ID: 981029139

View in Genome Browser
Species Human (GRCh38)
Location 4:140106442-140106464
Sequence CAGAAGCATGCATTTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981029136_981029139 2 Left 981029136 4:140106417-140106439 CCTAGTCTTAGAAGCACCAATCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 981029139 4:140106442-140106464 CAGAAGCATGCATTTGTGTGTGG 0: 1
1: 0
2: 1
3: 20
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981029139 Original CRISPR CAGAAGCATGCATTTGTGTG TGG Intronic
900324237 1:2100159-2100181 CAGCAGTATGCATTTGGGGGTGG - Intronic
901211717 1:7530163-7530185 CAGAAAGATGCAGATGTGTGTGG + Intronic
901465232 1:9417070-9417092 TATGAGCATGCATATGTGTGTGG - Intergenic
903515039 1:23904645-23904667 GGGAAGTATGCATTTGTCTGGGG + Intronic
904584917 1:31575239-31575261 CAGAAGAATGCACTTGCCTGAGG - Intergenic
908424990 1:63998401-63998423 CAGAAGCATCCTTCTGTTTGAGG + Intronic
908448373 1:64224198-64224220 CAAAGGCATGCATTTGTCTTAGG - Intronic
908492682 1:64662192-64662214 CAAAAGCATGTATGTATGTGGGG - Intronic
908528512 1:65011099-65011121 CAAAAGCATTCATTTGCCTGGGG + Intergenic
916737991 1:167625033-167625055 GAAAGGCATGCATTGGTGTGAGG - Intergenic
917494646 1:175529291-175529313 AAGAAGCAAGCATTTGGCTGAGG + Intronic
917777808 1:178356367-178356389 CATAAGCATGTATTTATGTTGGG - Intronic
920367696 1:205456705-205456727 CAAATGCCTGCATATGTGTGCGG - Intergenic
921371736 1:214430577-214430599 CAGAAGGAAGAATTTGTGTTTGG + Intronic
921402768 1:214744433-214744455 CATAAGCATGCTTTTTTGTGGGG - Intergenic
921435036 1:215108781-215108803 CAGTAGTATTCATCTGTGTGGGG + Intronic
922312038 1:224403344-224403366 TAGAAACATGCATTTGTGGCCGG - Intronic
922724580 1:227916863-227916885 TGCAAGCATGCATGTGTGTGTGG - Intergenic
1062791356 10:308292-308314 CAGAGGCATGCAGTGGTGTGTGG + Intronic
1063099152 10:2934688-2934710 GAGAAGCATGCATTAGAGTAAGG + Intergenic
1063521158 10:6742594-6742616 CAGAAGAAAGAATTTGTCTGAGG + Intergenic
1063569119 10:7198093-7198115 CACATGCATGCTTCTGTGTGTGG - Intronic
1065848691 10:29768190-29768212 CAGAAGTATTTTTTTGTGTGAGG - Intergenic
1066074783 10:31863060-31863082 CACAAACATGTATTTGTGTTTGG - Intronic
1066624845 10:37395964-37395986 GAGAGGCAAGCATGTGTGTGAGG + Intergenic
1067716158 10:48692439-48692461 CAGACACTTGCAATTGTGTGAGG - Intronic
1067957461 10:50808104-50808126 CACATGCATGCATGTGTTTGTGG + Intronic
1069577769 10:69543161-69543183 CAGAAGAATGCATTCGTCTGTGG + Intergenic
1069898628 10:71694588-71694610 CAGAAGCAGGCATTCCTGCGAGG + Intronic
1070507473 10:77126740-77126762 CATCAGCCAGCATTTGTGTGTGG - Intronic
1071960235 10:90803092-90803114 CAGAAGAAAGAATTTGTCTGAGG + Intronic
1072045884 10:91654489-91654511 CAGAAGTATACATTTGGGTATGG + Intergenic
1072373192 10:94786900-94786922 CAGAAGCAACCAATGGTGTGTGG - Intronic
1074515256 10:114161670-114161692 CAACAGCAGGCATTTGTTTGGGG + Intronic
1075239385 10:120764333-120764355 CAGCAGCAGGCAATAGTGTGTGG - Intergenic
