ID: 981009241

View in Genome Browser
Species Human (GRCh38)
Location 4:139907979-139908001
Sequence TAGAATAAGCAGATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981009235_981009241 17 Left 981009235 4:139907939-139907961 CCGTCTACCTTTTCTGGGTGTCC 0: 1
1: 0
2: 0
3: 15
4: 217
Right 981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG No data
981009237_981009241 -4 Left 981009237 4:139907960-139907982 CCACATTGCATGTATTACCTAGA 0: 1
1: 0
2: 1
3: 8
4: 107
Right 981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG No data
981009236_981009241 10 Left 981009236 4:139907946-139907968 CCTTTTCTGGGTGTCCACATTGC 0: 1
1: 0
2: 2
3: 26
4: 246
Right 981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981009241 Original CRISPR TAGAATAAGCAGATGGATGG TGG Intronic
No off target data available for this crispr