ID: 981028436

View in Genome Browser
Species Human (GRCh38)
Location 4:140099757-140099779
Sequence AAGGTTTTGAGAGGTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981028436_981028441 14 Left 981028436 4:140099757-140099779 CCCAACACACCTCTCAAAACCTT 0: 1
1: 0
2: 2
3: 31
4: 262
Right 981028441 4:140099794-140099816 TCACTCAGTTTCATCTCTCCTGG 0: 1
1: 0
2: 12
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981028436 Original CRISPR AAGGTTTTGAGAGGTGTGTT GGG (reversed) Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
901767465 1:11512346-11512368 AAGCATTTGAGAGGTGACTTGGG - Intronic
902148327 1:14421787-14421809 AGGGTTTTGAAAGGTGAGCTTGG - Intergenic
902458888 1:16555866-16555888 AAGGTAGTGAGAGGCATGTTTGG + Intergenic
902493268 1:16852050-16852072 AAGGTAGTGAGAGGCATGTTTGG - Intronic
903152074 1:21416622-21416644 AAGGTAGTGAGAGGCATGTTTGG + Intergenic
903293757 1:22330773-22330795 AAGGTTTTAAAATGTCTGTTGGG + Intergenic
903487758 1:23703558-23703580 ATGGTTTTGAGATGGGAGTTTGG - Intergenic
904504633 1:30940689-30940711 CAGGTTGTGAAAGGTGTCTTAGG - Intronic
905738009 1:40344040-40344062 AAGATTTAGAGGGGTGTGGTGGG - Intergenic
906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG + Intergenic
911401096 1:97376444-97376466 AAGGCCTTGCCAGGTGTGTTTGG - Intronic
911790861 1:102014037-102014059 AAGCATTTGAAAGGTGAGTTGGG + Intergenic
912723883 1:112042371-112042393 CAGGTTTTGAGAGGCTTGTGTGG - Intergenic
913166834 1:116195593-116195615 AAGTTTGAGAGAGGAGTGTTTGG + Intergenic
913246917 1:116878428-116878450 AAGGGATTGAGAGGGGTGCTGGG - Intergenic
913257419 1:116966256-116966278 AACATTTTGAGAGGTGTCTATGG - Intronic
913606758 1:120474519-120474541 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
913988581 1:143587105-143587127 AAGGTAGTGAGAGGCATGTTTGG + Intergenic
914209673 1:145565622-145565644 AAGGTGGTGAGAGGCGTGTTTGG + Intergenic
914268590 1:146057991-146058013 AAGGTGGTGAGAGGCGTGTTTGG + Intergenic
914368500 1:147002872-147002894 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
914584435 1:149047317-149047339 AAGGTGGTGAGAGGCGTGTTTGG + Intronic
914685242 1:149973052-149973074 ATGGATTTGAGAGATGTTTTAGG - Intronic
918922006 1:190724657-190724679 AATGTTTTAAGATGTGTTTTAGG + Intergenic
919993059 1:202722387-202722409 AAGGGTTTGAGTGGAGTGTGAGG + Intergenic
921356069 1:214285425-214285447 AATGCTTTGAGAGTTGTTTTGGG + Intronic
921466287 1:215492198-215492220 AAGCATTTGAGAGGTGACTTGGG + Intergenic
921562347 1:216673707-216673729 AATGTTTTGAGACATGTATTAGG + Intronic
921795202 1:219335032-219335054 AATGTTTTGAGAAGTGGGTTTGG - Intergenic
