ID: 981032299

View in Genome Browser
Species Human (GRCh38)
Location 4:140137374-140137396
Sequence GTTAAAACCCACAACCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981032299 Original CRISPR GTTAAAACCCACAACCATAT GGG (reversed) Intronic
900037285 1:425796-425818 ATAAAAACCCTCAACAATATAGG - Intergenic
900058914 1:661537-661559 ATAAAAACCCTCAACAATATAGG - Intergenic
900943383 1:5815526-5815548 GTTAAAACCCTCAACCTTCCAGG - Intergenic
904764199 1:32830307-32830329 GTTAAAGCCCTCAACCATGAGGG - Intronic
908163333 1:61433567-61433589 TTTAAGACCCAAAACCATAAGGG - Intronic
908818879 1:68062145-68062167 GTTAAAACCCTCAACAAACTAGG + Intergenic
915821354 1:159027207-159027229 ATTAAAACCCTCAGCAATATTGG - Intronic
916889450 1:169102424-169102446 GTTAGAAACCAGAACCATTTTGG + Intergenic
924357029 1:243189805-243189827 GTTAACACTCACAAACACATAGG - Intronic
1072825609 10:98603301-98603323 GGTAAAACTCACAAAAATATGGG - Intronic
1072885642 10:99270945-99270967 ATTAAAACCCTCAACAAAATTGG + Intergenic
1073679161 10:105683253-105683275 GATAAAACCCACAAAAATGTAGG + Intergenic
1076964011 11:63719-63741 ATAAAAACCCTCAACAATATAGG - Intergenic
1079480358 11:20873299-20873321 CTTAAAAGCCACAATCTTATAGG - Intronic
1081316338 11:41635626-41635648 GTTAAAACCCTCAACAAACTAGG - Intergenic
1083078268 11:60064297-60064319 GATAAAACCCACAAGAACATGGG + Exonic
1089824947 11:121266467-121266489 GCTAGAACCCACAACCCTAGGGG - Intergenic
1089825923 11:121277263-121277285 ATTAAAACCCTCAACAAAATCGG - Intergenic
1094742247 12:33303222-33303244 CTTAAGACCCACAACCAGAAAGG - Intergenic
1094778597 12:33762914-33762936 GATAAAACCCTCAACAACATAGG + Intergenic
1095043743 12:37474745-37474767 TTTAAGACCCACAACCAGAAAGG + Intergenic
1096280757 12:50251247-50251269 ATTTATACCCACAACTATATTGG - Intronic
1096447777 12:51709803-51709825 GTTAAAAACCACATCTATTTCGG - Intronic
1099303396 12:80925558-80925580 TTTAAAACCAACAACTTTATCGG + Intronic
1105297471 13:19101601-19101623 TTTAAAACTCCCAACCATAGGGG - Intergenic
1106681613 13:32014074-32014096 GTTAACAACCACAACAAAATAGG - Intergenic
1109484860 13:63005597-63005619 ATTAAAACCCTCAGCAATATTGG + Intergenic
1111040745 13:82744043-82744065 GATAAAACCAACAAAAATATTGG + Intergenic
1111277241 13:85966310-85966332 TTTAAAAACCACAACACTATCGG - Intergenic
1111606116 13:90541463-90541485 GTTAAAACCCTCAACAAAATAGG + Intergenic
1111997269 13:95177066-95177088 CTTAAAACCCACAGGCATGTAGG - Intronic
1113183121 13:107654958-107654980 ATTAAAACCCTCAGCCAAATCGG + Intronic
1113726889 13:112610802-112610824 GTTGAAACCCCCAACTATTTTGG - Intergenic
1116838780 14:49797908-49797930 GTGAAAACCCACAAAGACATGGG - Intronic
1118866250 14:69705989-69706011 GTTATAACTCACAAACATAAAGG + Intronic
1119582364 14:75797595-75797617 ATTAAAACCCTCAACAAAATTGG - Intronic
1120583626 14:86284835-86284857 AATAAAACCAACAACCATAAAGG - Intergenic
1122191943 14:100052121-100052143 TTTAAAACCAACTACCAGATAGG - Intronic
1202942275 14_KI270725v1_random:162341-162363 CTTAAGACCCACAACCAGAAAGG + Intergenic
1124650911 15:31473266-31473288 GTTAAAATCCACAGGCAGATAGG - Intergenic
1124682147 15:31741200-31741222 GTTAAATCTCCTAACCATATGGG - Intronic
1125384167 15:39119083-39119105 GTTAAAACCCTCAAGAATCTAGG + Intergenic
1126291144 15:47081124-47081146 CTTAAGACCCACAACCAGAAAGG - Intergenic
1126294393 15:47121325-47121347 ATTAAAACCCTCAACAAAATTGG + Intergenic
1132412586 15:101594729-101594751 GTTAAAACCCTCAGCAAAATCGG - Intergenic
1132444540 15:101901462-101901484 ATAAAAACCCTCAACAATATAGG + Intergenic
1143428328 17:6859002-6859024 GTTAAAAACCTCAACCAACTAGG - Intergenic
1147779713 17:42932405-42932427 GTTAAAACACACAATCAAAATGG + Intergenic
