ID: 981028723

View in Genome Browser
Species Human (GRCh38)
Location 4:140102418-140102440
Sequence CAGGAGAAACCAGCCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981028723_981028725 -7 Left 981028723 4:140102418-140102440 CCAAGCAAGGCTGGTTTCTCCTG 0: 1
1: 0
2: 4
3: 19
4: 240
Right 981028725 4:140102434-140102456 TCTCCTGAGGCCTCTATCCTTGG No data
981028723_981028728 4 Left 981028723 4:140102418-140102440 CCAAGCAAGGCTGGTTTCTCCTG 0: 1
1: 0
2: 4
3: 19
4: 240
Right 981028728 4:140102445-140102467 CTCTATCCTTGGCTTGCAGATGG 0: 4
1: 253
2: 697
3: 1332
4: 1976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981028723 Original CRISPR CAGGAGAAACCAGCCTTGCT TGG (reversed) Intronic
900308537 1:2022547-2022569 CAGGAGACACCGTCCTTCCTGGG - Intronic
901269401 1:7940098-7940120 AAGGAGAAACCACCTTTCCTTGG - Intronic
901613345 1:10517190-10517212 GAAGAGAAAGCAGCTTTGCTGGG - Intronic
902275525 1:15336924-15336946 CAGGAGAAAACACCCTCGTTAGG - Intronic
903172845 1:21564297-21564319 CCGGAGAAAGCAGCCTGGCCTGG + Intronic
904266644 1:29322147-29322169 CAGCAGGAACCATCCTTGCTAGG + Intronic
905326281 1:37154362-37154384 CAAGAAAAACCAGCCATGCCTGG + Intergenic
906205452 1:43984129-43984151 CAGGGGACCCCAGGCTTGCTGGG + Intronic
907413509 1:54298527-54298549 CAGGAGAAAGCTGCCCTTCTAGG + Intronic
909629221 1:77753290-77753312 AAAGAGTAACCAGTCTTGCTGGG + Intronic
910362053 1:86422797-86422819 CAGAAGACTCCAACCTTGCTGGG + Intergenic
912458441 1:109815516-109815538 CAGGAAACTCCAGCCTTGCTTGG + Intergenic
912850132 1:113116769-113116791 GAAGAGAAACCAGCCTCCCTTGG - Intronic
913372741 1:118118596-118118618 CAGGAGACACAGGCCTTGCCTGG - Intronic
918696807 1:187555086-187555108 TAGGAGAGACCAGCTTGGCTTGG + Intergenic
919011252 1:191967739-191967761 AAGGAGAAATAAGCATTGCTAGG + Intergenic
920928838 1:210367954-210367976 GGGGTGAACCCAGCCTTGCTGGG + Intronic
921163910 1:212492258-212492280 AAGAAGAAACCAGTCCTGCTGGG + Intergenic
923065675 1:230515118-230515140 CAAGAGAGGCCACCCTTGCTGGG + Intergenic
923404786 1:233649050-233649072 CAAGAGAAGCCAGATTTGCTAGG + Intronic
923465042 1:234240844-234240866 CAGGAGGAAGGAGCCTTTCTTGG + Intronic
924587848 1:245375589-245375611 CAGAAGAAGCCAGCCCTGCAGGG + Intronic
1065504276 10:26413628-26413650 CAGGAGAAACACGTCATGCTGGG - Intergenic
1066012772 10:31209671-31209693 CAGGGGAAGCCAGCCAGGCTGGG - Intergenic
1067835225 10:49634220-49634242 CAGGAGACAGCAGCCGTGGTAGG - Intronic
1069757162 10:70780351-70780373 GAGGAGACAGCAGCCCTGCTAGG - Intronic
1073201613 10:101740278-101740300 CAGGAGAAACCACACATCCTGGG + Intergenic
1073522393 10:104145462-104145484 AAGGAGAAACAAACCTTGGTCGG + Exonic
1075656097 10:124162269-124162291 TAGGAGCCAACAGCCTTGCTAGG + Intergenic
