ID: 981032791

View in Genome Browser
Species Human (GRCh38)
Location 4:140142692-140142714
Sequence TGCTTTCTTAAAATATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 1, 2: 11, 3: 82, 4: 725}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981032791_981032797 15 Left 981032791 4:140142692-140142714 CCTTCAAATATTTTAAGAAAGCA 0: 1
1: 1
2: 11
3: 82
4: 725
Right 981032797 4:140142730-140142752 AAATCAGACTAAACACCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981032791 Original CRISPR TGCTTTCTTAAAATATTTGA AGG (reversed) Intronic
900912617 1:5612349-5612371 TGCTTTCTTAAAGTCTTTCTGGG - Intergenic
901247748 1:7746270-7746292 TGCTTTGTAAAAATATTTTATGG + Intronic
901366031 1:8749276-8749298 TTCATTCTTAAAATATTTCTTGG + Intronic
901468976 1:9442407-9442429 TTCGGTCTTAAAATACTTGATGG - Intergenic
903112051 1:21144032-21144054 TGCTTTCTTAAAAAATATTTTGG - Intronic
905287242 1:36889495-36889517 TGCTTTCTTAAATTCTTGGATGG - Intronic
906023154 1:42649108-42649130 TTCCTTCTTTAAATATTTGGTGG - Intronic
906857535 1:49324460-49324482 TGCTTTATTAGAATATCAGAGGG + Intronic
907100939 1:51834950-51834972 TGGTTTTCTAAAGTATTTGAGGG - Intronic
907131407 1:52100516-52100538 TGCATTCTTTAAAGTTTTGAGGG + Intergenic
908053016 1:60253352-60253374 TGATTTGTTAAAATAATTGAAGG - Intergenic
908276643 1:62480058-62480080 TGTTATCTTCAAATATTTAAAGG - Intronic
909122601 1:71622973-71622995 TTCTTTTTTAAGATTTTTGAAGG - Intronic
909158100 1:72106695-72106717 TGCTTTGTTGAAATGTTTGATGG - Intronic
909293464 1:73913441-73913463 TGAGTTCTTATGATATTTGATGG - Intergenic
909574101 1:77153865-77153887 TACTTTCTTGAAATATATAATGG - Intronic
909766862 1:79367141-79367163 TGCTCTCTTCAAATATTCAAAGG - Intergenic
909950916 1:81719505-81719527 TGCTATTTTTAAATATTTGTTGG + Intronic
909954303 1:81758883-81758905 ACCTATCTTCAAATATTTGAAGG - Intronic
910225378 1:84930873-84930895 TGCTTTCTTAAGCTACCTGATGG - Intronic
910521694 1:88129222-88129244 GTCTTTCTTAGAATTTTTGAGGG - Intergenic
910956555 1:92712567-92712589 TGATTTCCTAAAGAATTTGATGG - Intronic
910969550 1:92841968-92841990 TGCTTTTCCAAAATATTTCAGGG - Intronic
911353803 1:96791290-96791312 TGTTTTCTTAAAATATATGTAGG + Intronic
911468984 1:98292662-98292684 TGTTTTCCTTAAATATTTGATGG - Intergenic
911780142 1:101866755-101866777 TCCTTTATTCAAATATTTGCAGG + Intronic
911811491 1:102287819-102287841 GGCTTTCTTTGAATATTTTAAGG - Intergenic
911938574 1:104012358-104012380 TGGATTTTTAAAATATTTGTGGG + Intergenic
911986737 1:104636148-104636170 TTTCTTCTTTAAATATTTGATGG + Intergenic
912010923 1:104961299-104961321 TGCTCTATTAAAATAAATGAAGG + Intergenic
913153271 1:116066873-116066895 AGCTTTCCTAGAATATTTTAGGG + Intronic
913175818 1:116272305-116272327 TACTCTGTTAAAATATTTTAGGG + Intergenic
913419454 1:118648931-118648953 AGCTGTTTTTAAATATTTGAAGG - Intergenic
914328849 1:146647539-146647561 TGATTTCTTACAATATGTAATGG - Intergenic
915155541 1:153872673-153872695 TGCTTTCTTGAAAATTTTCAAGG - Intronic
915889871 1:159763059-159763081 TGTTTTCTCAAAACATTTGGGGG + Intergenic
