ID: 981017979

View in Genome Browser
Species Human (GRCh38)
Location 4:139994166-139994188
Sequence TTGGAATGAAACAGAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981017979 Original CRISPR TTGGAATGAAACAGAATTTT GGG (reversed) Intronic
901368619 1:8776596-8776618 ATAGAATGAAACAATATTTTGGG - Intronic
903010719 1:20328218-20328240 TTAGAATCAAACAATATTTTGGG + Intronic
904552469 1:31331086-31331108 TTGGAATGAAATTGTAATTTAGG + Intronic
905243004 1:36593371-36593393 TTGAAAACAACCAGAATTTTGGG + Intergenic
905318270 1:37097304-37097326 TTGGAAGGAGACAGAATGGTGGG + Intergenic
906047370 1:42842431-42842453 TTGGAGGGAAAAAGAATCTTAGG - Intronic
906569326 1:46822746-46822768 TGGGAATGAGACAGGCTTTTGGG - Intergenic
906572643 1:46857400-46857422 TTAGAAATAAACAGGATTTTTGG + Intergenic
906913124 1:49978068-49978090 TTGGCTTGACATAGAATTTTAGG + Intronic
909077907 1:71075250-71075272 TGGTAATGGAAAAGAATTTTTGG + Intronic
909279126 1:73726182-73726204 TTGGAGTGCAACAGTAGTTTTGG + Intergenic
910747088 1:90585817-90585839 TCAGAAGGAAACAGAATTCTAGG + Intergenic
910977644 1:92923981-92924003 TTCAACTGAAACAGAATTTAGGG + Intronic
911643194 1:100310920-100310942 TTGAAATTTCACAGAATTTTGGG - Intergenic
911989648 1:104676937-104676959 TTTCAATGAGACAGAAGTTTTGG + Intergenic
912173781 1:107133414-107133436 TTGGAATGAAACAGTGATTTAGG + Intergenic
914347141 1:146809517-146809539 TTGGAATTAACCAGGATGTTGGG + Intergenic
914512052 1:148342711-148342733 ATGGAATGAAACAGACTGTGTGG - Intergenic
915633552 1:157170990-157171012 TTGGAATGAAATAGGATCATTGG + Intergenic
915702330 1:157807692-157807714 TTGGGATAGAAGAGAATTTTTGG - Intronic
916156012 1:161849267-161849289 TTGGAATAAAACAGACATGTTGG - Intronic
916234434 1:162572308-162572330 TAGGAATGAAGCAGTAATTTAGG + Intronic
917051340 1:170927743-170927765 TCTGAGAGAAACAGAATTTTAGG + Intergenic
918141223 1:181721561-181721583 TTCGTATGGAAAAGAATTTTAGG - Intronic
918329509 1:183444595-183444617 TTTGAATGAGACAAAATATTCGG + Intergenic
918388096 1:184031128-184031150 TTGGAATGAAGCTGAATTTAGGG + Intronic
918442077 1:184577518-184577540 TTGGAATTAAAGAGAGTTGTGGG + Intronic
918474355 1:184906977-184906999 TTGTGATGACACAGAATGTTGGG - Intronic
918578531 1:186096300-186096322 TAGGGATGAAGCAGAATTTTAGG - Intronic
918852040 1:189704702-189704724 ATGAAATGAAACATAATTATGGG + Intergenic
918995260 1:191751202-191751224 TTGCAATGAAATAAAACTTTGGG + Intergenic
919136509 1:193515031-193515053 TTGCAAAGAAATATAATTTTTGG - Intergenic
919471739 1:197987776-197987798 TTGAGATAAAAAAGAATTTTTGG + Intergenic
919544797 1:198902302-198902324 TTGAAAGGAAAGAGAATATTAGG - Intergenic
919663140 1:200267864-200267886 TTGAAAAGAAATAGGATTTTAGG + Intergenic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
921489873 1:215762415-215762437 ATAAAATGAAACATAATTTTGGG + Intronic
922027156 1:221760912-221760934 TTTTAAGGAAAGAGAATTTTAGG + Intergenic
922732879 1:227960796-227960818 GTAGAATGATACAAAATTTTTGG + Intergenic
922957379 1:229614747-229614769 TTGGTATTAAACAGAGTTTGGGG - Intronic
923249185 1:232163549-232163571 TTGGAATGATATAAAAGTTTTGG + Intergenic
923390218 1:233507506-233507528 TTGGTATGAAACAGAGGCTTAGG - Intergenic
923625467 1:235610416-235610438 TTGTAATGAATAAGAATTTGTGG + Intronic
923851263 1:237797685-237797707 ATGGAATGAAGCATAATTTCTGG + Intronic
924542191 1:244991487-244991509 GGGGAATGAGTCAGAATTTTTGG + Intronic
1063263344 10:4415756-4415778 TTGGAAAGAAATAGATGTTTGGG + Intergenic
1064606669 10:17049025-17049047 TTGGAGTTAAACATAATCTTTGG - Intronic
1065206386 10:23361468-23361490 TTGGAATGAACCAGATTAGTAGG - Intergenic
1065260935 10:23922577-23922599 TTAGAATGAAACTAAATTGTAGG + Intronic
1065593837 10:27293490-27293512 TTATAATGAAAAAGAATTTCTGG + Intergenic
1065656512 10:27956774-27956796 TTATAATGAAAAAGAATTTGTGG - Intronic
1066157048 10:32689626-32689648 CTGAAATGAAACAGAATTTCTGG + Intronic
1066499595 10:35977760-35977782 TTAGAATCAAATAGCATTTTTGG + Intergenic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1069143456 10:64858766-64858788 TTGAACTGAAATAAAATTTTAGG - Intergenic
1069603930 10:69728091-69728113 TTCCAATGAAACAGTATTTATGG - Intergenic
1070075011 10:73126529-73126551 TTGGAATGACTCAGAGTTTTAGG + Intronic
1071021786 10:81065612-81065634 TAAGAAAGAAACAGAATATTGGG - Intergenic
1071045091 10:81363583-81363605 ATGGAAAGAATCAGAATTTCTGG + Intergenic
1071065228 10:81624946-81624968 TTGGAATAAAAATAAATTTTAGG - Intergenic