1076236566 10:128868163-128868185 GAGGAGAAACCAGCCTTGCCAGG + Intergenic
1076881094 10:133239584-133239606 CAGGTGAAGACAGCCATGCTGGG - Intronic
1077021412 11:418753-418775 CAGGAGGAACCAGAACTGCTCGG + Exonic
1077474082 11:2778241-2778263 GATGAGAAACCAGCCTGGCCTGG - Intronic
1077542729 11:3155097-3155119 CAGGAGAAACCAGCCCTGAAAGG + Intronic
1077753667 11:5002583-5002605 CTGGAGAAATGAGCCTTGCCTGG + Intergenic
1078574277 11:12485368-12485390 CAGGAGAAACCAGGACTTCTTGG + Intronic
1081037587 11:38168296-38168318 CAGAAGAAGCCAGCCTTTTTAGG - Intergenic
1082072385 11:47949574-47949596 CAGGAAATACCAGTTTTGCTGGG + Intergenic
1083169719 11:60915848-60915870 CTGGAGAGCCCAGCCTGGCTGGG - Intronic
1083514219 11:63241731-63241753 CAGAAGAAAATAGCCTTTCTAGG - Intronic
1084544085 11:69805274-69805296 CAGGGGAAGACAGCCTTGCCTGG - Intergenic
1087372771 11:97305653-97305675 CAGGGGAAACAAGACATGCTGGG - Intergenic
1087903030 11:103663916-103663938 CTGGACATACAAGCCTTGCTGGG + Intergenic
1089347743 11:117801854-117801876 CAGGGGACTCCTGCCTTGCTGGG - Intronic
1089388572 11:118084540-118084562 CAGTGATAACCAGCCTTGCTGGG - Intronic
1089772089 11:120810318-120810340 CAGGAGAAACTTTCCTTTCTTGG + Intronic
1090387424 11:126365060-126365082 CAGGAGGAAACAGCCATGCAGGG + Intronic
1090389990 11:126382258-126382280 CAGGAGGAAACAGCCATGCAGGG + Intronic
1091582881 12:1799553-1799575 CAGGAGAGCTCAGCCCTGCTTGG + Intronic
1091662589 12:2395653-2395675 CAGGAGAAACCAGATTTTCCAGG + Intronic
1092002774 12:5045186-5045208 CGGGAGAACCCTGCCTTGCTGGG - Exonic
1092109455 12:5948627-5948649 CTGGAGAATCCAGTGTTGCTGGG + Intergenic
1092399946 12:8166486-8166508 AAGGGGAAACCAGTTTTGCTTGG + Intronic
1092792598 12:12082928-12082950 CAGGAGAAACCAAATTTGCAAGG - Intronic
1093167521 12:15822099-15822121 CATGAAACATCAGCCTTGCTGGG - Intronic
1093373928 12:18400409-18400431 CAGGAGAAACAAGTCTTCCTTGG + Intronic
1095669363 12:44840445-44840467 AAGGAAAAAAGAGCCTTGCTTGG - Intronic
1100964569 12:99998759-99998781 CAGAAGAAACTAACCCTGCTAGG - Intergenic
1103538961 12:121652909-121652931 CAGGAGCCACCTCCCTTGCTAGG + Intronic
1104071517 12:125350009-125350031 GAGGAGATCCCAGCCCTGCTCGG + Exonic
1104733564 12:131122311-131122333 AAAGAAAAACCAGCCCTGCTCGG - Intronic
1104972419 12:132538003-132538025 CAGGAGGAGCCAGACTGGCTGGG + Intronic
1105887134 13:24651847-24651869 GTGGAGAATCCAGCCTTGCCCGG - Intergenic
1106243538 13:27928266-27928288 CAGGAGAAACCGACCTTCCAGGG + Intergenic
1107443401 13:40448406-40448428 AAGAAGGAACCAGCCTTGCATGG - Intergenic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1115032354 14:28812122-28812144 CAGGAGAAACATGCATTGCAAGG + Intronic
1115273677 14:31582927-31582949 CAGGAAAGAACAGACTTGCTTGG + Intronic