915971202 1:160356471-160356493 TTCTTTCTTCTCATATTTGATGG + Intronic
916304242 1:163311210-163311232 TGCTCTCTTTAATTATATGAAGG - Intronic
916381156 1:164213152-164213174 TGGTTTCTTTCAATATTTTATGG - Intergenic
916446368 1:164876025-164876047 TTTTTTATTAAAATATTTTATGG + Intronic
917303349 1:173602213-173602235 GGCTGTCCAAAAATATTTGATGG + Intronic
917721118 1:177787487-177787509 TACTTCCTTAAGATATTTAATGG - Intergenic
917761265 1:178161100-178161122 TTTTTTTTTAAAGTATTTGAGGG - Intronic
917830882 1:178884435-178884457 TATATTCTAAAAATATTTGATGG + Intronic
917949909 1:180020854-180020876 TTCTTTCTGAAACTCTTTGATGG - Exonic
918091782 1:181302221-181302243 TGTTTTCTCCAAATATTTGTTGG + Intergenic
918225787 1:182481502-182481524 TTAATTATTAAAATATTTGATGG - Intronic
918318555 1:183343720-183343742 CACTTTTTTAAAAAATTTGAAGG - Intronic
918545097 1:185673248-185673270 AGCTTTCTTGAAATATATGATGG - Intergenic
918752331 1:188289081-188289103 TGCATTCTTACAAAATCTGATGG - Intergenic
918770198 1:188547301-188547323 TTCTTTCTTTAAATTTTTGTGGG + Intergenic
918863732 1:189867056-189867078 TTCTTGTTTAAAATATTTTAGGG - Intergenic
919139126 1:193548196-193548218 TGCTTTTTTAAAATAGTTCATGG - Intergenic
919596901 1:199575533-199575555 TACTTGCTTAAATTAATTGAAGG - Intergenic
920938924 1:210462478-210462500 TACTATCATAAAATACTTGAAGG - Intronic
921009876 1:211131105-211131127 GGCTTTCCTCAAATATTTAAGGG - Intronic
921570434 1:216771676-216771698 TGCTTCCTCAAAATATTTCTAGG - Intronic
921943227 1:220864723-220864745 AGGTTTCTTACAATATTTGCAGG - Intergenic
922151592 1:223010152-223010174 TGCTTTCCTAAAAAAATTAAGGG + Intergenic
922365261 1:224857373-224857395 AGCTTTCTTAAAATATTTGAAGG + Intergenic
923249132 1:232163160-232163182 TGAGTTCTCAAAATATCTGATGG - Intergenic
923301317 1:232643183-232643205 TGATTTCTTAAACTGTTGGAAGG + Intergenic
923348079 1:233076945-233076967 TGATTTATTAAATTATTTGAGGG + Intronic
923871902 1:238004205-238004227 TGCTTGCTTTAAATAATGGAGGG + Intergenic
924866119 1:247982943-247982965 TACTGCCTAAAAATATTTGAAGG + Intronic
924925969 1:248681132-248681154 TACCTTCATAAAATATTTCAAGG - Intergenic
1063261917 10:4398979-4399001 TGCTTTCTGGAAATACTTCACGG + Intergenic
1063550326 10:7026429-7026451 TGCTTTCTTAGCAAATTTCAGGG - Intergenic
1063886313 10:10583101-10583123 AGCTGTCTTCAAATATTCGAAGG + Intergenic
1063993069 10:11587287-11587309 TAATTTCTTAAAATATTTTAGGG - Intronic
1063995595 10:11615553-11615575 TTCTTTCTACAAATATTTGCAGG - Intergenic
1064633529 10:17341384-17341406 AGCTCTCTTCAAATATTTTAAGG + Intronic
1064949767 10:20835308-20835330 AGCTTTCTTGATATATTGGAAGG + Intronic
1065153224 10:22843568-22843590 TGCTATTTTAAAATATTTATTGG - Intergenic
1065156631 10:22876463-22876485 TGCTTTGTTAATACATTTCAAGG + Intergenic
1065316101 10:24465464-24465486 TGCATTTTTAAAACATTTTAAGG - Intronic
1065636239 10:27737905-27737927 TACTTTTTTAAAAAATTAGAAGG - Intronic
1066104274 10:32143350-32143372 GGCTTTCAAAAAATACTTGATGG + Intergenic
1066228083 10:33404075-33404097 TGCTGTTTCTAAATATTTGAAGG + Intergenic
1066568620 10:36748017-36748039 TGCTTTCTTATGAAATTTGAAGG - Intergenic