1147972497 17:44226881-44226903 GGTAAAACTCACAAAAATATAGG + Intergenic
1149247785 17:54731658-54731680 GTTAAAACCCTCAACAAACTAGG + Intergenic
1152325671 17:79634414-79634436 GCTAAAACCCACACCCAAAGTGG + Intergenic
1156154257 18:34282909-34282931 GTCACTACCCACAGCCATATAGG + Intergenic
1156940927 18:42766656-42766678 GTTAAACCCCAAAACCATGGGGG + Intronic
1160640814 19:133351-133373 ATAAAAACCCTCAACAATATAGG - Intergenic
1164077225 19:21831060-21831082 GTTAAAACCCTCAACGAACTAGG + Intronic
1164545603 19:29159366-29159388 ATAAAAACCCACAACAAAATTGG + Intergenic
925563795 2:5227278-5227300 GTCAAAACCCACACCTATTTGGG + Intergenic
930516517 2:52414212-52414234 GGTAAAACCCACAAAAGTATGGG + Intergenic
930958463 2:57231520-57231542 GTCAATACCCACAACGTTATGGG - Intergenic
933195404 2:79383663-79383685 GTTAAAGCCCAAAACCACCTAGG - Intronic
933444557 2:82362958-82362980 GATAAAACTCACAAACATATGGG + Intergenic
933516548 2:83311047-83311069 GTTATAACTCACTACCATAAGGG - Intergenic
934611168 2:95737648-95737670 GTAAAAACCAATAACCATGTAGG + Intergenic
935001023 2:99015450-99015472 GTTAAAACCCTCAGCAAAATTGG + Intronic
935613701 2:105054454-105054476 GTTAACACTCACTTCCATATGGG - Intronic
936910841 2:117591610-117591632 GTTAAAACCCTCAGCAAAATTGG - Intergenic
937819270 2:126289669-126289691 GGTAAAACTCACAAAAATATAGG - Intergenic
938996727 2:136687144-136687166 ATTAAAACCCTCAACAAAATCGG + Intergenic
943845494 2:192640704-192640726 GTGATAAGCCACAAGCATATTGG + Intergenic
945657495 2:212643265-212643287 GTTAAAACCCCCAGCAAAATCGG - Intergenic
1169969753 20:11256848-11256870 ATTAAAACCCACAGCAAAATTGG + Intergenic
1171802939 20:29643963-29643985 CTTAAGACCCACAACCAGAAAGG - Intergenic
1171841144 20:30212779-30212801 CTTAAGACCCACAACCAGAAAGG + Intergenic
1173199246 20:40942409-40942431 GGTATAAACCACAGCCATATGGG - Intergenic
1175012600 20:55754646-55754668 GTTAAGACCCACAATCAGAAAGG + Intergenic
1176580895 21:8524589-8524611 CTTAAGACCCACAACCAGAAAGG - Intergenic
1181054835 22:20255975-20255997 GTTATCACACACAATCATATAGG - Intronic
1185290737 22:50025938-50025960 GCAAAACGCCACAACCATATTGG + Intronic
949948364 3:9208188-9208210 GTCAAAACCCATAAACATCTCGG - Intronic
951400775 3:22229516-22229538 GCTATAACCCACAATCATAAAGG - Intronic
951751731 3:26043388-26043410 GTTAAAACCCAGGAGCTTATGGG - Intergenic
952984541 3:38766416-38766438 ATTAAAACCCTCAACCAAATTGG - Intronic
954028945 3:47804091-47804113 GTTAAAACCCACAATGACAGTGG - Intronic
955170437 3:56558659-56558681 GATAAAACCCACAACTACAGGGG - Intronic
956660257 3:71590534-71590556 GTAAAAACCCAAAACAAAATGGG + Intergenic
957019099 3:75104271-75104293 GTTAAAACCCTCAACAAACTAGG - Intergenic
958156036 3:89757037-89757059 ACAAAAACCCACAACCAAATAGG - Intergenic
965296325 3:166951741-166951763 GTTAAAACCCTCAGCAAAATTGG - Intergenic
966585841 3:181623334-181623356 GTTAAAACAAAAAACAATATGGG + Intergenic
970605525 4:17677980-17678002 GTTAAAACCCTCAGCAAAATCGG + Intronic
972531840 4:39968305-39968327 TTCAGAACCCACAACTATATGGG + Intronic
972869153 4:43274580-43274602 GTGAATAACCACAACCATAATGG + Intergenic
976481444 4:85551210-85551232 GTTAAAACCCTCAACAAACTAGG - Intronic
978757581 4:112320225-112320247 ATTAAAACCCTCAACAAAATTGG - Intronic
979244788 4:118489796-118489818 GTTAACACTCACAAACACATAGG + Intergenic
979830210 4:125290574-125290596 TTAAAAACCTTCAACCATATAGG - Intergenic
981032299 4:140137374-140137396 GTTAAAACCCACAACCATATGGG - Intronic
981167966 4:141584482-141584504 ATTAAAACCCTCAACAAAATTGG + Intergenic
981627309 4:146773399-146773421 GTTAAAACCCTCAACAAACTGGG - Intronic
985033049 4:185811423-185811445 TTTAAAACCCCAAAGCATATCGG + Intronic