1115668570 14:35582603-35582625 CAGGAGAAACCAGTCTTATGGGG + Intronic
1116497784 14:45583193-45583215 GTGGGGAAACCAGGCTTGCTTGG + Intergenic
1121064242 14:90946398-90946420 GAGGAGAAACCAGACCTGCCAGG - Intronic
1121904199 14:97724570-97724592 CATGAGGAAACAGCATTGCTTGG + Intergenic
1121965572 14:98301101-98301123 GAGGAGAAACCGGCTTTTCTCGG - Intergenic
1122683188 14:103482821-103482843 CTGGAGACACCTGCCTTGTTGGG + Intronic
1123109514 14:105859261-105859283 CAGCCCAAACCAGCCTGGCTCGG + Intergenic
1125773774 15:42192139-42192161 CATGTGAATTCAGCCTTGCTGGG + Intronic
1125889368 15:43254140-43254162 CAGGAGGAGCCAGCCTGCCTTGG - Intronic
1127294137 15:57594998-57595020 CAGGGGAAACCAGCCTATGTGGG + Intronic
1128287999 15:66454544-66454566 CAACAGAAACCAGCCTGACTTGG + Intronic
1129476410 15:75786894-75786916 CAGGAGCACCCAGGCTTGCCCGG + Intergenic
1131406197 15:92166867-92166889 GAGAAGAAACCAGACTTCCTAGG - Intronic
1133988791 16:10688955-10688977 CAAGAGAAACCAGCGATGCACGG + Intronic
1134816218 16:17207904-17207926 CAGGAGAAATGACCCTTCCTTGG + Intronic
1135285686 16:21190898-21190920 AAGGAGAAACCAAGCCTGCTTGG - Intergenic
1136866875 16:33766414-33766436 CAGGACATCCCAGCCATGCTTGG - Intergenic
1137687314 16:50395222-50395244 CAGCAGAAATGAGCCTTCCTTGG + Intergenic
1138635777 16:58337246-58337268 CAGGAGGTGCCACCCTTGCTGGG + Intronic
1139830900 16:69797434-69797456 CAGGAGAAAACAGGCTTGAGAGG - Intronic
1141266900 16:82505864-82505886 CAGGAGAAACCAGAGGTGATGGG + Intergenic
1142310828 16:89312548-89312570 CAGAGGAAGCCAGACTTGCTGGG - Intronic
1203105287 16_KI270728v1_random:1349788-1349810 CAGGACATCCCAGCCATGCTTGG + Intergenic
1203128227 16_KI270728v1_random:1612580-1612602 CAGGACATCCCAGCCATGCTTGG - Intergenic
1143014413 17:3884010-3884032 CAGGAGAGACCAGAGCTGCTCGG - Intronic
1144355376 17:14440806-14440828 CAGGAGAAAACTGCCCTGCCTGG - Intergenic
1144408167 17:14973138-14973160 CAGCAGACACCAGCCTCCCTGGG - Intergenic
1146952686 17:36917745-36917767 CAAGAAAAACCAGCCTCACTTGG + Intergenic
1147367602 17:39969557-39969579 CAAGAGAAGCCAGCGTTGCACGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149685696 17:58533294-58533316 GAGGAGAAACCTTCCTAGCTGGG + Intronic
1152134225 17:78494543-78494565 CCGGAGAAGCCTGCCTGGCTGGG - Intronic
1152168690 17:78728114-78728136 CTGCAGGAACCAGCCTGGCTTGG - Intronic
1152341437 17:79728096-79728118 CAGGACATCCCAGCCATGCTTGG - Intergenic
1152892558 17:82890786-82890808 GAAGAGACACCAGCCTTGCAAGG + Intronic
1153047779 18:872217-872239 AGGGAGAAACCTGCCTTGTTGGG + Intergenic
1153822615 18:8845107-8845129 AAGCAGAAACCAGCCTTCCCTGG - Intergenic
1156699426 18:39807523-39807545 CAGGAGAAGCAATCCTAGCTGGG + Intergenic
1157099453 18:44716118-44716140 CAGCAGACACCAGCCCTGATTGG - Intronic
