ID: 981020790

View in Genome Browser
Species Human (GRCh38)
Location 4:140025959-140025981
Sequence TGACATAGCCACAGTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981020790_981020793 8 Left 981020790 4:140025959-140025981 CCCTGATCACTGTGGCTATGTCA 0: 1
1: 0
2: 0
3: 13
4: 217
Right 981020793 4:140025990-140026012 ATCCTTGTCTTTTACTCATTGGG 0: 1
1: 0
2: 0
3: 30
4: 256
981020790_981020792 7 Left 981020790 4:140025959-140025981 CCCTGATCACTGTGGCTATGTCA 0: 1
1: 0
2: 0
3: 13
4: 217
Right 981020792 4:140025989-140026011 CATCCTTGTCTTTTACTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981020790 Original CRISPR TGACATAGCCACAGTGATCA GGG (reversed) Intronic
900040373 1:457235-457257 AGAGATAGCTACAGTGATGAGGG + Intergenic
900061804 1:692206-692228 AGAGATAGCTACAGTGATGAGGG + Intergenic
900640664 1:3686692-3686714 TCAGATGGCCACAGTGACCACGG - Intronic
900983370 1:6059146-6059168 TGACCTGGCCACAGGAATCACGG + Intronic
902647098 1:17807237-17807259 TGACATAGTCACAGTTTCCATGG + Intronic
902659008 1:17888330-17888352 TGACTTGGCCTCAGTGAGCAGGG + Intergenic
902831065 1:19013013-19013035 TGACATAGCCTCAGTTTTCTTGG - Intergenic
904150893 1:28439551-28439573 AGACACAGCCCTAGTGATCAAGG - Intronic
904279687 1:29410050-29410072 TGACATCTCCACAGTGAGGAGGG + Intergenic
904882634 1:33712294-33712316 TGACATAGCCCCTGACATCAGGG - Intronic
907478643 1:54727111-54727133 CGACAGAGCTACAGTAATCAAGG + Intronic
908731545 1:67231157-67231179 TGTCAAAGCCACAGTAACCAAGG - Intronic
910698346 1:90045900-90045922 TTACCTAGACACAGTGATAAGGG - Intergenic
912104911 1:106260645-106260667 AGTCCTAGCCATAGTGATCAGGG - Intergenic
912237753 1:107870269-107870291 TGACATGGATGCAGTGATCAGGG - Intronic
915535573 1:156533515-156533537 TGAAAGAGGCACAGGGATCAGGG - Intronic
915812338 1:158926941-158926963 TCACATGGCCACAGAGATCAAGG - Intergenic
916530246 1:165649790-165649812 TGAAATAGCCACAGTGCTGGGGG + Intronic
918952436 1:191156304-191156326 TGACATATTCAAAGTGATGAAGG + Intergenic
919205267 1:194414200-194414222 AGGCATATCCACAGTGACCATGG - Intergenic
921745835 1:218739749-218739771 TGACAAAATCACAGTGATCTTGG + Intergenic
1063428701 10:5969107-5969129 TGACAAAGCAACAATAATCAAGG - Intronic
1068152976 10:53157711-53157733 TAACATAACCACAGTGAACAAGG + Intergenic
1069349332 10:67506891-67506913 TGACTTGGCCAAACTGATCATGG - Intronic
1069760701 10:70809188-70809210 TGACCTAGGCAGAGGGATCAAGG - Intergenic
1070680156 10:78443414-78443436 TGTCATAGACGCAGTGGTCAGGG - Intergenic
1071516337 10:86300445-86300467 TGACAGAGCCAGAGGGAACAGGG + Intronic
1073495744 10:103889456-103889478 TGAGCGAGGCACAGTGATCAAGG + Intronic
1073624551 10:105083514-105083536 TGACATTGCCACAGGTATTAGGG - Intronic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1074839504 10:117335207-117335229 TGACATAGCCAAAGTGCTGAAGG + Intronic