921827028 1:219683859-219683881 GAGGTTTGGAGAGTTGTATTGGG + Intergenic
922759518 1:228118130-228118152 TAGGTTTTACGAGGTGTGTAAGG - Intergenic
922850338 1:228727936-228727958 AAGTTTCTGTGATGTGTGTTTGG + Intergenic
923165059 1:231352912-231352934 AAGGCTTTCAGAGGTGTGAATGG + Exonic
1063121359 10:3107036-3107058 AAGGTGGTGAAAGGTGTGCTGGG - Intronic
1064179978 10:13106052-13106074 CAGATTTTTAGAAGTGTGTTTGG - Intronic
1064698358 10:17990581-17990603 AAGGGTATGAGAAATGTGTTGGG - Intronic
1065581346 10:27174990-27175012 AAGGGTGTGAGAGGTGGGGTGGG - Intronic
1066323853 10:34333865-34333887 AAGGTTTTGAATGATATGTTAGG + Intronic
1067311669 10:45119662-45119684 AAGGTCATGCCAGGTGTGTTAGG - Intergenic
1068006176 10:51394109-51394131 AAGTTTTGGAGTGGTTTGTTAGG - Intronic
1068766080 10:60765253-60765275 TAGGTTTTGATAGTGGTGTTTGG + Intergenic
1069751133 10:70745662-70745684 AAGTTTTGGAGTGGTGTGTTAGG - Intronic
1071071917 10:81704444-81704466 AAGAGTTCGAGAGGTGGGTTGGG + Intergenic
1072798156 10:98372459-98372481 GAGGGCTGGAGAGGTGTGTTAGG - Intergenic
1073546197 10:104351331-104351353 AAGTTTATGAGAACTGTGTTGGG - Intergenic
1074591045 10:114813455-114813477 CAGCTTTTGAGACGTGTGATTGG - Intergenic
1075490103 10:122859457-122859479 AAGGATTTGAGAGGCTTGTAAGG - Intronic
1076250907 10:128983118-128983140 AAGGCTTAGAGAGGTGGGGTGGG + Intergenic
1076264269 10:129097500-129097522 AAAGTTTTGAGATCCGTGTTGGG - Intergenic
1077073438 11:688603-688625 AAGTCTTTGAGAGGTATCTTTGG - Intronic
1077605821 11:3611276-3611298 AAGGTTTGGGGAGGTGATTTGGG - Intergenic
1079243192 11:18735251-18735273 AAGGTTTTGGCAGGTGATTTGGG + Intronic
1079582781 11:22087161-22087183 AAGGTTTTGAAAGATTTTTTTGG - Intergenic
1081486061 11:43530186-43530208 AATGTTTTGAGAAATGTGTTGGG - Intergenic
1083413118 11:62507083-62507105 AAGGTTTGGAGAGGAGTGGGGGG - Intronic
1084006061 11:66324234-66324256 AAGATTTTGAGATGCATGTTTGG + Intergenic
1085733658 11:79020559-79020581 AAGGCTTTCAGAGGTGGGATGGG - Intronic
1087758145 11:102076173-102076195 AAGGTTATGAGAGGGGGGTAAGG - Intronic
1089195573 11:116692422-116692444 ATGGTCTTGAAAGGTGTGCTGGG - Intergenic
1090347349 11:126082339-126082361 AACGTTTTCAGAGCTGTGTGAGG - Intergenic
1091521885 12:1253761-1253783 AAAGTTCTGAGAGATGTATTGGG + Intronic
1093235238 12:16602306-16602328 AAGGTTGTGAAAGTTGTGATGGG - Intronic
1093657823 12:21717330-21717352 TATGTTTTGAGAGGTGACTTTGG + Intronic
1097295116 12:57954559-57954581 AAGGCTTTGAGATCTGTATTAGG + Intronic
1098515453 12:71371249-71371271 ATGGTTTTGATGGGTGTGTGTGG - Intronic
1099334987 12:81344127-81344149 AAGGTTTTCTGAGGTATCTTAGG - Intronic
1100085974 12:90911431-90911453 AAAGTTTAAAGAGGTTTGTTTGG + Intronic