1073274342 10:102296442-102296464 TTTGAATGATAAAGAATTGTAGG + Intronic
1074357279 10:112797615-112797637 ATGATATGATACAGAATTTTTGG + Intronic
1074820138 10:117172196-117172218 TTGGAATGAAACACACCTATTGG + Intergenic
1075770324 10:124929129-124929151 CTGGAATGAAGCAAACTTTTGGG + Intergenic
1075976095 10:126696706-126696728 TTAGAATAAAAGAGTATTTTTGG - Intergenic
1077719560 11:4614097-4614119 CTGGAATAAAACAGAAGCTTAGG - Intergenic
1078553387 11:12295695-12295717 TTTAAATGATACAAAATTTTTGG - Intronic
1079392378 11:20033794-20033816 CTGGAATGAACTAGAACTTTGGG + Intronic
1080146947 11:28997484-28997506 TTGGAAAGTGAGAGAATTTTAGG - Intergenic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080903483 11:36517725-36517747 TTGGGATGAAAGTGACTTTTTGG - Intronic
1081301157 11:41453568-41453590 TTGGAGTGAGTCAGAATTTGGGG + Intronic
1081565376 11:44257710-44257732 TTGGAATCACACAGAATTCCTGG + Intergenic
1081660159 11:44883142-44883164 TTTTAATGAAACAGAACTCTTGG - Intronic
1081799129 11:45845695-45845717 TAGGAATGAAACAGAGTGTAAGG - Intergenic
1082687536 11:56259352-56259374 TTGGAATGAGTTAGGATTTTGGG - Intergenic
1082846189 11:57727625-57727647 TGGGAAGGAAACAGATTTTGGGG - Intronic
1083714187 11:64566294-64566316 TTGAAATAAAACTGAAGTTTAGG + Intronic
1084022764 11:66427608-66427630 TTGGAGGAAAACAGCATTTTTGG - Intergenic
1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG + Intronic
1085367722 11:75966906-75966928 TTGAATTTAAACAGAATTTGGGG + Intronic
1085545245 11:77312124-77312146 TTGGGATGACACAGAATTCCTGG - Intergenic
1086558456 11:88139883-88139905 TAAGAAAGAAACAGAATTCTGGG - Intronic
1087101450 11:94369329-94369351 TTGAAATGAAAGAGAATTGGGGG + Intergenic
1087570607 11:99922532-99922554 TTTGGATGAAACAGAAACTTGGG - Intronic
1087796903 11:102463791-102463813 TTGGAGTGACAGAAAATTTTTGG + Intronic
1088787438 11:113194911-113194933 TAGGAATGAGATAGAATTCTTGG + Intronic
1089048226 11:115522723-115522745 TGGGAATGAAACTTAATTATAGG - Intergenic
1092614591 12:10205195-10205217 GTGGAATGAAAAGGTATTTTTGG - Intergenic
1092824293 12:12383626-12383648 TTTGATTGAAATGGAATTTTTGG + Intronic
1093269631 12:17044331-17044353 TTGGAATTACAAAAAATTTTTGG - Intergenic
1093418291 12:18945869-18945891 TTGGACTGGAATAGAATTTTAGG + Intergenic
1093571874 12:20675429-20675451 TTGGATTTAAACTGCATTTTAGG - Intronic
1095122809 12:38438928-38438950 TTGGAATGTACCATAATTTTTGG + Intergenic
1095243237 12:39885853-39885875 TTGAAATGAATCAGAATCCTGGG - Intronic
1095929802 12:47614008-47614030 TTGGAATGAATTAGGATTTTTGG - Intergenic
1096887535 12:54732555-54732577 TTAGACAGAAAAAGAATTTTGGG + Intergenic
1097670205 12:62527267-62527289 TAGAAATGAAACAGAGTCTTCGG + Intronic
1099210282 12:79777794-79777816 TTAGTTTGAAATAGAATTTTAGG - Intronic
1099499044 12:83388892-83388914 TAGGAAGGAAACAGGAATTTGGG + Intergenic
1100386774 12:94111051-94111073 TTGTAATGAATCAGAAATTGGGG + Intergenic
1101462909 12:104915140-104915162 GTGGATTTAAACAGATTTTTAGG - Intronic
1101770247 12:107743243-107743265 TTGTAATGATGCAGAATTCTAGG + Exonic
1101917800 12:108909617-108909639 ATGGGATGAAACAGTATCTTAGG - Intergenic
1102462131 12:113106386-113106408 TTGGAGTGAAACAGAATCACAGG - Intronic
1103124470 12:118409443-118409465 GTTAAAAGAAACAGAATTTTAGG - Intronic
1104412091 12:128567223-128567245 TTGCATTGAAACAGCCTTTTTGG - Intronic
1104607289 12:130199404-130199426 ATGGTATTAAACAGACTTTTGGG + Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1105586832 13:21753092-21753114 TTGAAATCTAACAGCATTTTTGG - Intergenic
1106976386 13:35221832-35221854 TTGAAATTCAACAAAATTTTTGG - Intronic
1107740271 13:43443225-43443247 TCCGAATTGAACAGAATTTTTGG - Intronic
1108693955 13:52886289-52886311 CTGGTGTGAAACAGAAGTTTGGG + Intergenic
1108698383 13:52923046-52923068 TTGGAAAGAGACAGATTCTTAGG + Intergenic
1109172102 13:59109204-59109226 TTGGAATGAGGCAAAGTTTTTGG - Intergenic
1109594259 13:64529487-64529509 TTGCAATGAAACAAACTTTTGGG - Intergenic
1110169038 13:72478215-72478237 ATGGCATGAAATAAAATTTTAGG + Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1110635701 13:77765481-77765503 TTGGAATGAATTAAAACTTTGGG - Intergenic
1110956388 13:81558249-81558271 TAAAAATGATACAGAATTTTTGG + Intergenic
1111083148 13:83338475-83338497 TTAGAATGTAACAGTTTTTTAGG + Intergenic
1111128837 13:83948135-83948157 TTGGAAAGAAACAGGACTATTGG - Intergenic
1111348066 13:86989577-86989599 TAAAAATGAAACAGAATGTTGGG + Intergenic