1157424343 18:47572000-47572022 CAGAAGAAACCAGCCTCTCCTGG + Intergenic
1157695864 18:49723111-49723133 CAGGATAAACTTACCTTGCTGGG + Intergenic
1159333298 18:67029990-67030012 CAGGAGAATCCAGCAGTGTTGGG - Intergenic
1160575855 18:79853480-79853502 CAGGACAGACCAGCCTAGTTAGG + Intergenic
1161839389 19:6669893-6669915 CAGGAGGAACCAGCCTTGGACGG + Exonic
1162369041 19:10268137-10268159 CAGGAGGAGCCAGCCTTGTTGGG + Intergenic
1163097218 19:15068304-15068326 CTGTAGAAACCAGCATTGGTGGG + Intergenic
1163705130 19:18808014-18808036 CGGGGGAACCCAGCCATGCTGGG - Intergenic
1163865867 19:19772969-19772991 CAGGAGAAACCAGCTGTCCTGGG - Intergenic
1165106240 19:33471174-33471196 CTGATGAAACCAGCCTGGCTGGG + Intronic
1165259466 19:34599507-34599529 AAGGGGAAACCTGTCTTGCTTGG - Intronic
1165996716 19:39848824-39848846 AAGGAGAAAACAGCCCCGCTTGG - Intergenic
1167412264 19:49351693-49351715 GAAGAGAAACCAGCCTGGCGTGG + Intronic
1168497826 19:56869111-56869133 CAGAAGGAACCAGCCCTGCTGGG - Intergenic
925546202 2:5019617-5019639 GAAGAGACACCAGTCTTGCTGGG - Intergenic
925999490 2:9318964-9318986 CAGGAAAATACACCCTTGCTAGG - Intronic
926218404 2:10919561-10919583 AAGGAAAGACCAGCCCTGCTGGG + Intergenic
926340274 2:11899418-11899440 CAGGAGACCCCAGCCTTCCAGGG - Intergenic
926398317 2:12468494-12468516 CAGGAGACACCTGCCTGGCTGGG + Intergenic
926695265 2:15766423-15766445 CAGCAGATACCAGTTTTGCTGGG - Intergenic
926865442 2:17352311-17352333 CAGAAGTAACCAGCCTTGTCTGG + Intergenic
927278468 2:21282012-21282034 CGGGAGAAGCCAGCCTGGCCAGG - Intergenic
927311954 2:21641515-21641537 CAGGAGAAAGCAGTTTTGCTCGG + Intergenic
927699722 2:25260068-25260090 CTTGGGAAACCACCCTTGCTGGG + Intronic
929265339 2:39912849-39912871 CAGAAGACACCATCCTAGCTGGG + Intergenic
929573492 2:43038377-43038399 CAGAACAACCCAGCCTTCCTCGG - Intergenic
930899924 2:56493513-56493535 GAGGGGAAACAAGCCTTGCCAGG + Intergenic
930988188 2:57615154-57615176 CAGGTGAAACCAGCCCTGGGAGG + Intergenic
931286633 2:60837557-60837579 CAGCATAAACCAGGCTCGCTTGG + Intergenic
932703951 2:74009258-74009280 CAGGAGTTACCAGCCTCCCTTGG - Intronic
936980863 2:118263953-118263975 CAGGAGAAACAAGGCATGGTTGG + Intergenic
937216473 2:120316565-120316587 CAGGAGAGATCAGTCCTGCTGGG + Intergenic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
942804272 2:179911336-179911358 AAGGAGAAAGCAGTCTTACTTGG - Intergenic
945667950 2:212765321-212765343 AAGGTGAAACCAGAATTGCTTGG + Intergenic
946834654 2:223761060-223761082 CTTGAGTAACCAGCCTGGCTCGG - Intronic
946883539 2:224200477-224200499 CCGGTGAAACCAGCCCTGCATGG - Intergenic
948287705 2:236799301-236799323 CGGGAGAAACCAGGCCTGCCAGG + Intergenic
948524235 2:238560385-238560407 CAGGAGACACCAGGATGGCTGGG + Intergenic
948600153 2:239103307-239103329 CAGGATGAAGCAGCCTTCCTTGG + Intronic