1100086618 12:90918455-90918477 AAGATTTTGTTAGGAGTGTTTGG + Intronic
1100093854 12:91007322-91007344 AAGGTTTTGTAAAGTGTTTTGGG - Intergenic
1105492160 13:20899368-20899390 AAGGTTTTGAAAGGGGAGTCTGG + Intronic
1108502796 13:51083856-51083878 AAGGTCTTGAGTGGAGTGTCTGG - Intergenic
1110232280 13:73179428-73179450 AAGGTTTTTACAAGTGTGTTAGG - Intergenic
1113175312 13:107557155-107557177 AATGTTTTGTTAGGTTTGTTAGG + Intronic
1113477700 13:110596621-110596643 AAGCTCTAGAGACGTGTGTTTGG - Intergenic
1114909420 14:27171628-27171650 AAGCATTTGAGAGGTGACTTGGG - Intergenic
1115888831 14:38004394-38004416 AAGGGTTTGTGAAGTGTGATGGG + Intronic
1116507299 14:45699805-45699827 AAGAGTTTGAGAGGTGTTTGGGG + Intergenic
1117511256 14:56453785-56453807 GAGAATTTGAGAGGTGTGTCAGG + Intergenic
1117871414 14:60204993-60205015 AAGGCTGTGAGAGGTATGTGTGG + Intergenic
1118574996 14:67233399-67233421 CAGGTTTTTAAAAGTGTGTTGGG - Intergenic
1118990237 14:70791194-70791216 AAGGCTTTGAAAGGCGTGTGGGG - Intronic
1120010159 14:79404727-79404749 AAGGCTGTGAGACGTGTGCTTGG + Intronic
1120325145 14:83014430-83014452 AATGTTTTTGGAAGTGTGTTCGG - Intergenic
1121724972 14:96140571-96140593 CAGGTTGTGAGTGGTGGGTTGGG - Intergenic
1126616923 15:50592401-50592423 AAGGTTTTGAGCCAAGTGTTTGG + Exonic
1126840398 15:52712046-52712068 AAGTTTTGGAGTGGTTTGTTAGG - Intergenic
1126851967 15:52802773-52802795 GGGGTTTTGAGGGGTGTGTTGGG - Intergenic
1127295932 15:57608446-57608468 AAGGGTTTGTGGGGTGTATTTGG + Intronic
1128333823 15:66773558-66773580 AAGGCTTTAAAAGGGGTGTTAGG + Intronic
1129171364 15:73810171-73810193 AAGGCTGGGAGAGGTGTGATAGG - Intergenic
1129688558 15:77700213-77700235 AAGGTAGGGAGAGGTGTGTTGGG - Intronic
1130612096 15:85370698-85370720 AAGGCTTTGAGTGGGGAGTTAGG + Intergenic
1133841777 16:9416619-9416641 AAGATTTAGGGAGGTCTGTTGGG + Intergenic
1136886293 16:33932237-33932259 AAGGTGGGGAGAGGTGTGCTGGG - Intergenic
1138829861 16:60362066-60362088 CACATTTTGAGTGGTGTGTTGGG + Intergenic
1139007415 16:62590100-62590122 GAGGTTTTGAGAGCTGAGTGGGG + Intergenic
1139063890 16:63289851-63289873 AAGGTAATGAGAGGAGAGTTAGG + Intergenic
1141733386 16:85836831-85836853 GAGAGTTTGAGAGGTGTGTCTGG + Intergenic
1203086145 16_KI270728v1_random:1185596-1185618 AAGGTGGGGAGAGGTGTGCTGGG + Intergenic
1143740962 17:8953740-8953762 AAGGTCTTGGAAGGTGGGTTGGG - Intronic
1145378635 17:22374959-22374981 CAGGTTTTGCGATGTGTGGTCGG - Intergenic
1145719173 17:27052388-27052410 ATGGTTTTGAGAGGTCTTCTTGG - Intergenic
1146706419 17:35003803-35003825 AAGGTTTCTACAGGTCTGTTGGG - Intronic
1147206479 17:38841139-38841161 AAGATTTAGGGAGGTGTGTGGGG + Intronic