1077369811 11:2176206-2176228 CAAATGCAGGCATCTGTGTGAGG + Intergenic
1078633206 11:13024452-13024474 CTCATGCATGCATCTGTGTGAGG + Intergenic
1079250916 11:18786995-18787017 CAGAAGGATGTATATTTGTGCGG + Intronic
1079906924 11:26260125-26260147 CAGAATTATCCCTTTGTGTGGGG - Intergenic
1080122039 11:28689515-28689537 CAGAAGAATTCATGTCTGTGGGG - Intergenic
1080275307 11:30497144-30497166 CATAAACATGCATTTGAGGGAGG - Intronic
1081094377 11:38915105-38915127 CATGAGCATGCATTTTTGTTAGG + Intergenic
1085197356 11:74680662-74680684 CAGGAGTGGGCATTTGTGTGTGG + Intergenic
1085985422 11:81781229-81781251 GAGAAGTATGTATGTGTGTGTGG - Intergenic
1088227607 11:107638725-107638747 CAGCCACATGCATTTGTGTATGG + Intronic
1088604844 11:111518833-111518855 CAGAAGCTGGCATTTGAGTTAGG - Intronic
1091029551 11:132172884-132172906 CAGAAAATTGCATTTGTGTCGGG + Intronic
1091560807 12:1611535-1611557 CAATAGCATGCATTTATTTGTGG + Intronic
1091925140 12:4340727-4340749 CAGATGCATGGATTTGTTTCTGG - Intronic
1092442273 12:8516751-8516773 CATAAGCATGCGTTTCTGTAGGG - Intronic
1093827868 12:23716944-23716966 CAGAGGCATTCCTTTGTGTGTGG - Intronic
1095596759 12:43967874-43967896 CAGAAACATGCGTGTGCGTGTGG + Intronic
1096485267 12:51976034-51976056 CAGAAACAGGCATCTGTGTAGGG + Intronic
1097707601 12:62883839-62883861 GAGAAGGATGCAATTATGTGAGG - Intronic
1098092236 12:66915993-66916015 CTGAAGCATGCTTTTGTTGGGGG + Intergenic
1098521725 12:71440588-71440610 CAAATGCAGGCATTTGCGTGCGG + Intronic
1098728713 12:74004756-74004778 AATAAGCAGTCATTTGTGTGTGG - Intergenic
1099349270 12:81544643-81544665 CAAAAGCATGCAGTTCTCTGTGG - Intronic
1099369182 12:81809687-81809709 CAGAAGCATTTATTTGTCTCAGG + Intergenic
1101120615 12:101575897-101575919 CATAAGAATGCATTTCTGTTGGG + Intronic
1101496043 12:105255237-105255259 CAGAAGCAGAGATTTCTGTGGGG - Intronic
1101806314 12:108067312-108067334 AGGAAGCATGCATGTGTTTGTGG + Intergenic
1104092811 12:125529859-125529881 CACAATCATTCATTTGGGTGAGG - Intronic
1106796543 13:33212139-33212161 CAGAAGCATGCCTTTTGGGGTGG + Intronic
1107083392 13:36398873-36398895 CAGAAGGATGCATGTGCGTCTGG - Intergenic
1110194479 13:72771183-72771205 CATAACCATACATTTATGTGAGG + Intronic
1111394152 13:87642962-87642984 CAGAATCATACATCTGAGTGCGG + Intergenic
1112956250 13:105062024-105062046 GAGAAGCATACATTTTTATGGGG - Intergenic
1113780339 13:112973067-112973089 CAGGGGCACGCATTTCTGTGTGG + Intronic
1116255118 14:42544216-42544238 CATATGCATGCATTTGTTTCTGG + Intergenic
1116411251 14:44626304-44626326 TAGCATCTTGCATTTGTGTGGGG - Intergenic
1117485755 14:56195225-56195247 CAGAAGCATGCTTTTGAAGGGGG - Intronic
1118408331 14:65450073-65450095 CATATGTATGCATGTGTGTGTGG + Intronic
1119559667 14:75579852-75579874 TAGAAGCATGCTTTTGGCTGGGG - Intronic
1119747501 14:77054649-77054671 CTGGAGCATACATTTGTGTGGGG + Intergenic
1120551285 14:85876290-85876312 CAGAATCATGCATTGTTTTGAGG - Intergenic