948724054 2:239920916-239920938 CAGGAGAAACCTGCCCACCTGGG - Intronic
1169651995 20:7879390-7879412 CAGGGGAAAAGAACCTTGCTTGG - Intergenic
1170033834 20:11969696-11969718 CACCAGAGGCCAGCCTTGCTGGG + Intergenic
1170581028 20:17699796-17699818 CAGAAGAAATCAGCCTGTCTGGG - Intronic
1172385435 20:34530857-34530879 CAGGAGCAACCACTCTGGCTGGG - Intronic
1175266511 20:57706722-57706744 CAAGAGAAACCACCCTGGCCTGG + Intronic
1178363135 21:31966553-31966575 CAAGAGAAACAATCTTTGCTAGG - Intronic
1178970454 21:37171365-37171387 CAGGAGAAAGTAGCAATGCTGGG - Intronic
1179401907 21:41091993-41092015 AAGCAGAAATCAGCCTTGTTTGG + Intergenic
1179487125 21:41717494-41717516 CTGGAGACACCTGTCTTGCTGGG - Intergenic
1179487670 21:41721345-41721367 GTGGAGAATCCAGCCCTGCTGGG - Intergenic
1180908955 22:19435044-19435066 CAGGAGAAAGCATCCTTGGGTGG + Intronic
1180982280 22:19884491-19884513 CCGGAGAAACCAGCCCTTCATGG + Intronic
1182623687 22:31631047-31631069 CAGCAGACACCAGCTCTGCTTGG + Intronic
1182737664 22:32542675-32542697 CTGGAGAGGCCAGCTTTGCTAGG + Intronic
1183295424 22:37026582-37026604 CAGGGGAAACATGCTTTGCTTGG + Intronic
1185133481 22:49054786-49054808 CGGGCGATTCCAGCCTTGCTTGG + Intergenic
949740097 3:7222405-7222427 CTGGAGCAACCAGCATTCCTTGG - Intronic
950259887 3:11536099-11536121 CCTGAGAAAACAGCCTGGCTGGG - Intronic
955002240 3:54938189-54938211 AAGGAAGAACCAGCCCTGCTGGG + Intronic
955240173 3:57170780-57170802 CAGGAGATAACATCCTGGCTTGG + Intergenic
960516121 3:118604521-118604543 CAGGAATATCCATCCTTGCTGGG + Intergenic
961549905 3:127663517-127663539 TGGGGGAAACCAACCTTGCTGGG - Intronic
961609954 3:128128804-128128826 AAGGAGAATCCAGCAGTGCTTGG - Intronic
961614182 3:128165779-128165801 CAGCAGGAACTTGCCTTGCTTGG + Intronic
963949045 3:151178462-151178484 CAGGAGAAGCCAGAGGTGCTGGG + Intronic
967991597 3:195135546-195135568 CTGGAGAACCCAGGCTGGCTCGG + Intronic
968170567 3:196506318-196506340 CTGGAGAAACCATCCTTGGAAGG - Intergenic
969472037 4:7394634-7394656 GAGGAGGAAGCAGTCTTGCTGGG + Intronic
969780153 4:9395088-9395110 AAGGGGAAACCAGTTTTGCTTGG - Intergenic
971341994 4:25779236-25779258 CTGGCGAAACCAGCCCAGCTAGG - Intronic
971368270 4:25994754-25994776 CAGAAGAAACCAGTCCAGCTGGG + Intergenic
971382543 4:26111917-26111939 CAGCAGATACCACTCTTGCTGGG - Intergenic
974507146 4:62790303-62790325 CAGAAGAAACCTTCCTTGCTGGG + Intergenic
976763217 4:88572126-88572148 CAGAAGAAACCAACCTTGCTGGG + Intronic
978138294 4:105289656-105289678 CAGCAGCAACCAGCCATGATGGG + Intergenic
979432556 4:120648482-120648504 CAGCAGAAACCAACATTGCGGGG - Intergenic
980089328 4:128425772-128425794 CAGGAGAAACAGGCCTTCTTTGG - Intergenic