1111845323 13:93500387-93500409 TTGGAATAAAAGAGCATTTGAGG + Intronic
1111911594 13:94318861-94318883 TTGGAAAGAAAGAGACTTTAAGG - Intronic
1112135582 13:96574669-96574691 ATTGAATGAAACAGAACTTGAGG + Intronic
1113509614 13:110842704-110842726 TTTTTATGAAAGAGAATTTTCGG + Intergenic
1114928160 14:27431447-27431469 CTTGAATGACACAGAAATTTGGG + Intergenic
1115061886 14:29202046-29202068 TTGGAAACAAACTGAATTCTAGG + Intergenic
1115889741 14:38013024-38013046 TTGGAATGAATCAAGACTTTAGG + Intronic
1116759499 14:48993710-48993732 TTGGAAAGAACCAGAAATTTTGG - Intergenic
1117635324 14:57736869-57736891 TTGGAAAAATACAGAGTTTTGGG + Intronic
1117786756 14:59293742-59293764 TTGGTCTGAAACTGAATTTTTGG + Intronic
1119274583 14:73342411-73342433 TTGAAATGAAACATTATTGTAGG + Intronic
1119914430 14:78384079-78384101 TTGGAAGGAGACAGAATTACTGG + Intronic
1121302522 14:92882951-92882973 TTGGGATGAAAGAGAAATCTTGG + Intergenic
1122089039 14:99326073-99326095 TCGGAAGGAAACAGAATGGTAGG - Intergenic
1123196675 14:106623756-106623778 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123196685 14:106623840-106623862 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123847326 15:24315948-24315970 TTGTAGAGAACCAGAATTTTAGG - Intergenic
1123866322 15:24523018-24523040 TTGTAGAGAACCAGAATTTTAGG - Intergenic
1123956964 15:25346486-25346508 TTGGTATGACAGATAATTTTTGG - Intronic
1124614653 15:31232875-31232897 TTGGAAAGATATAGAAATTTAGG - Intergenic
1125081748 15:35682315-35682337 TTGGCATGATACAAAGTTTTTGG + Intergenic
1125211178 15:37216969-37216991 TCTGAATGAAGCAGCATTTTTGG - Intergenic
1126082667 15:44980806-44980828 TTATAATGAAACAGTTTTTTAGG + Intergenic
1126188001 15:45849272-45849294 TGGGAATGAAAGATACTTTTAGG + Intergenic
1126200924 15:45985195-45985217 TTTGTATGTAACACAATTTTAGG - Intergenic
1126206603 15:46052992-46053014 TTGGCAGGAAACAAAATTCTTGG + Intergenic
1126771374 15:52059690-52059712 TTTGAATTAAACTGAATATTTGG + Intronic
1126893083 15:53227385-53227407 TGGGCTTGAAGCAGAATTTTAGG + Intergenic
1126941484 15:53771238-53771260 GTAAAATGAAACAGAAATTTTGG + Intergenic
1127601818 15:60545222-60545244 TCTGAATGGAACAGAATATTTGG + Intronic
1127637173 15:60882155-60882177 TTGCAACGAAACAAAACTTTGGG - Intronic
1128850724 15:70953396-70953418 TTGGAATGATATGGAATTCTTGG + Intronic
1128966412 15:72062511-72062533 TAGAAATCAAACAGAAATTTGGG + Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1129978968 15:79848857-79848879 TTGGATTTTAATAGAATTTTAGG + Intronic
1131285649 15:91054823-91054845 TTGCTTTGTAACAGAATTTTTGG + Intergenic
1131570328 15:93528487-93528509 TAGGAAAGAAACAGAATATTAGG + Intergenic
1131753391 15:95534429-95534451 TTGGAAGGAAACAAATTATTAGG + Intergenic
1131922308 15:97341793-97341815 GTGTGATGAAACAGAATTTGGGG - Intergenic
1133923669 16:10177659-10177681 TTGGGATGAAACTGCGTTTTGGG - Intronic
1136076152 16:27818673-27818695 ATGGAATTAAAAGGAATTTTGGG + Intronic
1136865500 16:33748713-33748735 TAGAAATGAAACAGAAGTATTGG - Intergenic
1138535527 16:57658073-57658095 TAGGAAAGAAACAGATTCTTAGG - Intronic
1139803682 16:69545400-69545422 TTAGAATGAAACAGAAGGCTGGG + Intergenic
1139986847 16:70905752-70905774 TTGGAATTAACCAGGATGTTGGG - Intronic
1140309699 16:73837302-73837324 TTGAAATTAAATAGAAATTTGGG - Intergenic
1141973657 16:87499433-87499455 TTTGAAGGAGACAGAGTTTTGGG - Intergenic
1142066626 16:88066551-88066573 CTGAAAATAAACAGAATTTTAGG - Intronic
1142241345 16:88948245-88948267 TTTGCATGAAACAGAATTGAGGG - Intronic
1203106650 16_KI270728v1_random:1367399-1367421 TAGAAATGAAACAGAAGTATTGG + Intergenic
1203126864 16_KI270728v1_random:1594969-1594991 TAGAAATGAAACAGAAGTATTGG - Intergenic
1142779597 17:2170896-2170918 TTGGAATATAAAAGAATTCTGGG + Intronic
1151004315 17:70416108-70416130 TTGAAGTGAAAGGGAATTTTTGG + Intergenic
1152409433 17:80115402-80115424 AAGGAATGAAACAGAAATTCTGG - Intergenic
1203188659 17_KI270729v1_random:155571-155593 TTGGAATCAAAAGGAATTATTGG - Intergenic
1153105748 18:1524009-1524031 TTTGAGTGAAACAGAATCTTGGG + Intergenic
1153861411 18:9212691-9212713 ATGAATTGATACAGAATTTTGGG - Intronic
1158471313 18:57739400-57739422 TAGGAAGGAAACAGAAATGTAGG - Intronic
1159037131 18:63288154-63288176 CTGTAATGAAACAGTATTTGTGG - Intronic
1159428963 18:68326112-68326134 ATGAAATGTAACAGAATTTCAGG - Intergenic
1159451336 18:68605877-68605899 AGAGAATGGAACAGAATTTTTGG - Intergenic