1121110259 14:91307764-91307786 GAGGAGCATGTGTTTGTGTGTGG + Intronic
1124555759 15:30724389-30724411 CAGAAACATGCATAGGTGGGTGG + Intronic
1124675511 15:31681331-31681353 CAGAAACATGCATAGGTGGGTGG - Intronic
1125110592 15:36027770-36027792 CAGCAGCATTCATTTGCTTGTGG - Intergenic
1125260085 15:37813746-37813768 CTGAAGGATGCACTTGTGTTTGG - Intergenic
1127575121 15:60284454-60284476 CAGAAGAAAGAATTTGTCTGAGG + Intergenic
1129567997 15:76644853-76644875 CAGAAGCATGAGTATGTGTCTGG - Intronic
1130791897 15:87164303-87164325 CAGAAGCATCCATTTTAGAGAGG + Intergenic
1132406605 15:101545213-101545235 CAGTAGAATGCGTTTGTGTCTGG - Intergenic
1133579290 16:7127552-7127574 CACGAGCGTGCATGTGTGTGGGG + Intronic
1135870902 16:26149535-26149557 CAGAAGAAAGCATTTTTGTAAGG + Intergenic
1139167638 16:64587125-64587147 CAGAAGCAAACATTTGTGGCAGG - Intergenic
1142702916 17:1675115-1675137 CAGTAGCATGGAATTGTGTGTGG - Intronic
1143346642 17:6254346-6254368 CAAAAGCATGGAATTCTGTGAGG + Intergenic
1144158244 17:12529635-12529657 CAGGTGTATGCATTTCTGTGGGG + Intergenic
1144221987 17:13107949-13107971 CTCAAGCATTCATTTCTGTGTGG - Intergenic
1146513214 17:33468686-33468708 GAGAAGTATGTATGTGTGTGGGG - Intronic
1146642611 17:34552725-34552747 CGGAAGCATGCTTTTCTGTGTGG - Intergenic
1146962859 17:36999776-36999798 CAGAGCCATGCAGTTGTCTGGGG + Intronic
1148123924 17:45227319-45227341 CAGAAGTAAGCACTGGTGTGGGG + Intronic
1149073370 17:52570323-52570345 CAGAAGCATCCTTTTTTGGGGGG + Intergenic
1149429672 17:56587652-56587674 CAGAAGTATGGGTATGTGTGTGG + Intergenic
1150468515 17:65415802-65415824 CACAAGCATGCTCCTGTGTGTGG + Intergenic
1151594381 17:75068186-75068208 CAGAAGCATGTACATGTGAGGGG - Intergenic
1152318025 17:79592200-79592222 CACATGCATGCATGTGTGTGTGG + Intergenic
1152372882 17:79901419-79901441 CAGCAGCATGCACTTCCGTGTGG + Intergenic
1152421701 17:80196841-80196863 CACAGGCCTGCATTTCTGTGTGG - Intronic
1152644451 17:81462369-81462391 CAGACGCAGGCATCTGAGTGCGG - Intronic
1152762887 17:82118628-82118650 CAGAAGCAGGTATTTCTTTGGGG + Intronic
1152877786 17:82797330-82797352 CAGATGGAGGCCTTTGTGTGAGG + Intronic
1153687379 18:7560052-7560074 CAGAAGACTGCTTTTGTGTAGGG + Intergenic
1153975645 18:10266466-10266488 CAGAGGCATCCACTTGTGTGAGG + Intergenic
1155588600 18:27398467-27398489 CAATAGGATGCATGTGTGTGGGG - Intergenic
1155824444 18:30421850-30421872 CAGAAGCATGGATTTGAGTGTGG - Intergenic
1156001747 18:32392766-32392788 GAGAATCAAACATTTGTGTGTGG - Intronic
1156681169 18:39590493-39590515 GAGAAGCATGGTTCTGTGTGAGG + Intergenic
1158599482 18:58845159-58845181 AATCAGCATGCATTTGGGTGAGG - Intergenic
1159654426 18:71014801-71014823 CAGAAGAAAGCATTTGACTGAGG - Intergenic
1159949512 18:74472291-74472313 CAAAGCCTTGCATTTGTGTGTGG + Intergenic
1160126791 18:76182257-76182279 TATAAGATTGCATTTGTGTGTGG - Intergenic
1161839576 19:6671089-6671111 CAGGTGCATGCATATGTGTATGG + Intergenic
