ID: 981016770

View in Genome Browser
Species Human (GRCh38)
Location 4:139981744-139981766
Sequence GAGAGGATGGGCCAGCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981016763_981016770 11 Left 981016763 4:139981710-139981732 CCTCAGGCTTTCCTTGTTATAGA 0: 1
1: 0
2: 1
3: 25
4: 268
Right 981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG 0: 1
1: 1
2: 2
3: 10
4: 112
981016761_981016770 30 Left 981016761 4:139981691-139981713 CCTCTTGGCAGGGACAGTTCCTC 0: 1
1: 0
2: 8
3: 108
4: 442
Right 981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG 0: 1
1: 1
2: 2
3: 10
4: 112
981016764_981016770 0 Left 981016764 4:139981721-139981743 CCTTGTTATAGATAACCAGTTTG 0: 1
1: 0
2: 1
3: 9
4: 152
Right 981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG 0: 1
1: 1
2: 2
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981016770 Original CRISPR GAGAGGATGGGCCAGCTATT TGG Intronic
905279714 1:36841371-36841393 CAGAGGATGCCCCAGCTATGGGG - Intronic
905304239 1:37006544-37006566 GAGAGGAGGAGGCAGCTAATGGG + Intronic
909368204 1:74853872-74853894 GAGAGGATGGGGTAAGTATTAGG + Intergenic
909878032 1:80835822-80835844 GAGAGCATGGGCGAGTGATTGGG - Intergenic
909895686 1:81066268-81066290 AAGAGGATGGGCAGGCTACTTGG - Intergenic
910132695 1:83927492-83927514 GTGAGAATGGGCAAGCTATGTGG + Intronic
913576843 1:120183754-120183776 AAGAGGATGGGCCAGGGATTAGG - Intergenic
914418386 1:147505667-147505689 GAGAGGCTGAGCCACATATTGGG - Intergenic
914558752 1:148795189-148795211 AAGAGGATGGGCCAGGGATTAGG - Intergenic
914614081 1:149335041-149335063 AAGAGGATGGGCCAGGGATTAGG + Intergenic
915491380 1:156251811-156251833 GAGGGGGTGGGCCAGCTAGCAGG + Intronic
916058218 1:161082411-161082433 GATAGGCTGGGCTAGCTAATTGG + Intronic
917468936 1:175309445-175309467 GAGAGGATTGGGAAGCAATTGGG - Intergenic
917530571 1:175831393-175831415 TAGAAGATGGGCCAGCTCCTAGG - Intergenic
922441297 1:225657099-225657121 TACATGATGGGCCAGCCATTGGG - Intergenic
1063661645 10:8038235-8038257 GAGAGGCTGGACCAGCCTTTTGG - Intergenic
1067430178 10:46237514-46237536 GAGGGGAGGTGCCAGCTATGGGG + Intergenic
1070621665 10:78017134-78017156 GAAAGGTTGGGCCAGCTGTAGGG + Intronic
1073178264 10:101569482-101569504 CAGGGGATGGGCCGGCTAATGGG + Intergenic
1075351158 10:121726193-121726215 GAGAGGATGGGCTAGCCACCTGG - Intergenic
1080702194 11:34653330-34653352 AAGAGGATGGCCCAGCTGTCAGG - Intronic
1082996627 11:59260850-59260872 CAGAGGAGGGGCCAGCCATGGGG + Intergenic
1084387388 11:68852647-68852669 GAGAGGAAGGGCCAGCTTCCGGG - Intergenic
1098342509 12:69467282-69467304 ATGAGGATGGGCCAGCAATTTGG + Intergenic
1100225119 12:92548800-92548822 GAGAAGATGTGCCAGGCATTTGG + Intergenic
1101441149 12:104705055-104705077 GAGAGGATGGGCCAGCTGTTTGG + Intronic
1101612906 12:106308279-106308301 GAGAGGTTGGGCCAGTCATAAGG - Intronic
1107854942 13:44605634-44605656 GGCATGATGGCCCAGCTATTTGG + Intergenic
1111899355 13:94182052-94182074 GAGAGGAGGGGCCAACTACTGGG - Intronic
1115146610 14:30233947-30233969 GAGAGGAGTGCACAGCTATTAGG + Intergenic
1115272050 14:31563502-31563524 AAAAGTATGGGCCAGCTTTTCGG - Intronic
1122006147 14:98705501-98705523 GAGAGGACTGGCCAGGAATTAGG + Intergenic