1066701630 10:38135788-38135810 TGATTTCTCACAAGATTTGATGG - Intergenic
1068366673 10:56059572-56059594 TGCATTCTTACAAGATCTGATGG + Intergenic
1068544468 10:58330302-58330324 TTTTTTCTTAAATTATATGATGG - Intergenic
1068931981 10:62600238-62600260 TGCCTTCTAAGAATATTTTATGG + Intronic
1070482686 10:76899836-76899858 TGCTTTCAGATAATATTTAATGG + Intronic
1071041270 10:81310850-81310872 TTTTGTCTTAAAATATTTGGTGG - Intergenic
1071150173 10:82624868-82624890 TCCTTTCTTAAAATTAATGAGGG - Intronic
1071174322 10:82906479-82906501 TGCTGTTTTAAAATATTTTTTGG - Intronic
1071902066 10:90131380-90131402 TGATTTCTCAACATATCTGATGG + Intergenic
1072401046 10:95100410-95100432 TGCTCTCTTAAAATAATATAGGG - Intergenic
1072924682 10:99606616-99606638 AGCTGTCTTAATATTTTTGAAGG + Intergenic
1073375415 10:103030022-103030044 TGCTTACATTGAATATTTGAGGG + Intronic
1073443851 10:103569452-103569474 TGGTTTCATAAAATATGTGCTGG - Intronic
1074359259 10:112812219-112812241 TTCTTTCTTAAATTATTTACTGG + Intronic
1075431787 10:122390193-122390215 GGCTTTCTTCAGTTATTTGAAGG - Intronic
1077451490 11:2650642-2650664 TGCTTTGTCAAAAAGTTTGAAGG - Intronic
1077954745 11:7004234-7004256 TTATTTCTTAAATTATTTGGGGG - Intronic
1078344891 11:10539032-10539054 TGCTTTCAAAAAGCATTTGAAGG + Intronic
1078693423 11:13604765-13604787 TTTTTTTTTAAAATATTTGTGGG + Intergenic
1078822325 11:14894486-14894508 TCCTTTCTGAAAATAAATGATGG - Intergenic
1078895101 11:15591006-15591028 TGAATTTTTAAAATATTTGGTGG - Intergenic
1078905122 11:15678252-15678274 TTTTTTCTTTAAATATTTGCTGG - Intergenic
1079582953 11:22088758-22088780 TGGTTTCTTAAAAGACTTCAGGG + Intergenic
1079620294 11:22545945-22545967 TTCTTTCTTTATATATTTTATGG + Intergenic
1079620958 11:22553394-22553416 TGCTTTTTTAAAAAAATTGAAGG + Intergenic
1079676366 11:23231888-23231910 AGCCATCTTAAAATATTTTAGGG - Intergenic
1079743618 11:24096843-24096865 TGCTTTCATGAAACATTTGGAGG + Intergenic
1079835798 11:25330731-25330753 TTCTTATTTAAAATATTTTAGGG - Intergenic
1079908138 11:26275133-26275155 TGCTTTATTCACATATTTGTGGG + Intergenic
1080333286 11:31167353-31167375 TGCTTTATTAAAATTCTTAAGGG - Intronic
1080334387 11:31179698-31179720 TTAGTTCTTTAAATATTTGATGG - Intronic
1080990369 11:37527559-37527581 TTCTTTTTTTAAACATTTGATGG + Intergenic
1080995794 11:37599368-37599390 GGATTTCCTAAAATATTTCAAGG - Intergenic
1081200115 11:40205059-40205081 AGCTTTCTTCAGATATTTAAAGG - Intronic
1081721437 11:45291968-45291990 TGCTTTATTAAGAAATTAGAGGG - Intergenic
1082188643 11:49215174-49215196 TGTTTACTTTAAATATTTTAAGG - Intergenic
1082303059 11:50534363-50534385 TGCTTTGGTAAAATCTGTGAAGG - Intergenic
1082303628 11:50543393-50543415 TGTTTTCTTAGAATCTGTGAAGG - Intergenic
1082580395 11:54859631-54859653 TGTTTTCTTAGAATCTGTGAGGG + Intergenic
1082591227 11:55013090-55013112 TATTTTCTTAGAATCTTTGAAGG - Intergenic
1082979336 11:59105522-59105544 TGATTTTTTAAAATATGTCAGGG + Intergenic
1084347456 11:68564289-68564311 TGCTTTGTTTCAAGATTTGAAGG + Exonic
1085491407 11:76921853-76921875 TGCTATCTTCAAATATCTGAAGG - Intronic