1162881251 19:13661395-13661417 AGGAACCATGCATTTCTGTGCGG - Intergenic
1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG + Intronic
1164633138 19:29774597-29774619 CCCAAGCATCCATATGTGTGGGG + Intergenic
1164811536 19:31161127-31161149 CAGAGGCATTCATATATGTGTGG - Intergenic
1166201517 19:41240433-41240455 CAGATGGATGGATTTGTGAGTGG + Intronic
925390065 2:3488448-3488470 CAGAAGAATGTGTGTGTGTGGGG - Intergenic
925426775 2:3755656-3755678 CATATGGATGCATATGTGTGTGG + Intronic
925966708 2:9073311-9073333 CTGGAACATGGATTTGTGTGAGG + Intergenic
926318691 2:11732332-11732354 CAGAAGCATGAACTTGGATGTGG - Intronic
928083400 2:28329386-28329408 CTGAAACTTGCATTTGTGTGGGG + Intronic
930119874 2:47751779-47751801 CAGAAGAAAGAATTTGAGTGAGG + Intronic
930324316 2:49895686-49895708 CAGAAGCAGGCAGTTGCCTGGGG - Intergenic
931907757 2:66861067-66861089 CATAACCATGAATTTGTGTTTGG - Intergenic
933322867 2:80798718-80798740 CAGTAGAATGAATTTGTGTTTGG + Intergenic
934054032 2:88236722-88236744 GAGAAGAATAGATTTGTGTGGGG - Intergenic
934875276 2:97913039-97913061 CAGAAGCATTTCTCTGTGTGCGG + Intronic
936080805 2:109431249-109431271 CAGCAGCCTGCACTGGTGTGAGG + Intronic
936837801 2:116728570-116728592 CAGAAGAAAGCATTTGACTGAGG - Intergenic
936844128 2:116809674-116809696 CAGAAGCAGGCATTACTGTGAGG + Intergenic
937214860 2:120306031-120306053 TAGCAGTATGCATTTGTGTTAGG + Intergenic
939285195 2:140120722-140120744 CAGAAGTATTCTTTTGTGTAAGG + Intergenic
940702319 2:157060910-157060932 CAGAAGGAACCAATTGTGTGGGG + Intergenic
940796044 2:158080098-158080120 AAGAAGCATGAAATGGTGTGTGG - Intronic
940927088 2:159376355-159376377 CAGAAATATATATTTGTGTGTGG - Intronic
941618341 2:167749045-167749067 AAGATGCATGTATTTTTGTGAGG + Intergenic
944285105 2:197940677-197940699 AAGAAGCCTGCATTTGGGTGAGG + Intronic
944911699 2:204316827-204316849 CAGATCCATGGATTAGTGTGTGG - Intergenic
945381772 2:209148997-209149019 TTGGAGCATGCATATGTGTGAGG - Intergenic
1171299620 20:24048881-24048903 CATGTGCATGCATGTGTGTGTGG - Intergenic
1172355572 20:34277314-34277336 CAGAACCCAGCATTTGTATGTGG - Intergenic
1173174705 20:40755535-40755557 CAGGAGCATGCATTTTTGGTGGG - Intergenic
1174556609 20:51400092-51400114 CAGAAGCATGTATGGGTGGGTGG - Intronic
1174702470 20:52622946-52622968 TACATGCATGCATTTGTGTCTGG - Intergenic
1175377354 20:58537533-58537555 CACAACCATGTAGTTGTGTGTGG + Intergenic
1175739411 20:61410270-61410292 CAGAAGGATGGATGTGTGAGTGG - Intronic
1176018066 20:62947553-62947575 CAGATGCATGAAATTGGGTGAGG + Exonic
1176911826 21:14575066-14575088 TAGAAGTATGCATGTGTGTTAGG - Intronic
1178318763 21:31588910-31588932 CAAAAGTATTCTTTTGTGTGAGG - Intergenic
1180238903 21:46485411-46485433 CAGACAAATGCATATGTGTGCGG + Intronic
1181662541 22:24363012-24363034 CAGAAGTATTCGTCTGTGTGGGG + Intronic
1181718040 22:24749550-24749572 AACAAGCATGAATTTGAGTGAGG + Intronic
1182376354 22:29851304-29851326 CAGAAACATGGCTTAGTGTGAGG + Intergenic