1122999910 14:105287837-105287859 GAGAGCAAGGGGCAGCTACTGGG + Intronic
1128514901 15:68335928-68335950 CAGAGGATGGGCCAGTGATGGGG + Intronic
1129329859 15:74821437-74821459 GAGAGGAGATGCCAGCTATTTGG + Intronic
1133837120 16:9377308-9377330 GAGAGGAGGGGAAAGCTAGTGGG - Intergenic
1134109881 16:11508621-11508643 GAGAGGATGGGCCAGGATATGGG + Intronic
1134299357 16:12975763-12975785 GGGAAGATGGCCCAGATATTTGG + Intronic
1134622033 16:15696765-15696787 CAGAGGCTGGGCCACCTGTTCGG - Exonic
1138498526 16:57423582-57423604 GTGGGGATGGGGCAGCTCTTGGG - Intergenic
1141171583 16:81695065-81695087 GAGAGGCAGGGCCAGCTGCTGGG + Intronic
1142488408 17:261567-261589 GAAAAGATAGGCCAGCTATAAGG + Intronic
1142910977 17:3090711-3090733 GGGTGGATGGGCCAGCTTCTGGG + Intergenic
1143873484 17:9974696-9974718 GAGAGGAGGGGACAGATATTTGG + Intronic
1144168782 17:12638332-12638354 CTGAGGATGTGCCAGCTAATGGG + Intergenic
1144485839 17:15663696-15663718 GACAGTTTGGGCCTGCTATTTGG - Intronic
1146876941 17:36421294-36421316 GAGACTATAGTCCAGCTATTAGG - Intronic
1147062442 17:37891562-37891584 GAGACTATAGTCCAGCTATTAGG + Intergenic
1152370701 17:79886888-79886910 GAGAGGAGGGGCTAGCTACATGG + Intergenic
1153115916 18:1656041-1656063 GAGAGCATGGGACAGTGATTAGG + Intergenic
1153961396 18:10143056-10143078 GGGAGGATTGCCCATCTATTGGG + Intergenic
1154073563 18:11177736-11177758 GACAGGATGGGCCAGGTCTATGG - Intergenic
1160117719 18:76097463-76097485 AAGAGCATGGGCCAGTTATGTGG - Intergenic
1160953063 19:1676705-1676727 GAAAGGATGGGCCAGCGGATGGG + Intergenic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1163019148 19:14473419-14473441 GAGATGGTGGGCCAGCTTGTCGG - Exonic
1163327754 19:16616066-16616088 GAGAGGAAGGGGCAGCTCTCAGG + Intronic
1165149997 19:33754546-33754568 GAGAGGATGAGCCTCCTCTTTGG - Intronic
1165759190 19:38310590-38310612 GAGAGGAAGGGGGGGCTATTGGG + Intronic
1165791388 19:38494705-38494727 CAGAGGATGGGCCAGAAGTTGGG - Intronic
931647203 2:64435290-64435312 GAGAGGATGAGACAGCTATTTGG - Intergenic
932500649 2:72180105-72180127 GAGAGGATGGCCCAGCCATTTGG - Intronic
933413979 2:81961156-81961178 TAGAGGATTGGCCAACTATAGGG + Intergenic
935570846 2:104659158-104659180 GAGAGGATGTGCCACCGAGTGGG - Intergenic
940850121 2:158680053-158680075 GAGAGGATGGTCTTGATATTTGG - Intronic
946052339 2:216873930-216873952 GACAGGAGGAGGCAGCTATTGGG + Intergenic
1169135679 20:3195658-3195680 GAGAGGATGGGGCAGGTGATTGG - Intronic
1169749399 20:8976265-8976287 GAGAGGATGAGGCAACTCTTTGG - Intergenic
1170112942 20:12825042-12825064 GAGAGGATGTGCTAGAAATTGGG + Intergenic
1172917325 20:38452840-38452862 AAGAGGCTGGGCCAGCGATGAGG - Intergenic
1173434855 20:43023452-43023474 GGCAGCATGGGCCACCTATTTGG - Intronic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1176019365 20:62954637-62954659 GAGAGGATGGCCCAGACAGTCGG - Intronic
1176080178 20:63268638-63268660 GAGAGGAGGTGCCGGCTCTTGGG - Intronic
1176524392 21:7854857-7854879 CAGAGGCTGGGAAAGCTATTCGG + Intergenic
1178658412 21:34484870-34484892 CAGAGGCTGGGAAAGCTATTCGG + Intergenic
1183520646 22:38294455-38294477 GAGAGGATGGGGCAGCTACGGGG - Exonic
1184776207 22:46624715-46624737 GGGAGCATGAGCCAGCCATTTGG - Intronic
952983685 3:38758790-38758812 GAGAGGCCAGGCCTGCTATTGGG - Intronic