1086179884 11:83937877-83937899 TGCTTTCTTGAAATGTTTTAAGG - Intronic
1086373261 11:86175507-86175529 TGCTTTCTATAAATGTTGGATGG + Intergenic
1086677881 11:89631511-89631533 TGTTTACTTTAAATATTTTAAGG + Intergenic
1087011910 11:93522523-93522545 TGCCTGCATAAAAGATTTGAAGG - Intronic
1087133323 11:94689039-94689061 TTATTTCTTTAAATATTTGGTGG - Intergenic
1087163165 11:94971109-94971131 TCATTTCTTAAAATGTTTTAGGG + Intronic
1087508067 11:99053840-99053862 TACTTTCTTAAAATATTCCTTGG - Intronic
1087636451 11:100707028-100707050 TGCTTACTTAGCATATTTCAAGG + Intronic
1087800701 11:102500516-102500538 TGCTTTTGAAAAATATTTTATGG + Intergenic
1087888628 11:103510437-103510459 TAAATGCTTAAAATATTTGAAGG + Intergenic
1088094937 11:106087895-106087917 TGCTGTCTTCAAATAGTTTAAGG + Intronic
1088331824 11:108662557-108662579 GGATTTCCTAAAATATTTGTTGG + Intergenic
1088640039 11:111863603-111863625 TGCTTTAGTAATATATTTAAAGG - Intronic
1089725666 11:120477145-120477167 TGCTTTCTGAGTATATTTAAAGG + Intronic
1089818568 11:121200090-121200112 TGATTTCATAGAATTTTTGATGG + Intergenic
1089920507 11:122205323-122205345 TGCTGTCTTTGAATATTTAAAGG + Intergenic
1090085525 11:123646998-123647020 ATCTGTCTTCAAATATTTGAAGG + Intronic
1090248188 11:125232158-125232180 TAGTTTCTTCAAATATTTGGAGG + Intronic
1090468480 11:126956777-126956799 TGGTTTCTTATTATATTTAATGG - Intronic
1090560711 11:127929211-127929233 TTATTTCTAAAAATATTTTATGG + Intergenic
1090931946 11:131305589-131305611 TGGTTTGAAAAAATATTTGATGG + Intergenic
1091211029 11:133861030-133861052 TTATTGCTTCAAATATTTGATGG + Intergenic
1091363061 11:134993515-134993537 TGTTTTCTTAAAATAAGTAATGG - Intergenic
1091698999 12:2647693-2647715 TGCTTTGTTTAAATATATGTGGG + Intronic
1092073778 12:5656118-5656140 TGCTTTCTTAAGAAGTTAGAGGG + Intronic
1092361262 12:7838515-7838537 TGCTTTCATAATATAATTGTGGG - Intronic
1092730579 12:11529954-11529976 AGGTTTATAAAAATATTTGAAGG - Intergenic
1092798520 12:12139177-12139199 AACTTTCTATAAATATTTGAAGG - Intronic
1093310750 12:17580174-17580196 TGTTGTCTTCAAATATTTAAAGG + Intergenic
1093416247 12:18924242-18924264 TGCTTTCTTAAAAAAAAGGAGGG - Intergenic
1093727106 12:22526875-22526897 TGCTTTCTTAATATTTTAGTAGG - Intronic
1093733640 12:22594130-22594152 AGCTATCTTCAGATATTTGAAGG - Intergenic
1093850626 12:24032936-24032958 TTCTTTCTTTTAATATTAGAAGG + Intergenic
1093860567 12:24161330-24161352 AGCTATCTTCAAATATCTGATGG - Intergenic
1094265561 12:28555350-28555372 GGCTTACTTAAATTATTTCATGG - Intronic
1094857874 12:34424004-34424026 TGCTTTCTTAGAATGTGAGAAGG - Intergenic
1094867461 12:34554115-34554137 TGTTTTTGTAAAATATGTGAAGG - Intergenic
1094875470 12:34637401-34637423 TGTTTTTTTAAAATCTGTGAAGG + Intergenic
1095140393 12:38655703-38655725 TGATTTCTTAAAATTTTTCTTGG - Intronic
1095327877 12:40919848-40919870 TTTGTTCTCAAAATATTTGATGG + Intronic
1095397238 12:41774991-41775013 AGCTGTCTCCAAATATTTGAAGG - Intergenic
1095576434 12:43745433-43745455 TGAGTTCTCACAATATTTGATGG + Intronic