1147549433 17:41429058-41429080 AAGCTTTGGAGAGGTGTGTCAGG - Intergenic
1149314489 17:55425984-55426006 GATGTTTTGAGAGGTGGGTTGGG + Intergenic
1149426331 17:56558028-56558050 CAGCTTCTTAGAGGTGTGTTGGG - Intergenic
1149436109 17:56634789-56634811 AAAGTTTTGGAAGGAGTGTTGGG - Intergenic
1150287363 17:63961808-63961830 GGGGTTTAGAGAGGTGTGTCCGG - Intronic
1152089920 17:78240627-78240649 GAGGTCTTGAGAGGTGTGCTGGG + Exonic
1152380538 17:79940333-79940355 GACGTTTTGGGAAGTGTGTTTGG + Exonic
1152483475 17:80572738-80572760 AAGATTTTGAGATTTGTTTTTGG - Intronic
1153376192 18:4382244-4382266 AAAGTTTAGTGAGGTGTGCTGGG - Intronic
1156299766 18:35826143-35826165 GAGGTTCTGAGAGATTTGTTTGG - Intergenic
1157747312 18:50147185-50147207 AAGGCTCTGAAAGGCGTGTTGGG - Intronic
1159748373 18:72268862-72268884 AAATTATTTAGAGGTGTGTTTGG + Intergenic
1161569954 19:5025108-5025130 GAGATTTTGAGAGCTGGGTTGGG + Intronic
1166552706 19:43677051-43677073 GAGGATTAGAGAGGTGTGGTGGG + Intergenic
1167707079 19:51087476-51087498 AAGGTTTTTTGTGGTGTGGTAGG + Intergenic
1168090947 19:54083578-54083600 AAGATTTTGGGAGGTGAGGTAGG + Intergenic
1202708648 1_KI270714v1_random:4267-4289 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
927078943 2:19608976-19608998 ATTGTTATGAGAGGTGTATTGGG - Intergenic
928420692 2:31136245-31136267 AAAGTTTAGGGAGGTGTGTAGGG - Intronic
929625636 2:43403826-43403848 GAGGTTTTAGGGGGTGTGTTGGG - Intronic
930929007 2:56858357-56858379 ATGGTTTTGAGAGATGTTTTCGG + Intergenic
931144038 2:59497026-59497048 ATGGTTTTGATAGGTCTTTTTGG + Intergenic
931451431 2:62370385-62370407 AAGGTTGTCACAAGTGTGTTGGG + Intergenic
931562349 2:63576056-63576078 AATGTGTTGAGTGGTGTGTGAGG - Intronic
932148813 2:69349382-69349404 AATGTTTTTACAGGTGTGTAAGG - Intronic
932414568 2:71565800-71565822 CAGGTTTTGAGGGTTGAGTTAGG + Intronic
933130492 2:78666916-78666938 AAGGTTTTGATAGGTCTTCTTGG - Intergenic
933282631 2:80348812-80348834 AAGGTATTGAGATGTTTGTTAGG + Intronic
933744807 2:85562688-85562710 AAGGTTCTCAGAGGTGAGTCTGG + Intronic
937595968 2:123673856-123673878 AGCCTTTTGAGATGTGTGTTAGG - Intergenic
938121947 2:128640226-128640248 AAGGCTGTGAGTGGTGAGTTTGG + Intergenic
938508736 2:131916631-131916653 AAGCTTTTGGGGGTTGTGTTCGG + Intergenic
938696494 2:133840094-133840116 AATAATTTGAGAGGTCTGTTGGG + Intergenic
938844259 2:135192485-135192507 AAGATTTTGATAGGTGTGTTAGG - Intronic
938902281 2:135808433-135808455 GAGGCTTTGAAAGGTGTGTGAGG - Exonic
939218094 2:139266101-139266123 AAGGTCTGGAGAGGTATTTTTGG + Intergenic
940031965 2:149272933-149272955 CAGGGCTTGAGAGGTGTTTTGGG + Intergenic
940423474 2:153505659-153505681 ATGGTTTTGAGGGTTTTGTTAGG + Intergenic