1183346022 22:37308334-37308356 TGTAAGCATGCATGTGTGTGTGG + Intronic
1184962311 22:47940357-47940379 GTGCAGCATGCATGTGTGTGTGG + Intergenic
1185103934 22:48856629-48856651 CAGGAGCAGGCGTTTGTCTGGGG + Intergenic
949802446 3:7918433-7918455 CAGAATCTTGCATTTCTGAGAGG + Intergenic
951686651 3:25351749-25351771 CACAAGCATGAATATGGGTGAGG - Intronic
952927315 3:38329478-38329500 CAGAAGCACACATAGGTGTGAGG + Intergenic
953250131 3:41238287-41238309 CAGTAGCATGTATTTGTTGGTGG - Intronic
959277699 3:104297780-104297802 GAGAAGCATGTGTGTGTGTGTGG - Intergenic
959603809 3:108220854-108220876 TTGAATCATGGATTTGTGTGGGG - Intronic
959780372 3:110225033-110225055 CAGAAGAATGCATTTAAATGAGG - Intergenic
959905614 3:111708274-111708296 CAGAACCAGGCATTTGTGATGGG - Exonic
961449737 3:126997249-126997271 CAGAAGGATGGATTTCTTTGGGG + Intronic
963209497 3:142673461-142673483 CTCATGAATGCATTTGTGTGTGG + Intronic
963598617 3:147358505-147358527 CTGAAGCATGTATTTGGGCGAGG + Intergenic
963864842 3:150349669-150349691 CTGAAGCATGAATTTGAGTTGGG - Intergenic
970127154 4:12827581-12827603 CAGAATCATCCATTTCTGTAAGG + Intergenic
973742230 4:53929089-53929111 CAGAAGAATGCAATTATGGGGGG - Intronic
974205100 4:58691701-58691723 CAGAAGTATGCATGTGAATGTGG + Intergenic
974692625 4:65317347-65317369 CAGAAGCAAGGCTGTGTGTGGGG - Intergenic
977306590 4:95330962-95330984 CAGAAGGATGCAGGTGGGTGAGG - Intronic
980160119 4:129150689-129150711 CAGAAGAAAGCATTTGACTGAGG - Intergenic
980493126 4:133555421-133555443 CAGAAGCAGACATTTTGGTGTGG - Intergenic
981029139 4:140106442-140106464 CAGAAGCATGCATTTGTGTGTGG + Intronic
981070398 4:140529644-140529666 CAGAAGCATGCTGATGTGTTTGG - Intronic
982103743 4:151993582-151993604 CAGAAGAAAGCATTTGACTGAGG + Intergenic
983365023 4:166775420-166775442 CAGAAGAGTGGGTTTGTGTGGGG + Intronic
983726865 4:170940273-170940295 CAGTAGCATGGGTTTGTGAGTGG - Intergenic
984362379 4:178751868-178751890 CAGAACCATGCATTTATTTAAGG + Intergenic
985813547 5:2109611-2109633 CAGATGTCTGCATTTGTGTGGGG - Intergenic
985858164 5:2447356-2447378 CAGAAGAATGGATTTATCTGGGG + Intergenic
986007925 5:3683760-3683782 CTGGAGCATGCATTTGGGAGGGG - Intergenic
986593936 5:9401003-9401025 CAAAAGCATGCATTTTGGAGAGG - Intronic
986835843 5:11636041-11636063 TAGAATCATGAATGTGTGTGTGG - Intronic
987176876 5:15321031-15321053 CAGTAAAAGGCATTTGTGTGAGG + Intergenic
987620250 5:20330928-20330950 CAGAAGAAAGAATTTGTTTGGGG - Intronic
988921577 5:35947214-35947236 CAGAAGTATTCTTTTGTGTAAGG + Intergenic
990755647 5:59066487-59066509 CAGCAGAATGCATGTGTGGGTGG + Intronic
990757549 5:59091287-59091309 CATAAGCGTACATTTTTGTGGGG - Intronic
990876414 5:60491579-60491601 CAGAAGGATCCATTTATCTGTGG + Intronic
991240648 5:64455700-64455722 CAGAAGCAATCATTTCTGTTGGG - Intergenic
993832867 5:92780891-92780913 CAGAATAATGCATTTGATTGGGG - Intergenic
994413066 5:99433752-99433774 CACAAGTTTGGATTTGTGTGTGG + Intergenic