1075343819 10:121667791-121667813 TGTCATAGACACAGTGGCCAGGG - Intergenic
1075407615 10:122205006-122205028 TGACAGAGCCATAGTGAGGATGG - Intronic
1076349533 10:129806479-129806501 TGACATATCCAAAGTGAAGAGGG - Intergenic
1076431667 10:130408066-130408088 AGTCATGGCCAGAGTGATCAGGG - Intergenic
1076966595 11:93137-93159 AGAGATAGCTACAGTGATGAGGG + Intergenic
1077826441 11:5813820-5813842 TGATAAAGCCCAAGTGATCATGG - Intronic
1082926315 11:58551103-58551125 TGGCATTGCCACAGTGCCCAAGG - Exonic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085749606 11:79149849-79149871 TGACAAAGACACAGTGCACAAGG + Intronic
1085858951 11:80209907-80209929 TGACATAGGCTGAGAGATCAGGG + Intergenic
1086993266 11:93329352-93329374 TTACATAGCCTTAGTGATCTTGG + Intergenic
1087466065 11:98507964-98507986 TGAAACTGCCGCAGTGATCATGG - Intergenic
1087871017 11:103293217-103293239 TGACATATCCAGAGTGCTAAAGG - Intronic
1093202909 12:16211004-16211026 TGACTTAGCCACAGGAACCAAGG + Intronic
1093363574 12:18263502-18263524 TGATATAGCCACATTTATAATGG - Intronic
1093803822 12:23407896-23407918 GGACATAGCAACAGTCATCAAGG + Intergenic
1096772755 12:53946613-53946635 TGACTCAGCCAGAATGATCAGGG + Intergenic
1098142583 12:67465638-67465660 TTATATACCAACAGTGATCAAGG - Intergenic
1098630401 12:72714963-72714985 TGACAAGGGCACAGTGACCAGGG + Intergenic
1098862147 12:75722156-75722178 TGACAAAGTATCAGTGATCAAGG - Intergenic
1101056214 12:100917402-100917424 TGCCATAGCCACAGATATCTTGG - Intronic
1104210100 12:126680623-126680645 TGAGATAGCGACTGTGAACAGGG + Intergenic
1104545167 12:129704512-129704534 TGACATAGCCACACTGCTCCTGG + Intronic
1105642638 13:22281175-22281197 TGAAATAAACACATTGATCATGG - Intergenic
1105883674 13:24624717-24624739 TGAATTTGCCACTGTGATCAGGG + Intergenic
1109233891 13:59792239-59792261 TGACATAGCAGCTTTGATCAAGG - Intronic
1113602821 13:111582792-111582814 TGACATTGTCACAGTGATGCAGG - Intergenic
1114746131 14:25149317-25149339 TTATATAGCTACAGTAATCAAGG - Intergenic
1116780477 14:49232155-49232177 TTACAGAGCTACAGTAATCAAGG - Intergenic
1120034343 14:79679568-79679590 TGACATACCTTCAGTGCTCAAGG - Intronic
1202848336 14_GL000225v1_random:497-519 TTACATCACCTCAGTGATCAGGG - Intergenic
1126578987 15:50225209-50225231 TGAAATAGACACAGTAATCATGG + Intronic
1129241038 15:74252411-74252433 TAACACAGTGACAGTGATCATGG + Intronic
1130961910 15:88665540-88665562 TGACATATTTACAGTGATGAAGG + Intergenic
1131008972 15:89001688-89001710 TCTCATGGCCACAGAGATCAAGG - Intergenic
1132294522 15:100725721-100725743 GGACATAGCCACAGAGGCCAAGG + Intergenic
1132441535 15:101870386-101870408 AGAGATAGCTACAGTGATGAGGG - Intergenic
1134240878 16:12505618-12505640 GTACAAAGCCACAGTAATCAAGG - Intronic
1134352597 16:13451769-13451791 TGACATGTCCACAGTCCTCAAGG - Intergenic