981016709 4:139981140-139981162 CAGAAGAACCCAACCTTGCCAGG - Intronic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
981279183 4:142937366-142937388 CAGGACCAACAAGTCTTGCTAGG + Intergenic
981933588 4:150215757-150215779 CAGAACAAACCGGCTTTGCTGGG - Intronic
983584393 4:169340020-169340042 CAGGAGAATCCAGACTTCTTAGG + Intergenic
983892211 4:173041660-173041682 CAGAAGACATCAGCCTTGCCAGG - Intergenic
986262697 5:6162249-6162271 CAGGAGACACAAGCAGTGCTGGG + Intergenic
987343280 5:16957097-16957119 AAGGAGAACCCATCCATGCTTGG + Intergenic
988069120 5:26264877-26264899 CAGGAGAAACCATCCAAGCCAGG - Intergenic
988493145 5:31722077-31722099 CTGGAGGGAGCAGCCTTGCTTGG - Intronic
990562961 5:57002122-57002144 CAGGAGGAGCCAGACTTCCTTGG - Intergenic
991172809 5:63648007-63648029 CAGCAGAAAACTACCTTGCTTGG - Intergenic
992000537 5:72432062-72432084 CAGGAGAATACAGCCATGCCTGG + Intergenic
995229306 5:109740508-109740530 CAGGTGAGGCCAGCCATGCTTGG + Intronic
997745762 5:136298793-136298815 CAGGAGAAACCTGCATTGAAGGG - Intronic
998138046 5:139684801-139684823 GAGGAGAAAGCAGCCATGTTGGG + Intergenic
998850461 5:146346082-146346104 CAGGGGAAACCTGACTTGATCGG - Intergenic
998956288 5:147441788-147441810 TGGGAAAAAACAGCCTTGCTTGG - Intronic
1001761201 5:174209915-174209937 CATGAGACCCCAGCCTTGCCAGG - Intronic
1006422864 6:33946256-33946278 CAGGTGAAACCAGCCTCACTGGG - Intergenic
1006653296 6:35569025-35569047 CAGGAGAAACCATCCTGGCTGGG + Intergenic
1011110302 6:83830046-83830068 CAGGAGAAACCAGTCCAGCCAGG - Intergenic
1011513718 6:88129226-88129248 CATGAGCAACAAGCCTTGCCAGG - Intergenic
1011560932 6:88614646-88614668 AGGCAGAAACCAGCCATGCTGGG + Intronic
1012079141 6:94733856-94733878 CGGTAGACACCAACCTTGCTGGG - Intergenic
1013698475 6:112732534-112732556 CAGGAGAAACATGGCTAGCTAGG + Intergenic
1015217315 6:130765268-130765290 CTGGAGAAAACAGCCTTATTTGG + Intergenic
1015835843 6:137419113-137419135 CTGGACAAACAGGCCTTGCTGGG + Intergenic
1016040514 6:139427726-139427748 CAGGAGCAACCACCCTCGCTAGG - Intergenic
1016514880 6:144882679-144882701 GAGTAAAAACCAGCCATGCTGGG + Intergenic
1017700233 6:157062487-157062509 AAGGAGAAACAAGCCATGTTCGG - Intronic
1018167885 6:161116404-161116426 CTGGAGAAAAGAGCCTTGCAAGG + Intronic
1018846214 6:167558447-167558469 CAGGAGAAACCAGCAGAGCTAGG + Intergenic
1019375237 7:687729-687751 CAGGATAAACCAGCATAGCGTGG + Intronic
1019706711 7:2500322-2500344 GCAGAGAAACCAGCCTTGTTGGG - Intergenic
1023820796 7:43979529-43979551 CTGGAGAAGCCAGCCTCGCATGG + Intergenic
1028921011 7:96310034-96310056 CAGGAGAAACCAAACTTGCTGGG + Intronic
1032184810 7:129715369-129715391 CATGAGAATCCAGGTTTGCTAGG - Intronic
1033135679 7:138782166-138782188 CAGAGGGAACCAGCCTTGCGTGG - Intronic
1033441316 7:141382023-141382045 GAGGAGAATCCAGCCCTGTTGGG - Intronic