942372439 2:175299831-175299853 AAGGTTTTGGGGGGTTGGTTTGG - Intergenic
943072079 2:183153304-183153326 AAGACTTTCAGGGGTGTGTTGGG - Intronic
943415907 2:187603667-187603689 GAGGTTTTCCGAGGTATGTTTGG - Intergenic
943418819 2:187640359-187640381 AATGTTTAGAGAGGAGTTTTAGG - Intergenic
1169858071 20:10124695-10124717 AAGTATTTGAGAGGTGACTTGGG - Intergenic
1170482742 20:16783593-16783615 ATGGTTTTGAGAGGTCTTTTTGG + Intergenic
1173182897 20:40818029-40818051 AAGGTTTTGTGAAGTGGTTTTGG + Intergenic
1173479056 20:43384736-43384758 TAGGTTATGAGAAATGTGTTAGG + Intergenic
1174282069 20:49446779-49446801 AGGCTCTTGAGAGGGGTGTTGGG - Intronic
1174895867 20:54449525-54449547 AAGTTTTGGAGAAGTGTGTTTGG + Intergenic
1174910468 20:54602565-54602587 AAGTTTTAGAGATGTGTGTCAGG - Intronic
1175636631 20:60589801-60589823 AAGGGTTTGAGAGCTGTCCTTGG - Intergenic
1176784755 21:13241908-13241930 AAGCTTTTGGGGGTTGTGTTCGG - Intergenic
1177982795 21:27935745-27935767 AAGCTTTTGGGGGTTGTGTTCGG - Intergenic
1179984790 21:44914244-44914266 AAGGTTCTGAGAGGCCTGTGGGG - Intronic
1182384918 22:29929917-29929939 AAGTGTTTGAGAGGTGTGAGGGG + Intronic
1183927497 22:41216588-41216610 CAGGTTTGGAGAGGGGTGGTGGG + Intronic
1184279552 22:43429209-43429231 AAGGTTTTGGAAGGTGAGTGTGG + Intronic
1184325654 22:43781958-43781980 AAGGTTTTAAGTGGTATGTCAGG - Intronic
1184507174 22:44911153-44911175 AAGCATTTGAGAGGTGACTTGGG + Intronic
949256688 3:2056088-2056110 AATCTTTGGAGAGATGTGTTGGG + Intergenic
949444585 3:4120317-4120339 CAGATTTTGAAAGGTGTTTTAGG - Intronic
950560914 3:13723638-13723660 ATGTTTTTGAGAGGGGTCTTAGG + Intergenic
951745537 3:25973708-25973730 AAGGTTTTGGGGGGTGTTTTTGG + Intergenic
951778266 3:26334470-26334492 AAACTTTTCAGAGGAGTGTTTGG - Intergenic
952668467 3:35936923-35936945 AAAGTTTTGAGAGTGGTGTAGGG - Intergenic
953038317 3:39232790-39232812 AAGGAATGGTGAGGTGTGTTTGG + Intergenic
954021162 3:47743144-47743166 AAAGTTCTGAGAGGCATGTTAGG + Intronic
954223651 3:49169346-49169368 AAGATTTTGAGAGGTGGGCTGGG + Intergenic
954352547 3:50056987-50057009 AAGGCTTCTAGATGTGTGTTTGG + Intronic
955408818 3:58642787-58642809 AAGGCTTTGAGCAGTGTGTGAGG - Intronic
955840108 3:63103588-63103610 AAGGCTTTGAGATATGTGCTAGG + Intergenic
956445727 3:69323940-69323962 AAGCTTTTCAGAGCAGTGTTAGG - Intronic
956450712 3:69372007-69372029 AAGGTCATGAGAGGTGGGTTTGG - Intronic
958621506 3:96569048-96569070 AAGTTTGGGAGAGGTGGGTTTGG - Intergenic
959128516 3:102321104-102321126 ATGGTTTTGAGAGATCTTTTTGG + Intronic
959133812 3:102391779-102391801 AAGGTTTGGAGTGCTTTGTTAGG + Intronic
959381114 3:105642129-105642151 AAGCATTTGAGAGGTGACTTGGG - Intergenic