986896789 5:12380902-12380924 TTTAAAACCCACAACAAGCTAGG - Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
988182328 5:27813038-27813060 CTTATAACCCACAAACACATGGG - Intergenic
988662629 5:33289702-33289724 GTTACAAACCACAGCAATATTGG - Intergenic
989727795 5:44607798-44607820 ATTAAAACCCTCAGCAATATAGG + Intergenic
993138937 5:84005633-84005655 GTTAAAACCCACAACAAATTAGG + Intronic
993465896 5:88246853-88246875 TCTCAAACACACAACCATATGGG + Intronic
994207653 5:97053326-97053348 GTTAAAACCCTCAGCAAAATTGG - Intergenic
997192251 5:131948041-131948063 GTTAATTCCCACAAACCTATGGG - Intronic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1002736536 5:181393070-181393092 ATAAAAACCCTCAACAATATAGG + Intergenic
1002748161 6:81754-81776 ATAAAAACCCTCAACAATATAGG - Intergenic
1005374447 6:25168021-25168043 GATAAATCCCACAATCATAATGG - Intergenic
1008927547 6:56902843-56902865 ATCAAAACCAACAACCATACAGG + Intronic
1009672105 6:66768618-66768640 TTTAAAATCCACAGCCAAATTGG - Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011995167 6:93577552-93577574 GTTAAAATCCACATGCATTTTGG - Intergenic
1012147714 6:95707313-95707335 GTTCAAACCCAGAACCATGTTGG - Intergenic
1012203123 6:96430479-96430501 ATTAAAACCCTCAACAAAATAGG - Intergenic
1012207868 6:96483349-96483371 ATTACAAACCACATCCATATAGG - Intergenic
1015278231 6:131405443-131405465 GTTAATACCCACAACAATTATGG - Intergenic
1015570307 6:134614276-134614298 GTTAAAACCCTCACCCCTAATGG - Intergenic
1015807824 6:137129726-137129748 ATTAAAACCCTCAGCCAAATCGG - Intergenic
1015877646 6:137839510-137839532 ATTAAAACCCTCAACAAAATCGG - Intergenic
1016358393 6:143242427-143242449 TTTAATCCCCACAACTATATGGG + Intronic
1019241634 6:170668599-170668621 ATAAAAACCCTCAACAATATAGG + Intergenic
1024205747 7:47159187-47159209 GTTAAAGTCCACAACTGTATAGG - Intergenic
1026405774 7:70064052-70064074 GCTGAAACCCACATCCATTTGGG - Intronic
1028347781 7:89804397-89804419 ATTAAAACCCTCAACAAAATTGG - Intergenic
1031092494 7:117376585-117376607 ATAATAACCCACAACCACATGGG + Intronic
1032816727 7:135483374-135483396 ATTACAAACCACAACCAAATGGG + Intronic
1034286669 7:149888422-149888444 GTTAAAACCAACTACCATCCAGG - Intergenic
1035095723 7:156353355-156353377 GTTAATAGCCACAAAAATATAGG - Intergenic
1035506482 8:139497-139519 ATAAAAACCCTCAACAATATAGG - Intergenic
1037388591 8:18368494-18368516 TTTAAAACCCTCAACAATCTAGG + Intergenic
1041220333 8:55644596-55644618 GTTAAAACCCTCAACAAATTAGG - Intergenic
1041864606 8:62556814-62556836 GTAAAAACCCACCATCCTATTGG + Intronic
1042394046 8:68270629-68270651 GTGAAAGGCCAGAACCATATGGG - Intergenic
1043210433 8:77507477-77507499 GTGAAAACCCAGAAACATTTAGG - Intergenic
1044616502 8:94148105-94148127 GGGGAAACCCACAACCACATTGG + Intronic
1048506207 8:135024503-135024525 GTAAAAAGCCACAAGCTTATGGG - Intergenic
1052949155 9:34193895-34193917 GTTAAGACCCACAATCAGAAAGG + Intronic
1055132119 9:72787473-72787495 TTTAAAAACCAAAACCTTATGGG + Intronic
1061700883 9:132414738-132414760 GTGAAAACCTACAAGCATTTAGG - Intronic
1203601826 Un_KI270748v1:17833-17855 ATAAAAACCCTCAACAATATAGG + Intergenic
1186375600 X:8995979-8996001 GTTAAAAGCCACATTGATATGGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190967610 X:55316050-55316072 GTTAAAACGCTCAACAAAATGGG - Intergenic
1191806684 X:65143374-65143396 ATTAAAACTCTCAACAATATCGG - Intergenic
1194028134 X:88779575-88779597 ATTAAAACCCTCAACAAAATTGG - Intergenic
1194126519 X:90024717-90024739 GTAAAAACCCTCAACAATCTAGG + Intergenic
1194344560 X:92747386-92747408 ATTAAAACTCACAACAACATAGG - Intergenic
1194590521 X:95794939-95794961 GTTGAAATCCAAATCCATATAGG - Intergenic