1096619169 12:52851652-52851674 TGCTGTCTTAGAAAGTTTGAAGG - Intergenic
1096988915 12:55782583-55782605 TTCTTTTTTAAAATTTTTTAGGG + Intronic
1097392523 12:59033094-59033116 TGCTGTCTTAAAATGTTTGAAGG - Intergenic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1098293628 12:68982145-68982167 AGCTTTCTCAAGTTATTTGAAGG + Intergenic
1098951913 12:76648473-76648495 AGCTGTTTTCAAATATTTGAAGG - Intergenic
1099176842 12:79431886-79431908 AGTTTTCTTACAATATTAGAAGG - Intronic
1099535625 12:83840646-83840668 TGCTTTCACAAAATATTGTAAGG + Intergenic
1099629610 12:85125373-85125395 AGCTTTCTAAAATTATTTAATGG - Intronic
1100783198 12:98051063-98051085 TCATTTTTAAAAATATTTGATGG - Intergenic
1100952997 12:99873533-99873555 GGCTATCTTTAAATATTTGAAGG - Intronic
1101160542 12:101969939-101969961 TTAGTTCTTAAAATGTTTGATGG - Intronic
1101311936 12:103588784-103588806 TGCTTTCAAAAAAAATGTGAAGG + Intronic
1101427748 12:104601649-104601671 TGTTTTCTTAAAACACTTGCTGG + Intronic
1101483723 12:105129712-105129734 GGGTTTCTTTAAATATTTGAGGG + Intronic
1101524030 12:105511305-105511327 TCCTTTATTTTAATATTTGAAGG - Intergenic
1102718903 12:114999449-114999471 TGGTTTTTTTAAATATTTCAAGG - Intergenic
1104593766 12:130105434-130105456 TGCTTTTATAAAATACATGAAGG + Intergenic
1105049413 12:133035412-133035434 TGGTTTCTTTAACTATTTGGGGG - Intergenic
1105364172 13:19749342-19749364 TGCTTTTTTAAAATTTGAGATGG - Intronic
1106270001 13:28143729-28143751 TTCCTTCTTCAAATTTTTGAGGG + Intronic
1106278170 13:28235305-28235327 TACTTCCTTTAAATAATTGAAGG + Intronic
1107650821 13:42542748-42542770 TGATTTCTTAAAAAATCAGATGG + Intergenic
1107839795 13:44444974-44444996 TTCTTTCTTTAAATATTTAGTGG - Intronic
1108190169 13:47930257-47930279 TATTTTTTTCAAATATTTGAAGG + Intergenic
1108226278 13:48293083-48293105 TGCATTCTTTAAATCTTTGATGG + Intergenic
1108829151 13:54454907-54454929 TGCATTCTTATAATAATTCACGG + Intergenic
1109037075 13:57277528-57277550 TGCTGGCTTAAAATAGTAGAAGG - Intergenic
1109093962 13:58087159-58087181 TGATTTTTTATGATATTTGATGG - Intergenic
1109224545 13:59676428-59676450 ATCTGTCTTCAAATATTTGAAGG - Intronic
1109849117 13:68037348-68037370 TGTTTTCTTCAAATACTTGTGGG + Intergenic
1109899308 13:68743676-68743698 TGCTTTCTTAAAATATATTTTGG - Intergenic
1110080671 13:71306596-71306618 TTCTTGATTAAAAGATTTGATGG + Intergenic
1110424586 13:75352588-75352610 TTCTTTCTTAAAATAGTTGTTGG - Intronic
1111095219 13:83504788-83504810 TGCTTTCTTAACATCTTTTAAGG + Intergenic
1111655872 13:91152178-91152200 TGCATTCTAAAAATATTTCTTGG - Intergenic
1111661469 13:91217589-91217611 TGATCTCTTAAAATGTTTGCTGG - Intergenic
1112204722 13:97313435-97313457 ATCTTTTTTAAAAAATTTGATGG - Intronic
1112486087 13:99821106-99821128 AGCTTTCTAATATTATTTGAGGG + Intronic
1112815687 13:103269802-103269824 GACTATCTTATAATATTTGAAGG - Intergenic
1112933921 13:104775844-104775866 TCATTTCTTCAAATATTTGTTGG - Intergenic
1113820098 13:113207878-113207900 TGGATTTTTAAAATATTTGAAGG - Intronic
1114007188 14:18327164-18327186 TGCTTTCTTGTGAAATTTGAAGG - Intergenic
1114357912 14:21934025-21934047 TGCTGTCTTAAAATATTTCAAGG + Intergenic