959568800 3:107860002-107860024 AAGGTTGGGAGGGGAGTGTTAGG - Intergenic
959893388 3:111581402-111581424 AAGGTTTTCATGGGTGTTTTGGG - Intronic
959893737 3:111584066-111584088 AAGCATTCGAGAGGTGTATTGGG - Intronic
960293506 3:115914979-115915001 AAGGTGGGGAGGGGTGTGTTAGG + Intronic
961070074 3:123915801-123915823 AAGGATTTGAGAGAAGTGTCTGG + Intronic
964413790 3:156426861-156426883 AAGGTTTTGATAACTGTTTTTGG - Intronic
964660434 3:159114616-159114638 AAGGTTTTAAGTGGTCTCTTTGG + Intronic
964919402 3:161877763-161877785 AGGGTTTTGAGAGGTCTCCTTGG - Intergenic
965201737 3:165667315-165667337 AAGTTTTTGAGTGGAGTGTCAGG - Intergenic
966481556 3:180414384-180414406 AAGGTTTTAAGAGGTGAGAGTGG + Intergenic
968384638 4:125122-125144 AGGCTTTTGTGAGGTGTGTGAGG + Exonic
968393650 4:213275-213297 AGGCTTTTGTGAGGTGTGTGAGG + Intergenic
968401809 4:304825-304847 AAGCTTTTGTGAGGTGTGTGAGG - Intronic
968405862 4:338455-338477 AAGCTTTTGTGAGGTGTGTGAGG + Intronic
968410626 4:386775-386797 AGGCTTTTGTGAGGTGTGTGAGG + Intergenic
971471939 4:27036176-27036198 AAGCTTTTTGGATGTGTGTTTGG + Intergenic
972414251 4:38823410-38823432 TAAGTTCTGAGATGTGTGTTAGG - Intronic
973975874 4:56261761-56261783 ATGGTTTTGAGAGGTGGGGGAGG + Intronic
974759784 4:66260143-66260165 AAGGTCATGAGAGGAGTGTGGGG - Intergenic
976350611 4:84056148-84056170 ATGGATTTTAGAGGTGTCTTGGG - Intergenic
976725795 4:88214468-88214490 AAGTTTTAGAGTGGTTTGTTAGG + Intronic
977366046 4:96068921-96068943 AATCTTTTGAGAGGTGATTTGGG - Intergenic
978133371 4:105226858-105226880 AACCTTTTGAAAGGTATGTTAGG - Intronic
978442310 4:108746335-108746357 CAGGGTTTGAGGGGTGGGTTTGG + Intronic
979107748 4:116708867-116708889 AAGGTCTTGTGAGATGTGTAAGG + Intergenic
979587147 4:122433715-122433737 TAGCCTTTGAGAGGTGTGTATGG + Intergenic
979703286 4:123691364-123691386 AAGGTCTTGAGATCTGTTTTTGG + Intergenic
979970862 4:127133226-127133248 AAGGTGTCGAGATGTGTGGTAGG - Intergenic
980529128 4:134027968-134027990 AAGTTTTTGAGAGATTTGTTAGG + Intergenic
981028436 4:140099757-140099779 AAGGTTTTGAGAGGTGTGTTGGG - Intronic
981162954 4:141521147-141521169 GAAGTGTTGAGAGGTGTATTAGG - Intergenic
982219312 4:153111261-153111283 AAGTATTTGAGAAGTGCGTTAGG + Intergenic
982463733 4:155704456-155704478 ATGTTGTTGAGATGTGTGTTGGG - Intronic
982854436 4:160362978-160363000 AAGTGTTTGAGAGGTGATTTGGG - Intergenic
984081176 4:175252126-175252148 AATGTTATGAGAGGTGGGTAGGG + Intergenic
987642077 5:20625691-20625713 AAGGTTTAGTGAGGTGTTTTGGG + Intergenic
990009122 5:50974783-50974805 AAGGTTTTGTGATGTGTGTGTGG + Intergenic
990607003 5:57420901-57420923 ATGGTGTTGAGAGGTGAGGTGGG + Intergenic