953751421 3:45611473-45611495 AAGGGGATGGGCCATCTCTTTGG - Intronic
953920195 3:46946534-46946556 GTGAGGCTGGGCCAGCCATGTGG - Intronic
954335149 3:49911929-49911951 CAGAGGATGGGGCAGCTTCTGGG - Exonic
954437808 3:50505136-50505158 GAGACGATAGTCCAGCTCTTTGG + Intergenic
954533898 3:51343723-51343745 GAGAGCATGTGCCAGCTTTGAGG - Intronic
954670711 3:52290017-52290039 GGGAGGAGGGCCCAGCTAATAGG + Intronic
956976956 3:74591919-74591941 GAGAGGATGGGCTCCCTATCAGG + Intergenic
961085500 3:124063853-124063875 GAAAGGCTGGGCCAGCCTTTAGG + Intergenic
961979211 3:131058776-131058798 GTGAGGATGGGAGAGCTAATAGG - Intronic
964467248 3:157007989-157008011 GACAGGAATGGCCAGATATTTGG + Intronic
966593206 3:181703883-181703905 GAGAGTATATGCCTGCTATTCGG + Intergenic
966818180 3:183905988-183906010 GAAAGGAGGGGCCATCTTTTTGG - Intergenic
969331524 4:6475955-6475977 GAGAGAGTGGGCAAGCTCTTTGG - Intronic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG + Intronic
983097502 4:163581126-163581148 GAGAGAATGTCTCAGCTATTTGG + Intronic
986830590 5:11572723-11572745 GACAGGATGGGCCAGACATAGGG - Intronic
988473295 5:31561301-31561323 AAGAGGATGGGGCATCTTTTGGG + Intergenic
996500318 5:124209364-124209386 CAGGGGATGGGCCAGGGATTTGG + Intergenic
998136632 5:139677473-139677495 GAGAAGATGAGCCAGGTATCAGG + Intronic
1002101020 5:176857676-176857698 GAGAGGCAGGGCCAGCCAGTGGG + Intronic
1003308185 6:4947173-4947195 GAGGGGATGGGGCAGGTTTTGGG + Intronic
1003491218 6:6623600-6623622 GAATGGATGGGCCATATATTGGG - Intronic
1006454444 6:34123846-34123868 GAGAGGAAGGGCCAGCCAGATGG - Intronic
1009242035 6:61195709-61195731 GAGAGAATGGGCCACCTCTCAGG - Intergenic
1013958048 6:115863134-115863156 GAGAGGTTGGTCCATGTATTAGG - Intergenic
1019196208 6:170284577-170284599 GGGAGGATGGCCCAGCTGTGTGG - Intronic
1020660840 7:10979886-10979908 GAGGGGTTGGGTAAGCTATTAGG + Intronic
1022238294 7:28483964-28483986 TAGAGAATGGGCAAGCTGTTTGG + Intronic
1022467613 7:30662131-30662153 AAGTGGATGGGCCAGCCATGGGG - Intronic
1026848948 7:73712936-73712958 GAGGGGATGGGCCAGATCTTTGG - Intronic
1027423391 7:78039143-78039165 GAGAGGAAGGGCCAGGTACTTGG - Intronic
1031865205 7:127030992-127031014 AAGAGGATTGTCCAGCTCTTAGG - Intronic
1032496637 7:132367903-132367925 GGGAACCTGGGCCAGCTATTTGG - Intronic
1033030881 7:137825226-137825248 GTGAGGGTTGGCCAGCTTTTGGG - Intronic
1034397717 7:150839873-150839895 GAGAGGACAAGCCAGCTATGTGG + Intronic
1035521340 8:277146-277168 GAGAGGAAGGGTCAACTCTTAGG - Intergenic
1039091284 8:33832338-33832360 TAGAGGATAGGCCATTTATTTGG + Intergenic
1049782481 8:144435282-144435304 GAGAGGAGGGGCCGGCTACCTGG - Intronic
1051483479 9:17584178-17584200 GGGAGGAAGGGGCAGCAATTAGG - Intronic
1052167739 9:25354321-25354343 GAGAGAAAGGGACAGCTATAAGG - Intergenic
1057719110 9:97518081-97518103 GAGAAGATGGGGCAGGTGTTGGG - Intronic
1057911975 9:99026375-99026397 GAGAGAATGGGACAGCAACTGGG - Intronic
1059700317 9:116769597-116769619 GAGAGGATGGGGTAAGTATTAGG + Intronic
1060484684 9:124039657-124039679 GAGGGAATGGACCAGCTATGGGG + Intergenic
1060923659 9:127440330-127440352 AAGGGGATGAGCCAGCTGTTTGG + Intronic
1192796974 X:74432010-74432032 GAGAGGAGGGGCCAGATCCTAGG + Intronic