1114794064 14:25692519-25692541 CCCTTACTTAAAATCTTTGAAGG - Intergenic
1114949414 14:27730047-27730069 TGGTTTATTAAAATATTCAATGG - Intergenic
1115112681 14:29842598-29842620 TGCTTTGTTTAGATATTTAAAGG + Intronic
1115388466 14:32825539-32825561 GACTTTCTTAAAAAATTTGATGG - Intronic
1115406063 14:33018228-33018250 TGCTGTCTTAAAACATTTGAAGG + Intronic
1115768020 14:36643842-36643864 AGCTGTCCTCAAATATTTGAAGG - Intergenic
1116055953 14:39864069-39864091 TGCTATCTTCAAATATTTGAAGG + Intergenic
1116495788 14:45558563-45558585 TTATTTCATAAAATATTTTAAGG - Intergenic
1116512963 14:45769384-45769406 TCCTTTCTTAGACTATTTGTGGG + Intergenic
1116571559 14:46523664-46523686 TGCCTTTTTAAATTATTTGAAGG - Intergenic
1116651787 14:47603198-47603220 TCCTTTATTTAAATCTTTGAAGG - Intronic
1117196664 14:53346545-53346567 TGTTTTCTTAAAATATTGAGTGG + Intergenic
1117429765 14:55645104-55645126 TGCATTCTATTAATATTTGAAGG + Intronic
1117705151 14:58458246-58458268 AGTTTTCATCAAATATTTGAAGG - Intronic
1117931445 14:60845955-60845977 TTTTTTCTTGAAATATTTGATGG + Intronic
1118118714 14:62811253-62811275 TGTTTTCTTAAAATATCTGATGG + Intronic
1118390088 14:65288371-65288393 TGCCTACTTGAAATATTTGGGGG + Intergenic
1118589389 14:67390180-67390202 TGCTTTTTAAAAAACTTTGATGG - Intronic
1119314410 14:73680101-73680123 TCCTTTTTCAAAATATTTGTGGG + Intronic
1120034006 14:79674938-79674960 TCCTTGCATAAAATATTTTAGGG + Intronic
1120199854 14:81525111-81525133 TTCTTTCCTAGAATATTTTAAGG - Intronic
1121655200 14:95590027-95590049 TGCTTTCTTAAACTCTTTCTGGG + Intergenic
1121821971 14:96977489-96977511 TGCTTTCTTAAACTCTTAGGTGG + Intergenic
1123781187 15:23630751-23630773 TGATTTGTTAAAATATGTTAGGG + Intergenic
1124149574 15:27165488-27165510 AGCAATCTTCAAATATTTGAAGG - Intronic
1124461779 15:29898476-29898498 TGCTTTCAAAAAAAATCTGAGGG - Intronic
1124589775 15:31042723-31042745 TGCTTTCTTAAAACACTGGAGGG - Intronic
1124615984 15:31242512-31242534 GGCACTCTTAAAATCTTTGATGG + Intergenic
1124827104 15:33108279-33108301 TGCTTTGGTAAAAGTTTTGATGG + Intronic
1124834725 15:33185323-33185345 TGGTTCCTTAAAATAATTCAAGG + Intronic
1125098161 15:35878502-35878524 TTCTTTTTTAAAAAATTTTATGG + Intergenic
1125208647 15:37184330-37184352 TTTTATATTAAAATATTTGATGG - Intergenic
1125901993 15:43357152-43357174 TTCTTTCTCAGAATGTTTGAAGG + Intergenic
1126336744 15:47593572-47593594 TCCCTTCTTTAAAAATTTGAGGG + Intronic
1126539757 15:49808874-49808896 TACTGTTTTAAAATATTTTATGG - Intergenic
1126674773 15:51151145-51151167 TGCTTTTTTAATATGTTTGTTGG - Intergenic
1126857216 15:52850336-52850358 TGCTTTCTTTTAGTACTTGAGGG + Intergenic
1126895275 15:53250746-53250768 TGATTCCTTAAGATAATTGAAGG + Intergenic
1126925581 15:53582364-53582386 TGCTTTCTTAAGCTATATCATGG + Intronic
1127820646 15:62652561-62652583 TATTTTCTTCAAATATTTGAAGG - Intronic
1127976194 15:63998916-63998938 TGCCTTCTTCCAATATTTGGTGG - Intronic
1129611510 15:77062833-77062855 TGCTTTAAGAAAATATTTCAGGG - Intronic
1130055752 15:80523962-80523984 TTCTGTCTTCAAGTATTTGAGGG + Intronic