1159831372 18:73282181-73282203 ATGGAAACAAACAGATTTTTTGG + Intergenic
1159934547 18:74352289-74352311 TTGGAATGAAAAAAAATTTTTGG + Intronic
1160134377 18:76260093-76260115 TTGAAATAAAATGGAATTTTAGG + Exonic
1162707922 19:12569668-12569690 TTGGAATTGAATAGAATTTGAGG - Intronic
1163918323 19:20263153-20263175 TGGTAATGAAAAAGAATTCTAGG + Intergenic
1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG + Intronic
1164855960 19:31521837-31521859 TAGCAATGAAACAGAATATATGG - Intergenic
1167037851 19:47004710-47004732 TTGCTGCGAAACAGAATTTTGGG - Exonic
1167437683 19:49489124-49489146 TTGGAAGAAAACCGAATTTCAGG - Intronic
1167961365 19:53106753-53106775 TTGGAATTAAATAGAGTGTTGGG - Intergenic
925248103 2:2402668-2402690 TTGGAATGAAAATAAATATTTGG - Intergenic
927610985 2:24540385-24540407 TTGAAATGGAACAGTCTTTTTGG + Intronic
928534804 2:32229549-32229571 TGGGTAAGAAACAAAATTTTGGG + Intronic
929028400 2:37627512-37627534 TTGTAGTAAAACATAATTTTAGG - Intergenic
929704877 2:44199514-44199536 TGCAAATGAAACAGAATTGTTGG - Intronic
931290418 2:60868397-60868419 TTGGAAGGAATCTGAGTTTTTGG - Intergenic
931545246 2:63376555-63376577 AGTGAATGAAACAGAAGTTTTGG - Intronic
932519163 2:72390958-72390980 TGGAAATGAAAAAGAGTTTTGGG - Intronic
932873792 2:75429928-75429950 ATGGAAAGAGATAGAATTTTAGG + Intergenic
933524545 2:83418626-83418648 TTGGAAGGATACAAAATTCTTGG - Intergenic
934114980 2:88779797-88779819 TAGAAATGAAACAGAAGTATTGG + Intergenic
934631673 2:95932202-95932224 TAGAAATGAAACAGAAGTATTGG - Intronic
934634021 2:95965576-95965598 TAGAAATGAAACAGAAGTATGGG - Intronic
934799608 2:97139659-97139681 TAGAAATGAAACAGAAGTATGGG + Intronic
934801973 2:97172476-97172498 TAGAAATGAAACAGAAGTATTGG + Intronic
934833834 2:97563788-97563810 TAGAAATGAAACAGAAGTATTGG - Intronic
936096717 2:109535886-109535908 TGGGAATAGAACAGAATTTGGGG + Intergenic
936760848 2:115780040-115780062 TTGGAATGAAACATGATTTTTGG - Intronic
936968886 2:118155110-118155132 AAGCAATGAATCAGAATTTTTGG + Intergenic
937672472 2:124553046-124553068 TGGGAAAGAAATAGAATTCTAGG + Intronic
938659617 2:133472177-133472199 ATGGAAACAAGCAGAATTTTAGG - Intronic
938717279 2:134032176-134032198 TTGAAATGAAACTGCATTTGAGG + Intergenic
938736750 2:134192433-134192455 TTGGAATGAAACAGGTATGTAGG + Intronic
939036701 2:137140504-137140526 TTTAAATGACACGGAATTTTTGG - Intronic
939192013 2:138927812-138927834 TTGGAGTGAATCATAATTTTAGG - Intergenic
939210473 2:139168748-139168770 TTGATATGAAAAATAATTTTGGG - Intergenic
939273082 2:139965035-139965057 TTTGGATAAAACAGATTTTTAGG + Intergenic
939421616 2:141978348-141978370 TTGCATTAAAACAGCATTTTGGG + Intronic
939467368 2:142576257-142576279 TTGGAATGCAAAATAATATTTGG - Intergenic
939700209 2:145382012-145382034 TTAGAATAACAGAGAATTTTAGG + Intergenic
939782682 2:146468146-146468168 TTGGAAAGAAACAGAGTAATAGG - Intergenic
939854240 2:147338370-147338392 TTGGACTGAAAGACATTTTTTGG + Intergenic
940035322 2:149306727-149306749 TTTGATTGAACCAGAACTTTGGG - Intergenic
940977767 2:159965384-159965406 TTGGAATCATACAGTATTGTAGG + Intronic
942092631 2:172508826-172508848 TTGGAAGTAAACAGATGTTTAGG + Intergenic
943403025 2:187440114-187440136 TTGCAATGAAATTAAATTTTGGG - Intronic
944161997 2:196672152-196672174 TTTGAAATAAACAGAAGTTTAGG + Intronic
945500702 2:210570001-210570023 TTGGAATGAAATAGCATTTGGGG + Intronic
945927020 2:215816278-215816300 TTGAAATGAAAATAAATTTTAGG + Intergenic
946514946 2:220401955-220401977 AGAGAAGGAAACAGAATTTTCGG + Intergenic
946662382 2:222015322-222015344 TTGGAAGGAAATATGATTTTTGG - Intergenic
946725951 2:222661418-222661440 TTGGAATCAAACATAATTTATGG + Intergenic
946818190 2:223601955-223601977 TTGGAAAGAAACAAGATATTGGG + Intronic
947257036 2:228178145-228178167 ATGGAAGGAAAAAGAATTTCTGG - Intronic
947880218 2:233502368-233502390 TTGGATTTAAAAAAAATTTTTGG + Intronic
948618547 2:239217354-239217376 TGGTAATGAAACTGAAATTTGGG + Intronic
1168825072 20:805749-805771 TAGAAATAAAAAAGAATTTTTGG + Intergenic
1169380182 20:5099559-5099581 TTGGATGGAAATAGAAATTTGGG - Intronic
1171058802 20:21935324-21935346 ATGTAATGAGACAGAATTGTAGG + Intergenic
1172403201 20:34667829-34667851 TTGTAATTAATCAGCATTTTAGG - Intronic
1174322088 20:49749988-49750010 TGGGAATGAAACAGAAGTGTGGG + Intergenic
1174526522 20:51176209-51176231 TTGGATTCAAACAGATTTATGGG + Intergenic
1174807688 20:53618710-53618732 TTGGATTGAAACAGAATAGAGGG - Intergenic
1175791177 20:61740816-61740838 TTAGACTGAAACAGGATGTTGGG + Intronic