994480771 5:100331965-100331987 CACAAGTTTGGATTTGTGTGTGG - Intergenic
995450513 5:112294749-112294771 CTGAAGTACGCATTTGGGTGGGG + Intronic
995685734 5:114770207-114770229 TTGATGCATGCATTTGTTTGTGG + Intergenic
998613805 5:143718049-143718071 CAGAAGGATGGCTGTGTGTGTGG - Intergenic
998715044 5:144873589-144873611 CAGAAGCATAGTTTTGGGTGGGG + Intergenic
999645069 5:153709774-153709796 AAGAAGCAGACATCTGTGTGGGG - Intronic
1000292055 5:159879633-159879655 CACACGCATGCATATGCGTGTGG - Intergenic
1002517907 5:179773308-179773330 CAGAAAAAGGCATCTGTGTGGGG - Intronic
1003980957 6:11389377-11389399 CAGGAGCATGAACATGTGTGGGG - Intergenic
1004435300 6:15586749-15586771 CAGCAGCATGGGTTTGTGTGTGG - Intronic
1004622794 6:17346066-17346088 CAAAAGCATAGATTTTTGTGGGG + Intergenic
1005350553 6:24930642-24930664 CACAAGCATGAATTACTGTGGGG + Intronic
1005825498 6:29629218-29629240 CAGAAGCCTGCGTTTCTGAGGGG + Intronic
1008176642 6:48276119-48276141 CTGAAGCATGCATTTACTTGTGG - Intergenic
1011975105 6:93286179-93286201 CTGTAGAATACATTTGTGTGGGG - Intronic
1014009483 6:116459877-116459899 CAGAAGGATGCATTTTTATTAGG + Intergenic
1014057564 6:117033968-117033990 GAAAAGGATGCTTTTGTGTGTGG - Intergenic
1014824901 6:126038264-126038286 CAAAATAATGCATTTGTGTGAGG - Intronic
1015711858 6:136150516-136150538 CAGAAGCATGAATTTATTTCTGG + Intronic
1018134904 6:160769625-160769647 CAGAAGAATGAATTTGACTGAGG - Intergenic
1018864932 6:167738760-167738782 GAAAAGCATGCACTTGTGAGAGG + Intergenic
1018944495 6:168337039-168337061 CAGCAGTGTGCATGTGTGTGGGG - Intergenic
1019356693 7:583850-583872 CAGAACCGTGCAGGTGTGTGGGG - Intronic
1020070133 7:5221929-5221951 TAAAAGCCTGGATTTGTGTGTGG - Intronic
1020599619 7:10256013-10256035 CAGGAGCATGAATTTTAGTGGGG - Intergenic
1021685761 7:23183701-23183723 CAGAAACATTCATTTGTTTCTGG - Intronic
1022188459 7:27993486-27993508 CAGAAGCATGGATATATGTTGGG - Intronic
1023461017 7:40397201-40397223 AAGGAGCATGCATTTTTCTGTGG + Intronic
1023684307 7:42719040-42719062 CAGAAGAAAGAATTTGTCTGAGG + Intergenic
1023940312 7:44765216-44765238 TGGAAGCAAGCATTTGAGTGGGG + Intronic
1024715128 7:52070940-52070962 CAGAACCATGCATGTGTATATGG - Intergenic
1024726542 7:52203292-52203314 CAGTGGCATGCATGTGTGTCAGG - Intergenic
1025069172 7:55883992-55884014 CACATGCATGTGTTTGTGTGTGG - Intergenic
1026391445 7:69906642-69906664 CAGACGCAGGCAATTCTGTGTGG + Intronic
1027754114 7:82188700-82188722 CAGATGCATGCATGTGTCTATGG - Intronic
1028710170 7:93898124-93898146 CATACGCATGTATTTGTGTGTGG + Intronic
1028724049 7:94067364-94067386 CAGACACATGCATTTCTGTTTGG + Intergenic
1029299958 7:99574004-99574026 AATAAGCATGTATGTGTGTGAGG + Exonic
1033244291 7:139705203-139705225 CAGAAGCATGGATCTGGGTGGGG + Intronic
1033518666 7:142137160-142137182 CAGAAGCTTGTATTTTTATGTGG + Intronic
1033845951 7:145432373-145432395 CAACAGCCTGCATTTGTGTCAGG - Intergenic