1130201493 15:81832565-81832587 TTCATCCTTAAAATATTTTAGGG + Intergenic
1130391291 15:83457813-83457835 TGATTTTTTAAAATATCTTAAGG + Intronic
1131186233 15:90276512-90276534 TGCTTCCTTAAATAGTTTGAAGG - Exonic
1132306189 15:100814799-100814821 AGCTTTGTTTAAAAATTTGAGGG - Intergenic
1133078493 16:3298378-3298400 TACTGTCTTAACATATTTTATGG - Intronic
1133715537 16:8443873-8443895 TATTTTGTAAAAATATTTGATGG + Intergenic
1133967308 16:10540722-10540744 AGCTTTCTGAAAATACTAGATGG - Intronic
1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG + Intergenic
1135011613 16:18885353-18885375 TATTTTCTTCAAATATTTTAAGG + Intronic
1135034591 16:19066557-19066579 TTCCATCTTAAAATATTTTATGG + Intergenic
1135318515 16:21472936-21472958 TATTTTCTTCAAATATTTTAAGG + Intergenic
1135371408 16:21904731-21904753 TATTTTCTTCAAATATTTTAAGG + Intergenic
1135440379 16:22465984-22466006 TATTTTCTTCAAATATTTTAAGG - Intergenic
1135531901 16:23262039-23262061 TGGTCTTTTAAAATATTTGAGGG - Intergenic
1136328771 16:29554679-29554701 TATTTTCTTCAAATATTTTAAGG + Intergenic
1136443402 16:30294378-30294400 TATTTTCTTCAAATATTTTAAGG + Intergenic
1138022519 16:53497443-53497465 AGTTGTCTTAATATATTTGAAGG - Intronic
1139180080 16:64736742-64736764 TGTTTGTTTAAAATATTTGTTGG + Intergenic
1139196932 16:64930406-64930428 TTCTATCTTTAATTATTTGAGGG - Intergenic
1139787929 16:69409053-69409075 TGCTTTTATAAAATTTTTAAAGG - Intergenic
1139890126 16:70246801-70246823 TATTTTCTTCAAATATTTTAAGG + Exonic
1140004719 16:71063404-71063426 TGATTTCTTACAATATGTAATGG + Intronic
1140253127 16:73312253-73312275 AGCTATCTTTAAATATTTGGAGG + Intergenic
1140520570 16:75577489-75577511 TTATTTCTTAATATATTGGAAGG + Exonic
1142531832 17:584466-584488 TGCTTTATAAAAATATTTGGAGG + Intronic
1143506791 17:7370574-7370596 TGCTTTCATTAATTATTTTATGG + Intergenic
1144304382 17:13954665-13954687 ACCTGTCTAAAAATATTTGAAGG + Intergenic
1145213055 17:21029411-21029433 TTCTTTTTTAAAAAATCTGATGG - Intronic
1146018892 17:29258122-29258144 TGCTTATTTAATATATTTGTTGG - Exonic
1146213899 17:30963274-30963296 TGCCTTTTTAAAATATTGGGTGG + Intergenic
1146246822 17:31292816-31292838 TGCTGTCTTAGAATTTTTAAGGG - Intronic
1146256452 17:31393669-31393691 TGCTATTTTCAAATATTTAAAGG - Intronic
1146471607 17:33129407-33129429 TGCTATCTGCAAATATTTGAAGG + Intronic
1146597270 17:34180732-34180754 TGCCATCTGAAAATCTTTGATGG - Intergenic
1147263463 17:39222126-39222148 TGGTGTCTTCAAATATTTGAAGG - Intronic
1148855909 17:50579246-50579268 AGCTGTCTTCAAATATTTGAAGG + Intronic
1148917569 17:50995279-50995301 TGTTTTCTTAAAATAACTAATGG + Intronic
1149133104 17:53331615-53331637 TACTTTTTTAAAATAATGGAAGG - Intergenic
1149717969 17:58812496-58812518 TACTTTCTTACATTGTTTGAGGG + Intronic
1149862309 17:60128866-60128888 TGCTATTTCAAAATATTTAAAGG - Intergenic
1149981829 17:61317065-61317087 TGTTTTCTTAAAAAAGTTTAGGG + Intronic
1150141148 17:62729872-62729894 GGTTTTTTAAAAATATTTGAGGG - Intronic
1150673017 17:67218456-67218478 TGATTGCTGAATATATTTGATGG - Intronic