1176113209 20:63419899-63419921 TTGGAAGGAAAAGGTATTTTTGG - Intronic
1177542096 21:22507304-22507326 TAGATATCAAACAGAATTTTTGG - Intergenic
1178027462 21:28484505-28484527 TTGAAATAAATCAGAATTTAAGG + Intergenic
1178528692 21:33356265-33356287 GAAGAATGAAACAGAATGTTAGG - Exonic
1179002736 21:37478373-37478395 TAGGAATGAAAAAAAAGTTTAGG - Intronic
1179382902 21:40915766-40915788 TTCTAAAGAAACAGAATTTTTGG + Intergenic
1179938743 21:44624233-44624255 ATGGAATCAAACAGAAATTCTGG - Intronic
1180111069 21:45651475-45651497 TTGGAATGAATCCCAACTTTAGG - Intronic
1180829809 22:18899038-18899060 TTTGCAGGATACAGAATTTTAGG + Intergenic
1181291667 22:21799013-21799035 TTGGAATTCAACATAATTTCTGG + Exonic
1181524768 22:23474828-23474850 TAAGACTGAAACAGTATTTTAGG - Intergenic
1182219362 22:28745697-28745719 TTGGACTGAAACAGAAATGCTGG - Intronic
1203279900 22_KI270734v1_random:124311-124333 TTTGCAGGATACAGAATTTTAGG + Intergenic
949350018 3:3115963-3115985 AAGGATTGAAACAGAATTCTGGG + Intronic
949526473 3:4909599-4909621 ATGGAATGGAATGGAATTTTAGG + Intergenic
950892569 3:16417301-16417323 TTGGAATGACAGAGAAGTTCTGG - Intronic
951118075 3:18888931-18888953 TAAGAAGGAAACAGATTTTTTGG + Intergenic
951410468 3:22358649-22358671 TTGTAATAAAAGAGAAATTTTGG + Intronic
951766210 3:26202488-26202510 TTCAAATGAAACTGAGTTTTAGG - Intergenic
952249224 3:31633194-31633216 TTTGTATGAAAAAGAATTTCTGG + Intronic
952682307 3:36107873-36107895 TTGGAATGAAATGCAACTTTAGG - Intergenic
953833751 3:46325581-46325603 TTTGAATAAAATAGTATTTTTGG - Intergenic
954252219 3:49376826-49376848 TTGTAAAGAAACAGCATTCTTGG + Intronic
954276663 3:49546535-49546557 TTGTAAAGAAACAGCATTCTTGG - Intergenic
954940340 3:54366389-54366411 TTGAAATGAAAGAGAAGTTAGGG + Intronic
955421840 3:58746197-58746219 TTGGAAACATACACAATTTTTGG - Intronic
955622369 3:60878078-60878100 TGGGAAAGAAGCAGAGTTTTAGG - Intronic
955786102 3:62540573-62540595 ATAGAAGGAAACAGAATTCTAGG + Intronic
957515552 3:81246401-81246423 TGGGAATGAAACAGAATTCAGGG - Intergenic
957567747 3:81906607-81906629 TTAGAATGAAGCAGAAATTCTGG + Intergenic
957693786 3:83606676-83606698 TTGGAATAAATTACAATTTTTGG - Intergenic
958456102 3:94333346-94333368 TAGGAATCACATAGAATTTTAGG - Intergenic
959983246 3:112542155-112542177 TTCCAATAAAACAGTATTTTTGG + Intronic
960131690 3:114062943-114062965 TTGGAGTAAGATAGAATTTTTGG + Intronic
960405815 3:117258078-117258100 TTGGAATGAAGTAGAACTTTCGG + Intergenic
960663966 3:120092919-120092941 TTGGAATGAGAGAATATTTTAGG - Intronic
961433312 3:126898458-126898480 TTGGAATGATAGAGATATTTTGG + Intronic
962300055 3:134231780-134231802 TTGTAAAGAAACAGAACTTTGGG - Intronic
962950641 3:140215345-140215367 TTGGAATAAAACAGTTTCTTTGG + Intronic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
963475913 3:145804171-145804193 TTGGAAAAAAATAGAAATTTTGG - Intergenic
963563906 3:146903407-146903429 TATGAATGAAAAAGAAGTTTTGG + Intergenic
963594167 3:147304195-147304217 TTGTTATTAAACAGAATTTCAGG - Intergenic
964296850 3:155242574-155242596 TTAGAATGAATCAGAATAGTTGG + Intergenic
964449984 3:156802722-156802744 TAGAAATGAAACAGTCTTTTGGG - Intergenic
964802584 3:160571869-160571891 TTGGAGAAAAACAGAATTATAGG + Intergenic
964950252 3:162282890-162282912 TTGAAATCAAACAGAATTCCAGG - Intergenic
965134377 3:164742315-164742337 ATGAAATGAAACAGCAGTTTGGG - Intergenic
965255376 3:166400319-166400341 TAAAAATGAAAGAGAATTTTAGG + Intergenic
965348528 3:167583393-167583415 TCTGAATAAAACATAATTTTTGG + Intronic
965675150 3:171186903-171186925 TTGGAATTAAACTGATATTTTGG - Intronic
965788279 3:172359656-172359678 TTGGAATGTAACATATTTTTCGG - Intronic
965910573 3:173770004-173770026 TTGGAATATAACAGAAGCTTAGG - Intronic
966962804 3:184957086-184957108 TTAGAATAAAACACAACTTTTGG + Intronic
967750648 3:193111854-193111876 TTGGCAAGATACAGAATCTTTGG - Intergenic
969141561 4:5078651-5078673 TTGGATTCAGAGAGAATTTTGGG + Intronic
969618677 4:8268179-8268201 TTGGAATGACCCAGAATGCTAGG - Intergenic
970293231 4:14599881-14599903 TTGTCATGGAACAGAGTTTTGGG - Intergenic
971459723 4:26882024-26882046 TTTTATTGAAACAGAATCTTTGG + Intronic
972069190 4:34993938-34993960 ATGGAAAGAAACAGAACATTTGG + Intergenic
972231549 4:37078376-37078398 TGGGAATGCAACAGAAATATGGG - Intergenic
972308929 4:37861219-37861241 TTTGTAAGAAACACAATTTTTGG - Intronic
974172042 4:58279454-58279476 TTAAAATTAAACTGAATTTTTGG + Intergenic