993338074 5:86686593-86686615 ATGTTTCTTAGAGGTGTGTTAGG - Intergenic
994120955 5:96112199-96112221 AATATTCTGAGAGGTGTGTCTGG + Intergenic
994257072 5:97610107-97610129 TAGGTTTTGAGAGGTATTTTTGG + Intergenic
995042761 5:107607887-107607909 AAGGTTATGAGAGAAGTGTTAGG - Intronic
996017919 5:118561597-118561619 ATGGCATTGAGAGGTGTGTGAGG - Intergenic
999359483 5:150970947-150970969 AGGCTTTTGAGGGGTGAGTTGGG + Intergenic
999870236 5:155742151-155742173 AGGGTTTTAAGAAGGGTGTTAGG + Intergenic
999873879 5:155781303-155781325 AAGGGTTTGTGAGGTGTGATGGG - Intergenic
999873888 5:155781347-155781369 GAGGGTTTGCGAGGTGTGATAGG - Intergenic
1000147943 5:158471523-158471545 AAGGGTTTGCGAGGTGAATTGGG - Intergenic
1000778025 5:165443276-165443298 AAGGATTTAAGAGGTGACTTGGG - Intergenic
1001247677 5:170117366-170117388 CAGGTTAGGACAGGTGTGTTGGG - Intergenic
1001378222 5:171283017-171283039 AAGGTTTGGAGAGGAGTCTGGGG - Intronic
1003636618 6:7837724-7837746 AAGTTTTTTAGTGGTGGGTTCGG - Intronic
1005559054 6:27019550-27019572 AGTGTTTTGAGAGGAGAGTTTGG - Intergenic
1005796241 6:29364971-29364993 AAGGTTTTGTCAGGTTTGTCAGG - Intronic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1006205459 6:32337698-32337720 GAGGTGTAGAGAGGTGTGGTGGG - Intronic
1006517415 6:34552678-34552700 CAGGCTTGGAGAGGGGTGTTAGG + Intronic
1008021083 6:46578115-46578137 ATGGTTTTGAGAGATGTTCTTGG - Intronic
1008738757 6:54579309-54579331 AAGGTTTTGAGAGTTCCTTTAGG - Intergenic
1008902603 6:56638740-56638762 CTGGTTTTGTGAGGTGTATTGGG - Intronic
1009707431 6:67270725-67270747 AGAGTTTTGACAGGTGTGATTGG - Intergenic
1011027028 6:82880568-82880590 AAGGTTTTAAGAAGTGGGATGGG + Intergenic
1011170124 6:84496358-84496380 AAGGTTTTGAGAGGTCTCGGTGG + Intergenic
1017316016 6:153032250-153032272 ATGGTTTTGAGTGGGGTGTGTGG + Intronic
1018496810 6:164356187-164356209 ATGGTTTTGAGAGATCTTTTTGG + Intergenic
1018860109 6:167705039-167705061 AAGGTCTTGAGAGGGGTGTTTGG + Intergenic
1020109559 7:5440343-5440365 AGGGTTTTGAGAGGTGAATGGGG - Intronic
1020506499 7:8995694-8995716 CAGGTTTGGAGAGGTGCTTTTGG - Intergenic
1022439582 7:30422448-30422470 AAGGTTGAGAGAGTAGTGTTGGG + Intergenic
1022926927 7:35065801-35065823 ATGGTTCTCAGAGATGTGTTGGG - Intergenic
1027917950 7:84350259-84350281 AAGTTATTGGGAAGTGTGTTGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028250723 7:88537079-88537101 ATGGTTTTGAGAGTTGCTTTTGG + Intergenic
1029210471 7:98904135-98904157 AAGAATTTTGGAGGTGTGTTGGG + Intronic
1031148042 7:118019098-118019120 GAGGTTTTGATAGGTTTGATAGG - Intergenic
1033974826 7:147088141-147088163 AAGGTTTTGAAATGTGAATTAGG - Intronic
1034873809 7:154706892-154706914 AAGGTCTTTAGAGTGGTGTTGGG + Intronic