1135643656 16:24142798-24142820 GGAGATAGCCCCAGAGATCAAGG + Intronic
1137380500 16:47994461-47994483 ATAAAGAGCCACAGTGATCAAGG + Intergenic
1140069172 16:71634400-71634422 GGCCATTGCCACAGTGACCATGG - Intronic
1141068053 16:80929866-80929888 TGACATAGACCAGGTGATCAGGG + Intergenic
1144267530 17:13585703-13585725 TGACACAACCGTAGTGATCATGG + Intronic
1144426501 17:15147339-15147361 TGACTTAACCACAGTGTACAAGG - Intergenic
1145069630 17:19792888-19792910 AGACAAAGCTACAGTAATCAAGG + Intronic
1145280770 17:21465307-21465329 TAAGATAGCCACAGTGTTCTGGG + Intergenic
1145287163 17:21514420-21514442 TCTCACAGCCACAGAGATCAAGG - Intergenic
1145390461 17:22451931-22451953 TCTCACAGCCACAGAGATCAAGG + Intergenic
1147462685 17:40583730-40583752 TGACAGAGATGCAGTGATCAGGG - Intergenic
1147524450 17:41207546-41207568 TGATGTAGCTACAGTAATCAAGG - Intronic
1148987761 17:51638510-51638532 TAACAAAGCCACAGTGCCCAGGG + Intronic
1149413223 17:56430764-56430786 TGACATAGTCACTGTCCTCATGG + Intronic
1151214344 17:72567573-72567595 TGACATAGCCCCAGGCATCCAGG - Intergenic
1157173847 18:45432796-45432818 AGACATAGCCTCAGTCACCAAGG + Intronic
1158163851 18:54517155-54517177 TCCCTTAGCCTCAGTGATCATGG + Intergenic
1160643398 19:162760-162782 AGAGATAGCTACAGTGATGAGGG + Intergenic
1164118628 19:22245699-22245721 TCACATAACCAAAGTGATAAAGG + Intergenic
1165377708 19:35454793-35454815 TGCCATGGCCACAGTAAACATGG + Intergenic
1166233836 19:41441873-41441895 TAACATAGTCACAGTGCCCAGGG - Intergenic
1167266944 19:48487931-48487953 GGACAGAGCCACATTGAGCAGGG + Intronic
925995347 2:9288320-9288342 TGTCATCTCCACAGTGTTCATGG + Intronic
926147115 2:10403378-10403400 TGACATAGCCACTGTCACCCAGG + Intronic
926955374 2:18289218-18289240 TGAAATGGCCACAGTGAGGAAGG - Intronic
927600316 2:24434978-24435000 TGTCAGAGGGACAGTGATCAGGG - Intergenic
932727510 2:74192173-74192195 TCTCACAGCCACAGAGATCAAGG - Intergenic
933549455 2:83756945-83756967 TGACATAGCATCAGTGGTAAGGG + Intergenic
937529781 2:122814159-122814181 TGGCATAGATGCAGTGATCAGGG + Intergenic
937751638 2:125482334-125482356 CTATATAGCCACAGTCATCAAGG - Intergenic
938712760 2:133989782-133989804 TGACATGGAAACAGTGCTCATGG + Intergenic
940714178 2:157200447-157200469 TGCCATAGCCAAAGTCATCTAGG - Intergenic
943532618 2:189103494-189103516 TGAGATGGGCACAGGGATCAAGG - Intronic
944610647 2:201402561-201402583 TGATTTAACCACAGTGATAAGGG + Intronic
945184303 2:207123896-207123918 GGACAGAGCGACAGTGACCAAGG - Exonic
946933339 2:224693740-224693762 TGACATAGACACAGGTTTCAGGG - Intergenic
947173438 2:227336174-227336196 TGACTTAGTCACACTGTTCAAGG - Intronic
948663203 2:239519294-239519316 AAACAGAGCCATAGTGATCAGGG - Intergenic
1174957474 20:55115259-55115281 TGACTTAGCCAAAATTATCAAGG + Intergenic
1175334223 20:58184655-58184677 TGACATATTCACAGGGAACAGGG - Intergenic