974224732 4:59024530-59024552 TTTCAATGAAACAGAAATTTAGG + Intergenic
974579588 4:63778683-63778705 TTGGAATTAAAGAGAATTGATGG - Intergenic
975065788 4:70061905-70061927 ATGGAATGAAAAAGTATGTTTGG - Intergenic
975881454 4:78912599-78912621 TAAAAATGAAACAGAGTTTTAGG - Exonic
975954467 4:79821139-79821161 ATAGAGTGAAAGAGAATTTTCGG - Intergenic
976133982 4:81915063-81915085 TTGAAATGAAATATAATTTGAGG - Intronic
977115194 4:93015692-93015714 TAGGAGTAAAACAGAATTGTGGG - Intronic
977328371 4:95605757-95605779 TTTGTATGAAACAAAGTTTTGGG - Intergenic
978095964 4:104778334-104778356 TTGGATTTAAACTGCATTTTAGG - Intergenic
979554895 4:122034391-122034413 TTGGAATCAAAAATCATTTTAGG + Intergenic
980066709 4:128197242-128197264 ATGAAATAAAAAAGAATTTTAGG - Intronic
980199240 4:129633401-129633423 TAGGATTTAAACAGAATTGTAGG - Intergenic
980233677 4:130076159-130076181 TTTAAATGAAACAGAATGTAAGG - Intergenic
980398304 4:132245311-132245333 TTTGAATTAAACAGAAATGTTGG + Intergenic
980425039 4:132617709-132617731 CTGGAATGAATTAAAATTTTGGG - Intergenic
980864318 4:138536569-138536591 TTGTAATGAAGCAGAATCTTAGG - Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
981335798 4:143567828-143567850 TTGGAATGAGTTAAAATTTTGGG + Intergenic
981746723 4:148059376-148059398 TTGGCATTAAACAGAATTGGTGG + Intronic
982009632 4:151094187-151094209 TTGGAAAGTAACAGAATATTTGG + Intergenic
982435746 4:155382497-155382519 TAGGTATGAAAGATAATTTTGGG + Intergenic
982735140 4:158998120-158998142 TTCTAATAAAACAGAATTTATGG + Intronic
982878058 4:160672044-160672066 TAGGAAAGATACAGAAATTTGGG + Intergenic
982986648 4:162217089-162217111 TTAAAATGAAACAGATTATTAGG + Intergenic
984703095 4:182831285-182831307 GTGGAATGCAAAGGAATTTTAGG + Intergenic
985080123 4:186256259-186256281 TTGGCTTGAAAAAAAATTTTAGG + Intronic
985756615 5:1723289-1723311 GAGGAAGGAAACAGAATGTTTGG + Intergenic
987879972 5:23730840-23730862 ATGGAATCAGACAGAATTTGAGG - Intergenic
987985779 5:25143912-25143934 ATGTAATTAAACAGAATTTGAGG + Intergenic
988048009 5:25984510-25984532 TTGGACTGGCTCAGAATTTTTGG + Intergenic
988347179 5:30052676-30052698 TTAGATATAAACAGAATTTTTGG + Intergenic
989544020 5:42651387-42651409 TGAGAATGAAACAGAAGCTTTGG + Intronic
991200902 5:63990543-63990565 TTGTAATAAAACAAAATCTTAGG + Intergenic
991204362 5:64033416-64033438 TTGAATTGAAAGAGAAATTTGGG + Intergenic
991370994 5:65919701-65919723 TTGGAATTAAACATAATTCGAGG - Intergenic
992500716 5:77340248-77340270 TTAGAAAGAATCAAAATTTTTGG + Intronic
993570358 5:89529908-89529930 TTGCAATGACACAGAATGATTGG + Intergenic
994578071 5:101606815-101606837 TTGGAATCTAATAAAATTTTTGG - Intergenic
994596573 5:101845393-101845415 ATGGAATGAAACTGGTTTTTCGG - Intergenic
994990141 5:106985523-106985545 TTGGAATGCATCAGTCTTTTGGG - Intergenic
995087370 5:108128450-108128472 TTGTAATGTAATAGCATTTTTGG - Intronic
995698633 5:114907539-114907561 TTGGTAAGAAAAAGATTTTTGGG - Intergenic
996008380 5:118451255-118451277 TTGTATTCAAACAGAAATTTAGG - Intergenic
996115500 5:119613734-119613756 TTGGAATGAGATAGAAATTTTGG + Intronic
996365662 5:122698185-122698207 TTTTTATGAAACAGTATTTTAGG - Intergenic
996643832 5:125791723-125791745 TTCAAATGAAAGAGATTTTTAGG + Intergenic
996765102 5:127028477-127028499 TTCTAATGAAACATACTTTTAGG - Intronic
996781332 5:127189884-127189906 TTCCACTGAAACAGAATTTCTGG + Intergenic
997155325 5:131550107-131550129 TGGGAATGAAAGAGCATTATGGG - Intronic
998294111 5:140950378-140950400 TTTGAATGATATAGAATTCTGGG + Intronic
998580104 5:143364269-143364291 TTGGCAGGATACAGAATTCTTGG - Intronic
998740387 5:145194109-145194131 CTGGAAGGAAACAGACATTTTGG + Intergenic
998868710 5:146531431-146531453 TTTGAGTGAAACAGAATTTCTGG + Intergenic
999387674 5:151166552-151166574 ATGGAAAAAAACAGAATTTTAGG - Intergenic
999587079 5:153101598-153101620 TTAGAATGATACAGCTTTTTTGG + Intergenic
1000290447 5:159865185-159865207 TTGGAATGAAGGAGCACTTTTGG + Intergenic
1000432558 5:161167691-161167713 GTGGAAGAAAACAGAAGTTTAGG + Intergenic
1001208234 5:169784514-169784536 TTGGCATGAAAGATAATTTCAGG + Intronic
1002758279 6:181582-181604 TTGGTATCAGACAGAATTTCAGG + Intergenic
1002973457 6:2049206-2049228 CTGGAATAATACATAATTTTTGG - Intronic
1003499172 6:6690179-6690201 TTGGACTGCAACAGATCTTTTGG + Intergenic
1004431490 6:15549106-15549128 TTGGAGTTAAACAAAATTGTAGG - Intronic
1004549333 6:16631508-16631530 TTGGAATGATACAGAATTTTTGG - Intronic