1035760003 8:2062108-2062130 AAGGCTCTGAGAGGTGCATTGGG + Intronic
1037550136 8:19962726-19962748 AGGGTTTTGAGATGGGTGCTTGG - Intronic
1037620365 8:20558283-20558305 CAGGTTTTGAGAGATGGGTAGGG - Intergenic
1042266779 8:66916588-66916610 GAGGTTTTGATAGGTGAGTGTGG + Intronic
1043752300 8:83953100-83953122 AACATTTTGACAGGTTTGTTAGG + Intergenic
1043814755 8:84788522-84788544 AAGGTTTTGGGAGGTGGGGCTGG + Intronic
1044091486 8:88007859-88007881 TAAGTTTTGAGAAGTGTGGTGGG + Intergenic
1045159034 8:99515559-99515581 AAGGTTTTTATAGTTGTCTTTGG + Intronic
1047346089 8:124030418-124030440 AAACTTTTGAGTGGTGAGTTGGG - Intronic
1050027937 9:1355086-1355108 AAGGTTTTCAGAGATGAGCTGGG - Intergenic
1050316770 9:4409958-4409980 TAGGTTTTGGGAGGTCTGTATGG + Intergenic
1050360915 9:4830272-4830294 AAGGTTTTAAGAGCTGAGGTTGG + Intronic
1050642588 9:7684178-7684200 AAGGTGTGGAGAGGTATGTTTGG - Intergenic
1051897481 9:22003731-22003753 TGGGTTTTTATAGGTGTGTTGGG + Exonic
1052071758 9:24090308-24090330 ATGGATATGAGAGGTGTGATAGG - Intergenic
1052719865 9:32161430-32161452 AAAGTCTTCAGAGGTGTGTGTGG - Intergenic
1052808057 9:33031051-33031073 AAGGATTTGAAAGGGGAGTTAGG + Intronic
1055337699 9:75249304-75249326 ATGGTTTTAAGAGGTCTTTTTGG + Intergenic
1056569091 9:87800355-87800377 AAGGATTTGAGAGGGGAGTGTGG - Intergenic
1056889202 9:90474194-90474216 AAAGTTTGCAGAGTTGTGTTGGG + Intergenic
1057353198 9:94317107-94317129 GAGATTCTGAGAGGTGGGTTAGG + Intergenic
1057654552 9:96940484-96940506 GAGATTCTGAGAGGTGGGTTAGG - Intronic
1057988701 9:99744692-99744714 AGGGTTTTGAGATGGGTGTGAGG - Intergenic
1059763207 9:117358915-117358937 AAGCTAGTGAGAGGTGAGTTTGG - Intronic
1062078623 9:134606501-134606523 AAAGTTTTGAGGTGTGTGCTAGG - Intergenic
1062589502 9:137267058-137267080 AAGCTTTCGGGAAGTGTGTTTGG - Exonic
1188080695 X:25836502-25836524 AAGCTTTGGAGAGATGAGTTAGG + Intergenic
1191779306 X:64848977-64848999 AGGGTTTTGTGAGGTTAGTTAGG - Intergenic
1192221293 X:69198990-69199012 CAGGATTTGAGAGCTGGGTTGGG - Intergenic
1193611555 X:83637578-83637600 TATGTTTTGAGAAATGTGTTAGG + Intergenic
1194294101 X:92107372-92107394 AACATTTTGAGAGCTGTCTTAGG + Intronic
1194468706 X:94265595-94265617 ATGGTTTTGAGAGATGTTCTTGG - Intergenic
1195310926 X:103631091-103631113 AAGGTTGTGTGAGCTATGTTCGG + Intergenic
1196522679 X:116692989-116693011 GAGGGTTTGAGAGGTGCGTCAGG - Intergenic
1198093143 X:133351650-133351672 AAGGTTCTGAAAGGTGAGATTGG - Intronic
1198697555 X:139358857-139358879 AAGGTTTTTTGGGGTGTGTGCGG - Intergenic
1199354411 X:146844645-146844667 ATGGTTTTGAGAGATGTTCTTGG + Intergenic
1201506501 Y:14707045-14707067 AACATTTTGAGAGGTATCTTAGG + Intronic