1180166326 21:46032506-46032528 TTTCAAAGCCACAGTAATCAGGG - Intergenic
1181088121 22:20453540-20453562 CTACATAGCTACAGTAATCAAGG - Intronic
1181169667 22:21001089-21001111 TGTCACAGGCACAGTGATCCTGG + Intronic
1181980545 22:26762933-26762955 TGACTAAGCCACAGTGAATAAGG + Intergenic
1183718046 22:39545737-39545759 TCAAATAACCACAGTGACCAAGG - Intergenic
1184355955 22:43979765-43979787 TGAGACAGGCACAGTGATGAAGG - Intronic
1185125187 22:49006693-49006715 TGACATGGGCACAGGGGTCATGG - Intergenic
950230286 3:11270293-11270315 TGACCTTGCCACAGTAAACAAGG - Intergenic
954084909 3:48236671-48236693 TCTCATAGTCACAGGGATCAAGG - Intergenic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
954526907 3:51279992-51280014 TGAGATGGCCCCAATGATCATGG - Intronic
954663943 3:52240551-52240573 TGACATAGGCCCAGTCTTCAGGG - Intergenic
955066998 3:55542362-55542384 TCACAGAGCCACAGTGAGTATGG - Intronic
955476367 3:59340430-59340452 CAGCATGGCCACAGTGATCAGGG + Intergenic
956091342 3:65670536-65670558 TGACATAGCCATAGACATTATGG + Intronic
959011982 3:101088093-101088115 TGATAAAGGCACAGTGATTATGG + Intergenic
960547201 3:118929148-118929170 TGACATAAGAACAGTAATCATGG - Intronic
961174655 3:124824183-124824205 TTACAAAGCTACAGTAATCAAGG + Intronic
961343568 3:126246509-126246531 TGACACAGCAACAGCGAGCAGGG + Intergenic
964354300 3:155835901-155835923 TCTCACAGCCACAGAGATCAAGG - Intronic
964822752 3:160791578-160791600 TGACATTAGAACAGTGATCAAGG + Intronic
965218257 3:165892923-165892945 TGAAATAGGCTCAGTGACCATGG - Intergenic
965508315 3:169540479-169540501 TGACATGGCCACATTGAACATGG - Intronic
965652992 3:170953143-170953165 GGACAGAGCGACAGTGACCAAGG - Intergenic
967636732 3:191809734-191809756 TGCCATAGGCACAGTGTTGATGG + Intergenic
969904410 4:10380679-10380701 TCACAGAGCAACAGTGAACAAGG - Intergenic
970430634 4:15986043-15986065 AGACACAGCCACAGTTATCAGGG + Intronic
971790919 4:31168863-31168885 AGACTTGGCCAAAGTGATCATGG - Intergenic
972702260 4:41505536-41505558 TGACATCACCACAGAGGTCAGGG - Intronic
974005771 4:56555358-56555380 TTACAAAGCTACAGTAATCAAGG - Intronic
976665319 4:87584319-87584341 TGACAGAGCCAAGATGATCAAGG - Intergenic
977240493 4:94562570-94562592 TCACATTGCCACAGTTCTCAAGG + Intronic
977711940 4:100136261-100136283 GGACATAGCCAAAGTGGTCAAGG + Intergenic
978803887 4:112780412-112780434 TAACAAAGACACAGTGATTATGG + Intergenic
979106175 4:116689821-116689843 TGACATATCCAAAGTGCTGAAGG + Intergenic
981020790 4:140025959-140025981 TGACATAGCCACAGTGATCAGGG - Intronic
983782886 4:171695167-171695189 TCACATACCCACAGTGTACACGG + Intergenic
985087427 4:186327383-186327405 TTATATAGCTACAGTAATCAAGG - Intergenic
988527843 5:32002010-32002032 TGAAATAACAACAGAGATCATGG - Intronic
990852147 5:60218030-60218052 TGACATAGCTAGAGTTAACATGG - Intronic
