenic
1173209460 20:41020861-41020883 CCTCATTGAGTGTTGCAGGAAGG + Intergenic
1178683368 21:34692293-34692315 CCCCTTTTAGTTTGGCCTGAGGG + Intronic
1178865353 21:36322106-36322128 CCTGTTTTTGTGTGGCCTGAAGG + Intronic
1182068831 22:27448995-27449017 TCACATTTAGAGTGGCTAGAAGG - Intergenic
949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG + Intronic
953571459 3:44075040-44075062 CCTCATTTTGGGTGGTTTGGAGG + Intergenic
955067788 3:55547475-55547497 TTTCATTAAATGTGGCTTGATGG - Intronic
955424693 3:58776087-58776109 ACTCATTTCATGTGGTTTGAGGG + Intronic
956366994 3:68515061-68515083 GCTCATTTACCTTGGCTTGAAGG + Intronic
956427890 3:69155510-69155532 CCTACTTTACTGTGGCGTGAGGG + Intergenic
956803203 3:72782197-72782219 TTTCATTTAGTGTGGCATTATGG - Intronic
958143104 3:89588762-89588784 ACTAATTTAGAGTGGCTTTACGG - Intergenic
959961496 3:112303425-112303447 CCTCTTTTAGTGTGGCTGCCTGG + Intergenic
960404045 3:117238209-117238231 CCTCAGTAAGTGAGGCTTGCTGG - Intergenic
962428044 3:135291575-135291597 CATGTTTTAGTGTAGCTTGATGG - Intergenic
962957805 3:140282306-140282328 CCTCCTTTTGTGAGGCTTAAAGG - Intronic
963668473 3:148221307-148221329 ATTCAGTTAGTGTGGCTTAATGG - Intergenic
967943518 3:194784496-194784518 CCTCATTTACTCTGGCTTGTAGG + Intergenic
969450581 4:7270679-7270701 CCTCCTTGACAGTGGCTTGAAGG - Intronic
970015964 4:11512996-11513018 ACTCATTTAATTTGCCTTGAGGG - Intergenic
970464664 4:16310598-16310620 CCTCATTTGTTGTGGCTAAAAGG - Intergenic
972344195 4:38179023-38179045 CCTGATTTCCTGTGGCTTGGTGG + Intergenic
974507247 4:62791578-62791600 CCTCATCTGGGGTGGGTTGAGGG - Intergenic
976616526 4:87083533-87083555 CTTCATTTAATGTGGCTTATTGG + Intronic
981008116 4:139896567-139896589 CCTCATTTAGTGTGGCTTGATGG + Intronic
981225971 4:142294694-142294716 CCTCATTTATGGTGGCTTGTGGG - Intronic
982296202 4:153832297-153832319 CCTTATTTTGGATGGCTTGAAGG - Intergenic
992845968 5:80747943-80747965 CATCATTAAGTGAGGCATGATGG + Intronic
994084851 5:95747043-95747065 CCTCAGTTATTGGGGCTTGTTGG + Intronic
994322574 5:98410294-98410316 ACTAATTTAGAGTGGCTTTACGG - Intergenic
998741801 5:145211723-145211745 CCTAATTTGGTGTGTTTTGAGGG - Intergenic
999734344 5:154501606-154501628 CTTCATTTTGTGTGGCTGGCTGG + Intergenic
1003651183 6:7961724-7961746 CCTCATTTTGTCTCACTTGATGG + Intronic
1012994345 6:105958506-105958528 CCTTTTTTAGTGTGGCTAGCTGG + Intergenic
1014230041 6:118893562-118893584 CTTCATTTTGTGTTGCTTAACGG + Intronic
1015341656 6:132107848-132107870 TCTCATTTAGTGTGTCTGGGTGG + Intergenic
1015929249 6:138340501-138340523 CTTCATTCTGTTTGGCTTGATGG - Exonic
1020557704 7:9691115-9691137 CCACCTTTACTGTGGCTTGCCGG + Intergenic
1022632877 7:32102228-32102250 CCTCAGTCAATGTGGTTTGAGGG - Intronic
1023049492 7:36238519-36238541 CCTCATTTAGTGTGTCTCCAAGG + Intronic
1026541761 7:71285977-71285999 ACGCATTTAGTTTGGCTTTATGG - Intronic
1030916663 7:115322938-115322960 CCTCATTTTGTGTGACTCCAAGG - Intergenic
1034136126 7:148771859-148771881 ATTCACTTAGTGAGGCTTGAAGG + Intronic
1041883988 8:62787126-62787148 AATCATTCATTGTGGCTTGAGGG + Intronic
1046039168 8:108881056-108881078 CCTCATTGAGTGGGGCTTCCAGG - Intergenic
1052565731 9:30148062-30148084 CCCAATTTTGTGTGGCTTCAAGG + Intergenic
1055090677 9:72363137-72363159 CCTCATTTAGTGAGGATTTAGGG + Intronic
1055429883 9:76232553-76232575 CCTAATTTAGTGGGACTTAAGGG - Intronic
1059804522 9:117784210-117784232 CCTAAATTGGTGTGGCTTCAGGG - Intergenic
1061380291 9:130252488-130252510 CCTCACTGAGTGAGGCCTGAAGG + Intergenic
1195769802 X:108338494-108338516 CCTCTGTTAGTATTGCTTGAAGG + Intronic
1197690383 X:129494282-129494304 CCTTATTTAGTATGGATTCAGGG + Intronic
1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG + Intergenic