1033452549 7:141474644-141474666 CAGGAGAGGCAAGCATTGCTAGG - Exonic
1033590260 7:142802847-142802869 CAGGAGAAAGCAGCATTGGGTGG - Intergenic
1034784947 7:153917197-153917219 CTGGGGAAACCTGCATTGCTTGG - Intronic
1035520373 8:271321-271343 CGGGAGGAAACAGCCTTGGTAGG - Intergenic
1036277575 8:7369067-7369089 AAGGGGAAACCAGTTTTGCTTGG - Intronic
1037981945 8:23260627-23260649 AAAGAGAGACCAGGCTTGCTGGG + Exonic
1038380354 8:27087011-27087033 CAGGAGCAGCCACCCCTGCTTGG - Intronic
1039983562 8:42429010-42429032 CAGGAAAATGCAGCCTTGGTGGG - Intronic
1040513021 8:48111973-48111995 AAGGTGACATCAGCCTTGCTAGG - Intergenic
1041510757 8:58652579-58652601 CAGGAGAAACCAGCACTCCAGGG - Intronic
1044581453 8:93830062-93830084 CTGGACAGACAAGCCTTGCTGGG + Intergenic
1049598036 8:143493394-143493416 GAGGAGAAGCCAGTCTTGCCAGG - Intronic
1049715412 8:144087517-144087539 CAGGGGAAACCAGCCAGGCTAGG - Intergenic
1053597079 9:39573702-39573724 CAGAACAAACAGGCCTTGCTGGG - Intergenic
1053855111 9:42330693-42330715 CAGAACAAACAGGCCTTGCTGGG - Intergenic
1054569177 9:66791295-66791317 CAGAACAAACAGGCCTTGCTGGG + Intergenic
1054984697 9:71247952-71247974 CAAAAAAGACCAGCCTTGCTAGG + Intronic
1055653611 9:78432299-78432321 CAGAAGAAACCAACCCTGTTGGG + Intergenic
1056010954 9:82329594-82329616 CAGGAGAAGGCAGTCATGCTGGG + Intergenic
1057387518 9:94617008-94617030 GATGAGAATCCAGCCCTGCTCGG - Intronic
1058250604 9:102691213-102691235 CAGAAGAAACCAACCCTGCTTGG - Intergenic
1059247951 9:112864412-112864434 CATTAGAAACCAGTCTTGTTGGG - Intronic
1059766682 9:117390088-117390110 CAAGAGAAAACAGCAATGCTTGG + Intronic
1060523236 9:124306161-124306183 CAGGGGAAAGCAGCCTCACTTGG + Intronic
1061313384 9:129778417-129778439 AAGGAGAAATCTGCCTTCCTGGG - Intergenic
1062009894 9:134261308-134261330 CTGGAGAAGCAAGCCCTGCTTGG - Intergenic
1062273842 9:135721504-135721526 CAGGAGACCCCAGCCTGCCTGGG - Intronic
1186422945 X:9440866-9440888 GAGGAGAAACCACCCTTTGTAGG + Intergenic
1188650199 X:32622878-32622900 CAGGTGAAACCAATGTTGCTGGG + Intronic
1189311003 X:40017479-40017501 CAGGCGTAAGCCGCCTTGCTTGG + Intergenic
1192191326 X:68993086-68993108 CAGGAGAGACTGGCCTGGCTCGG - Intergenic
1194579175 X:95650502-95650524 CAGGAGAAACCATCCCTGTTAGG + Intergenic
1195078748 X:101351522-101351544 CGAGGGAAACCAGCCATGCTCGG + Intronic
1195107838 X:101617513-101617535 AAGGAGAAAACTGCCTTGGTTGG - Exonic
1195323484 X:103739826-103739848 CAGGAGAAAGCATGCATGCTGGG + Intergenic
1199331708 X:146568118-146568140 CAGGAGAAATGCGCCTTGGTGGG + Intergenic
1199787792 X:151120260-151120282 TCGGTGAAACCAGCATTGCTTGG - Intergenic
1200049153 X:153419554-153419576 CTGCAGCAGCCAGCCTTGCTGGG - Intronic
1201067500 Y:10112324-10112346 CAGGAGTACCCAGCCATGTTAGG + Intergenic