993987484 5:94614540-94614562 TTACATAGCCAAAGTGACCTAGG + Intronic
994927047 5:106129147-106129169 AGTCCTAGCCAGAGTGATCAGGG + Intergenic
995412608 5:111875796-111875818 TCTCATGGCCACAGAGATCAAGG + Intronic
995472142 5:112513922-112513944 TTTCATGGCCACAGAGATCAAGG + Intergenic
997079721 5:130724059-130724081 TCTCATGGCCACAGAGATCAAGG - Intergenic
997249672 5:132378774-132378796 TGACAGAGTCACAGTGACCCAGG - Intronic
998184944 5:139971247-139971269 TGACACAGGCAGAGTGATCGTGG - Intronic
1000206016 5:159059289-159059311 TGACATACCCAAAATAATCAGGG - Intronic
1000312102 5:160054984-160055006 TGACACAGCCACACTTCTCAAGG - Intronic
1001575006 5:172757620-172757642 TGATTTTGCCACAGTGATCTGGG - Intergenic
1001650439 5:173312118-173312140 TGACATAGCCTCTGTCCTCATGG + Intergenic
1002733474 5:181361710-181361732 AGAGATAGCTACAGTGATGAGGG - Intergenic
1002751069 6:112408-112430 AGAGATAGCTACAGTGATGAGGG + Intergenic
1003386256 6:5670315-5670337 TGTGATATCCACAATGATCAGGG - Intronic
1003723810 6:8736200-8736222 TGGCAATGCCACAGTCATCAGGG - Intergenic
1004168019 6:13274015-13274037 TCACAAGGCCACAGTGAGCACGG - Intronic
1004795135 6:19073842-19073864 TGACATATCCAAAGTGCTAAAGG + Intergenic
1004799072 6:19125578-19125600 AGACAAAGCTACAGTAATCAAGG + Intergenic
1004870466 6:19899107-19899129 TGCCAGCTCCACAGTGATCAGGG + Intergenic
1005762491 6:28980194-28980216 TCTCACAGCCACAGAGATCAAGG - Intergenic
1007322192 6:41035388-41035410 TTACCCAGCCACAGTGACCAAGG - Intronic
1009306572 6:62098442-62098464 TGATATAGTCAAAGTGCTCAAGG - Intronic
1012648819 6:101725081-101725103 TTACTTTGCCACAGTGATCCGGG + Intronic
1014873774 6:126630058-126630080 TAACATAGCCACACTGATGATGG - Intergenic
1015348417 6:132187668-132187690 TGACACAGGCACAGTGATTTAGG + Intergenic
1015699654 6:136021967-136021989 TGACAGAGACTCAGTGACCAAGG - Intronic
1016881348 6:148915297-148915319 TGACATCCCCACAGTCATCCAGG + Intronic
1018362048 6:163080381-163080403 TGACAGTGCCACAGTGCTGATGG + Intronic
1018405434 6:163476919-163476941 TGACAGAGCTATAGTGATGATGG - Intronic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019237722 6:170634032-170634054 AGAGATAGCTACAGTGATGAGGG - Intergenic
1019261790 7:86071-86093 TGACAACGCCACAGTGTGCAGGG + Intergenic
1021246047 7:18262331-18262353 TGACATATTCAAAGTGATGAAGG + Intronic
1026250764 7:68668418-68668440 AGACATTGCCACTGTTATCAAGG + Intergenic
1027338802 7:77183241-77183263 TGAAATGGCCAAAGAGATCAAGG - Intronic
1027426082 7:78062609-78062631 TGACAAAGCCACATTGGACAGGG - Intronic
1028354211 7:89886824-89886846 TGCCAAAGCCACAGTGATATTGG - Intergenic
1028818756 7:95180881-95180903 TGACATGGATGCAGTGATCATGG + Intronic
1029970713 7:104786010-104786032 TGACATGGACACAGTGTACATGG - Intronic
1030774828 7:113521526-113521548 TCACAGAGCCACAATGATGATGG + Intergenic