1004600279 6:17143211-17143233 TTCAGATGAAACAGAATTTAGGG - Intergenic
1004822187 6:19379531-19379553 TTTTAATGAATCAGAATGTTAGG - Intergenic
1005135012 6:22557932-22557954 TTAGAATGACCCAGAACTTTAGG + Intergenic
1005643414 6:27818151-27818173 ATAGAACAAAACAGAATTTTGGG + Intergenic
1005778639 6:29165005-29165027 TTCGAATGAAACATTGTTTTAGG - Intergenic
1006547825 6:34793793-34793815 TTGAAAGGACATAGAATTTTAGG + Intronic
1006953558 6:37845923-37845945 TTAAAATGAAACATTATTTTTGG + Intronic
1006991504 6:38218579-38218601 CTGGAATGGCACAGAATATTTGG - Intronic
1007197417 6:40074604-40074626 TTGAAATGAATCTGAATCTTAGG - Intergenic
1008155883 6:48013445-48013467 TTGGAATCAAATGGAAATTTTGG + Intronic
1008250639 6:49235633-49235655 TAGGAATAAAACACAGTTTTGGG + Intergenic
1010383316 6:75248950-75248972 TTGTAAAAAGACAGAATTTTGGG + Intronic
1010415614 6:75608153-75608175 TTGGAATGAAAGTGATTTTCAGG + Intronic
1011621132 6:89243534-89243556 TTGGAATGAAATAGAGGCTTGGG + Intergenic
1011826587 6:91313870-91313892 GTGGATTGAAACACCATTTTAGG + Intergenic
1012239403 6:96855062-96855084 TCGGTATGCAACAGAATCTTGGG - Intergenic
1012260219 6:97080084-97080106 TTGGACTGTAAAAGAAATTTGGG + Intronic
1012438095 6:99236187-99236209 TTGAAATGAAACAAGTTTTTTGG + Intergenic
1012662250 6:101915530-101915552 ATGGAATAAAACAGTATTTTAGG + Intronic
1012828488 6:104177883-104177905 TTGGAGGGAAACAGATTTTGAGG - Intergenic
1012849898 6:104434093-104434115 TTGGGATGCAAAATAATTTTTGG - Intergenic
1014108630 6:117595311-117595333 TTGGAATGAAACCGCAGTTATGG - Intronic
1014701296 6:124692028-124692050 TTCGAATAAAACTGAATATTTGG + Intronic
1015217730 6:130769119-130769141 ATGGAAAGAAATAGCATTTTGGG - Intergenic
1017600626 6:156076941-156076963 TTGGAATGAAAGAAGATGTTAGG - Intergenic
1021002252 7:15346105-15346127 TCTGAATTTAACAGAATTTTTGG - Intronic
1022756410 7:33296689-33296711 TTGGAAAGAAACACAAGTCTGGG - Intronic
1022866176 7:34423476-34423498 TGGGAAGGGAACAGAATTATGGG + Intergenic
1023224039 7:37950489-37950511 TTGGAGAGAAATATAATTTTAGG + Exonic
1023530041 7:41143632-41143654 ATAGAATGAAACTGTATTTTAGG + Intergenic
1024102864 7:46050678-46050700 TTCATATGAAACAGATTTTTAGG + Intergenic
1024452668 7:49565423-49565445 TTGGAAGGATACAAAATTCTTGG - Intergenic
1025887443 7:65610403-65610425 TTTGAATGAAACAGAACATGTGG + Intergenic
1026289636 7:68994825-68994847 TTGGATTCAAACAGACTCTTGGG - Intergenic
1027381569 7:77615730-77615752 TTGAAATGGAAAAGAATTTTAGG - Intronic
1027672062 7:81113421-81113443 TCATAATGAAACAGAATTTTAGG + Intergenic
1027985456 7:85282560-85282582 TTGGAGTGAATCATGATTTTTGG - Intergenic
1028725028 7:94076885-94076907 TTTGAATGAGACAGAACTCTTGG - Intergenic
1029917611 7:104228240-104228262 TTTGAAAGACTCAGAATTTTAGG + Intergenic
1029924052 7:104297191-104297213 TTGGAATGAATCCCAAATTTAGG + Intergenic
1030452381 7:109729546-109729568 TTGGAATTAAAAATTATTTTAGG + Intergenic
1031009017 7:116504461-116504483 TTGAAATAAAACACAATTTGTGG + Intronic
1031854971 7:126911509-126911531 TTTGAATGAAACAGAACATGTGG - Intronic
1032281432 7:130505623-130505645 TTTAAATGATACAGTATTTTAGG + Exonic
1032366220 7:131302483-131302505 TTGGAACCAAACAGCCTTTTGGG - Intronic
1032953482 7:136943399-136943421 TTGGAAACAAACAGAATAATAGG + Intronic
1035306843 7:157938703-157938725 TTGATATTAAAGAGAATTTTTGG - Intronic
1035731445 8:1856433-1856455 TTTGAAGGAAACAGATTTTTAGG - Intronic
1036040250 8:5071017-5071039 TGGGACTTAAACAGAATATTTGG + Intergenic
1036190895 8:6669901-6669923 TTGGAATTTAACAGAGATTTTGG + Intergenic
1036492229 8:9238375-9238397 TTGGAATGAATGAGGATTCTTGG + Intergenic
1037222551 8:16543048-16543070 GTGGAATGACACTGGATTTTGGG - Intronic
1038380883 8:27092520-27092542 TTGGAGAGAAACAGAATATATGG - Intergenic
1039026092 8:33259908-33259930 TTGGAATCATACAGTATTTTTGG - Intergenic
1039673406 8:39630860-39630882 TTGTAATGATACAGAATTCCTGG - Intronic
1040295877 8:46148834-46148856 CTGGAATGGAAGAGAATTTTTGG + Intergenic
1040451994 8:47557087-47557109 TTAGTATAAAACAGACTTTTGGG - Intronic
1041518119 8:58725301-58725323 ATGGAAAGAAACAGAATTACAGG + Intergenic
1042471317 8:69191767-69191789 TTGGAATGATACACAATATTTGG + Intergenic
1043097571 8:75994813-75994835 GTGGAAGAAAACAGAAATTTGGG + Intergenic
1043655325 8:82657748-82657770 TTGGAATAATAAAGTATTTTGGG + Intergenic
1043703328 8:83318386-83318408 TTGGACTGTAAAAGAGTTTTGGG - Intergenic
1044229975 8:89762907-89762929 TTGCAATGAGCCTGAATTTTTGG + Exonic