1034997415 7:155586964-155586986 CAGAAGGAGGCATGTGTGGGAGG - Intergenic
1036216214 8:6882006-6882028 GAGATGCATGCGTGTGTGTGTGG + Intergenic
1036503927 8:9338009-9338031 CAGGAGCTTGCAGATGTGTGTGG + Intergenic
1039370740 8:36981671-36981693 GAGAACAATGCATTTGTTTGCGG - Intergenic
1040862172 8:52010429-52010451 CAGATTCATGTTTTTGTGTGAGG - Intergenic
1041785381 8:61627116-61627138 TAGAAGCATTCATTTATGTTGGG - Intronic
1042729725 8:71919153-71919175 CACATGCATGCATTTCTTTGAGG + Intronic
1045253487 8:100500234-100500256 CAGAAGCATACATTTCTCTTGGG - Intergenic
1045313839 8:101026595-101026617 CAGAACCATGTATCTGTGGGAGG + Intergenic
1045401808 8:101826581-101826603 CAGAAAGATGGATATGTGTGTGG + Intronic
1047499876 8:125432316-125432338 GACAAGCATGTATGTGTGTGTGG + Intronic
1052398388 9:27970148-27970170 CAGAAGCATCCCAGTGTGTGTGG - Intronic
1054707339 9:68476289-68476311 CACAAGCATGCAATTGTCAGAGG - Intronic
1055315858 9:75033277-75033299 CAGATGGATGAATTTGTGAGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057824986 9:98365693-98365715 AAGAAACATGCATGTTTGTGGGG + Intronic
1058407185 9:104690316-104690338 CATCATTATGCATTTGTGTGTGG - Intergenic
1058441422 9:105011615-105011637 CGTAAGCATGTTTTTGTGTGTGG + Intergenic
1058713996 9:107707060-107707082 CAGATGAATGCATTTGGATGAGG + Intergenic
1061511982 9:131067188-131067210 CTCACGCATGCATTTGTCTGCGG - Exonic
1185795662 X:2962343-2962365 CAGGAGCATGCAGATGTGTTGGG + Intronic
1186932216 X:14406164-14406186 CTGAAGCAAGGATTTGGGTGTGG - Intergenic
1187738099 X:22324928-22324950 AAGATGCATGCATTTGAGTGTGG - Intergenic
1188260152 X:28014273-28014295 CATAAGCATCATTTTGTGTGTGG - Intergenic
1188453614 X:30336518-30336540 AAGAAGCATGAAGTTGTGGGAGG - Intergenic
1188611848 X:32109652-32109674 AAGTAGCAGGCATTTCTGTGAGG - Intronic
1188619556 X:32203318-32203340 CAGATGCCTGCCTTTATGTGAGG - Intronic
1188710348 X:33389478-33389500 AAGAAGCATGCATTTGGGGATGG + Intergenic
1189442062 X:41046157-41046179 CAGAAGCACCACTTTGTGTGTGG - Intergenic
1191997653 X:67113648-67113670 AAGAAGGATGTATTTGTGTGAGG - Intergenic
1196540680 X:116903477-116903499 CACATGCATGCATTTGTTTATGG + Intergenic
1196700167 X:118659405-118659427 CAGAAGGATGCATCTGTTTGAGG - Intronic
1197230259 X:123996333-123996355 CAGAAGAAAGCATTTGAGTATGG + Intronic
1197487589 X:127073693-127073715 AAGAAGAATCCATTTGTTTGGGG - Intergenic
1198528328 X:137524504-137524526 AAGAAGCATACAGTTGTGTCTGG - Intergenic
1198715095 X:139549959-139549981 GAGGAGCATGAATATGTGTGTGG + Intronic
1201851086 Y:18480592-18480614 TGTAAGCATGCATTTGTGTATGG - Intergenic
1201882233 Y:18839786-18839808 TGTAAGCATGCATTTGTGTATGG + Intergenic
1202330452 Y:23747171-23747193 TGTAAGCATGCATTTGTGTATGG + Intergenic
1202347743 Y:23952767-23952789 ATAAAGCATGCATTTGTGTAAGG + Intergenic
1202523030 Y:25717324-25717346 ATAAAGCATGCATTTGTGTAAGG - Intergenic
1202540317 Y:25922890-25922912 TGTAAGCATGCATTTGTGTATGG - Intergenic