1031626281 7:123996410-123996432 TGACATTTACACAGTGCTCAGGG + Intergenic
1032883960 7:136117591-136117613 TGACAGAGGCACTGTGGTCAAGG + Intergenic
1032958231 7:136999083-136999105 TGAATTAGCAACAGTGTTCATGG - Intronic
1035510045 8:172579-172601 AGAGATAGCTACAGTGATGAGGG + Intergenic
1039095132 8:33875818-33875840 TGGCATAGATGCAGTGATCAGGG - Intergenic
1039925343 8:41926275-41926297 TGACAAAGAGACAGTGATTAAGG - Intergenic
1040422375 8:47252235-47252257 TGGCAAAGCCACAGGGATGAAGG + Intergenic
1040959189 8:53013019-53013041 TGACATGGCCAGGGTGAGCAAGG + Intergenic
1041127565 8:54659613-54659635 TGACAAAGCAACAGTAATAAAGG - Intergenic
1041177391 8:55210654-55210676 TCTCATGGCCACAGAGATCAAGG + Intronic
1041339610 8:56830125-56830147 TGCCATAGCCAAAGTCATCTAGG - Intergenic
1042807072 8:72782513-72782535 TGACACAACAACAGTGTTCAAGG + Intronic
1044437108 8:92177307-92177329 TGGAGTAGCCACAGTGACCAGGG + Intergenic
1048016357 8:130501030-130501052 AGACATTGACACGGTGATCATGG - Intergenic
1048036571 8:130682930-130682952 TGGCAGAGCCACAGGGAGCACGG - Intergenic
1049235340 8:141509578-141509600 CAACAAAGCCACAGCGATCATGG - Intergenic
1049297385 8:141849986-141850008 TGTGATAGGCACAGGGATCACGG + Intergenic
1050263518 9:3866210-3866232 TGACATAGTCTCTGTGCTCAGGG + Intronic
1051044869 9:12860892-12860914 TGACTTGCCCACAGTGATCCAGG + Intergenic
1051352403 9:16210079-16210101 TTACACAGCCACAGTAATTAAGG - Intronic
1051857757 9:21588895-21588917 TGAGATAGCCACAGGGAGGATGG + Intergenic
1052253152 9:26423814-26423836 TGACACATCCACAGACATCATGG + Intergenic
1054383924 9:64526016-64526038 TGACATGGATGCAGTGATCAAGG + Intergenic
1059290794 9:113221840-113221862 TGGCATAGCCAGAGTGACCTTGG + Intronic
1060671519 9:125474076-125474098 TGACATAGACTCAGTGATGAGGG + Intronic
1061645328 9:131996302-131996324 TGAGAAAGGCACAGTGATGAGGG + Intronic
1062757929 9:138314329-138314351 AGAGATAGCTACAGTGATGAGGG - Intergenic
1203448594 Un_GL000219v1:87161-87183 TATCATAGCAACAGTGAACAAGG + Intergenic
1186382326 X:9073870-9073892 AGATGTAGCCACAGTGATAAGGG + Intronic
1188451868 X:30316027-30316049 TTACCCAGCCACACTGATCATGG - Intergenic
1189590298 X:42503844-42503866 GGTCATAGCAACTGTGATCATGG - Intergenic
1191792675 X:64987345-64987367 TTAGATAGCTACAGTAATCAAGG + Intronic
1192014034 X:67309271-67309293 TGACATGGATGCAGTGATCAGGG - Intergenic
1192708763 X:73557712-73557734 TCTCATGGCCACAGAGATCAAGG + Intergenic
1194475325 X:94351707-94351729 TGATATAGCTACAATAATCATGG + Intergenic
1194812158 X:98399936-98399958 TAACATAGTCACAGTGACTAGGG - Intergenic
1195206357 X:102603125-102603147 TGAAATAGCTACAATGATAATGG + Exonic
1199425923 X:147700927-147700949 TGACATGGATGCAGTGATCAGGG + Intergenic
1199842350 X:151662958-151662980 TGACATATCCACAGTGATGGGGG - Intronic
1200888080 Y:8292028-8292050 TGAAACAGGCACAGTCATCACGG + Intergenic