1044270241 8:90233912-90233934 TTGTAATGAAACACAATTCTTGG - Intergenic
1044302616 8:90603890-90603912 TTGAAATAAAAATGAATTTTAGG - Intergenic
1044390409 8:91643644-91643666 GTGGAGTGAAACAGAAAATTAGG - Intergenic
1044677633 8:94745668-94745690 TTGGAATAAAACGGAATTCCTGG - Intronic
1044864128 8:96552933-96552955 ATTGAATGAAAAAGAATTGTAGG + Intronic
1045306435 8:100960603-100960625 CTGAATTGAAACAGAATTTCTGG - Intergenic
1046744483 8:117862400-117862422 TAGGAATGAAAGAGAAGTTAAGG - Intronic
1046917679 8:119694265-119694287 TTGGAATTAAACTGAACTGTGGG - Intergenic
1048054446 8:130850002-130850024 TTGCAAAAAAACAGAATATTTGG + Intronic
1048343534 8:133558821-133558843 GTTGAATGAAACAGCATTATTGG - Intronic
1048680547 8:136836481-136836503 TTGGAATCAGACAAAATTTCAGG + Intergenic
1048814890 8:138323264-138323286 TTGTAAGGAAAGAGAAGTTTAGG - Intronic
1049879071 8:145049772-145049794 TTGGATAGAAACACAATTTGAGG - Intergenic
1049924141 9:392655-392677 TTGGAATGAAAAAAAAATTCTGG - Intronic
1050455352 9:5829657-5829679 TTGAAAGGAAAAAGAATATTAGG - Intronic
1050984164 9:12060762-12060784 TTGTCATGTTACAGAATTTTTGG + Intergenic
1051333124 9:16043420-16043442 TTGTAAGAAAACAGAATCTTGGG + Intronic
1052128114 9:24804611-24804633 TCTGAATGAAATAGGATTTTTGG - Intergenic
1052670408 9:31550249-31550271 TTGGAATTAAACTAGATTTTAGG + Intergenic
1053057527 9:35002712-35002734 CTGGGATGAAACAGAGTTTGGGG + Intergenic
1053257021 9:36626263-36626285 TTAGGATGAAACAAATTTTTTGG + Intronic
1053604103 9:39639706-39639728 TTGGAATGAATGAAAACTTTTGG - Intergenic
1053861918 9:42395758-42395780 TTGGAATGAATGAAAACTTTTGG - Intergenic
1054249437 9:62702708-62702730 TTGGAATGAATGAAAACTTTTGG + Intergenic
1054840783 9:69736834-69736856 TTTGAATTAAGCAGCATTTTTGG + Intronic
1055382381 9:75722947-75722969 TCTGAAAGAAACAGAGTTTTAGG + Intergenic
1055721073 9:79175425-79175447 TTGGAATTCAACAGTAGTTTAGG + Intergenic
1058263780 9:102872675-102872697 TTGGAAAGAAACAGTGTTCTTGG + Intergenic
1062078581 9:134606198-134606220 ATGCAATGAAACAGGATATTTGG - Intergenic
1186287731 X:8064115-8064137 ATGGAATGAACAAGAATTGTTGG - Intergenic
1186624882 X:11282636-11282658 TTTGATCGAAACAGAATTTCTGG + Intronic
1186707584 X:12158088-12158110 TTGGGAGGAAAGGGAATTTTTGG - Intronic
1186899893 X:14042879-14042901 TTGTAATGGGACATAATTTTTGG + Intergenic
1187217790 X:17293898-17293920 TTGCAAAGAAAAAGAAGTTTTGG + Intergenic
1187252542 X:17611899-17611921 TTGAAGAGAACCAGAATTTTTGG + Intronic
1187683537 X:21792888-21792910 TTGGCATGAAGAATAATTTTTGG - Intergenic
1188114699 X:26228873-26228895 TAGAAATAAAACACAATTTTGGG + Intergenic
1191242623 X:58201366-58201388 TTCTAATGACAGAGAATTTTGGG + Intergenic
1191946800 X:66543389-66543411 ATGGAATCAAAGAGAAATTTTGG - Intergenic
1192188989 X:68979200-68979222 TTGGCAAGAAACAGAACTCTGGG + Intergenic
1192319822 X:70081501-70081523 GTTGAATGTTACAGAATTTTAGG + Intergenic
1192395141 X:70772801-70772823 AAAGAATGAAACAGAAATTTTGG + Intronic
1192896209 X:75445202-75445224 TTCCAAAGAAACAGAATTTTAGG + Intronic
1193136463 X:77976423-77976445 TTATAATAAATCAGAATTTTAGG - Intronic
1193321841 X:80131911-80131933 TTGAAATGAATCAGAATGTATGG + Intergenic
1194113746 X:89871373-89871395 TAAAAATCAAACAGAATTTTTGG - Intergenic
1194519833 X:94905222-94905244 TTTGCATGATACAGAATTCTGGG + Intergenic
1194708702 X:97206474-97206496 TCAAAATGAAACAGCATTTTAGG - Intronic
1195158701 X:102149892-102149914 TTGTAATGACACAAAATTTCTGG + Intergenic
1196283705 X:113854893-113854915 CTGGAAACAAAAAGAATTTTAGG + Intergenic
1196310142 X:114154419-114154441 TTAGAATGAAACAGATCTCTAGG + Intergenic
1196502521 X:116402116-116402138 TTGGAATGAAACAGCCCTTTTGG - Intergenic
1196687172 X:118521136-118521158 TTGGAAAGCAATAGAAGTTTTGG + Intronic
1197754967 X:129986938-129986960 TTTGAGAGAAACAGAATTATGGG + Intronic
1198590518 X:138175336-138175358 TTGGAAAGAAAAAGAAGTTCTGG + Intergenic
1199917760 X:152362601-152362623 TTGGATGGAAACAAGATTTTAGG + Intronic
1200466481 Y:3526728-3526750 TAAAAATCAAACAGAATTTTTGG - Intergenic
1200630893 Y:5585505-5585527 ATGGAATGACAGAAAATTTTTGG - Intronic
1201110340 Y:10794621-10794643 CTGGAATGGAATGGAATTTTAGG - Intergenic
1201128747 Y:10936712-10936734 TTGGAATGGAACAGAATGGAAGG - Intergenic
1201686472 Y:16709622-16709644 TTCGAATGAAGCAGAATATATGG - Intergenic
1201934716 Y:19396112-19396134 TGGGAGTGAAACTGGATTTTTGG - Intergenic
1202586481 Y:26433889-26433911 TAGAAATGAAACAGAAATATTGG + Intergenic