1150904436 17:69322677-69322699 TACTAGCTGAAAATATTTGAAGG - Intronic
1151017640 17:70575872-70575894 TGGTTTTTTCAAATATTTTATGG + Intergenic
1153218096 18:2838488-2838510 GGCAATCTTAGAATATTTGAGGG + Intergenic
1153312581 18:3691600-3691622 TTCTTTTTTAAAATGTTTGGTGG - Intronic
1153578724 18:6549959-6549981 TTTTTTCATAAAATATTTCAGGG - Intronic
1153650531 18:7236004-7236026 TGTTTTCTTGAAATATAGGAAGG - Intergenic
1153688922 18:7571672-7571694 TAATTTTTTAAAATATTTTAAGG + Intronic
1153989621 18:10384915-10384937 TGCTTACTTCAAAGTTTTGATGG + Intergenic
1154488779 18:14902821-14902843 TGTTTTCTTAAAATAAGTAATGG + Intergenic
1155484931 18:26331171-26331193 TGCTTACTTATAACACTTGAGGG - Intronic
1155530641 18:26762972-26762994 TTCTTTCAAAAAATATTTAATGG - Intergenic
1155627238 18:27848611-27848633 TTTCTTCTTATAATATTTGAAGG - Intergenic
1156563974 18:38163025-38163047 TGCATCCTTAAAGTCTTTGATGG + Intergenic
1156762336 18:40608238-40608260 TATTTCTTTAAAATATTTGATGG - Intergenic
1158197316 18:54903139-54903161 TGTTGTCTATAAATATTTGAAGG - Exonic
1158227062 18:55212247-55212269 TGCTTTGGTTAAAAATTTGAAGG + Intergenic
1158326430 18:56318462-56318484 AGCAGTCTTAAAATATCTGAGGG - Intergenic
1158327886 18:56329855-56329877 TGCCTTTTTAAAGTTTTTGATGG - Intergenic
1158827276 18:61237174-61237196 TGTTTGCTTAAAATACGTGAAGG - Intergenic
1159210943 18:65320814-65320836 TTCTTTCTTTAAATGTTTAAAGG + Intergenic
1159324856 18:66901711-66901733 TGCATTTTAAAAATATTTGAAGG + Intergenic
1159436948 18:68430479-68430501 TACTTTTTTAAAATAATTGAAGG + Intergenic
1159696807 18:71569085-71569107 TGCAGTGTTAAAATATTTTATGG + Intergenic
1160482639 18:79256680-79256702 AGCTGACTTAAAATATTTTAAGG - Intronic
1164334208 19:24294682-24294704 TGCTTTTGTAGAATATATGAAGG + Intergenic
1164338330 19:24357045-24357067 TGTTTTTTTAGAATATGTGAAGG + Intergenic
1164338443 19:24358920-24358942 TGTTTTGGTAAAATCTTTGAAGG + Intergenic
1164368533 19:27617456-27617478 TGTTTTTGTAGAATATTTGAAGG + Intergenic
1165705237 19:37971285-37971307 TGCCCTTTTAAAACATTTGATGG + Intronic
1166273226 19:41731756-41731778 TGCTTTCTTAAAATTTCAGTTGG - Intronic
925766770 2:7243954-7243976 TACTTTATTAAAATTATTGAGGG - Intergenic
926024203 2:9525991-9526013 TATTTCCCTAAAATATTTGAGGG - Intronic
926409892 2:12591934-12591956 TGAGTTCTCAAAATATCTGATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927265571 2:21145439-21145461 TGGGTTCTTAAAGAATTTGATGG - Intergenic
928354222 2:30594865-30594887 TACTTGAGTAAAATATTTGAGGG - Intronic
928377962 2:30791811-30791833 TCTTTTCATAAAATATTTCATGG - Intronic
928506025 2:31953859-31953881 TAATTTTTCAAAATATTTGAAGG - Intronic
928678996 2:33680025-33680047 AGCTTTGATAAAATATTTCATGG - Intergenic
929161691 2:38838541-38838563 AGCTTTCAATAAATATTTGAAGG - Intronic
929260561 2:39862590-39862612 TGCTATCATAAAATAATGGAAGG - Intergenic
929261259 2:39869059-39869081 CCCTTGCTTAAAATATTTTAGGG + Intergenic
929355078 2:41014108-41014130 ACCTTGCTTGAAATATTTGAAGG + Intergenic
929745059 2:44648465-44648487 GGCATTCTTCAAACATTTGAAGG + Intronic
929816468 2:45236823-45236845 TGTTTTCTTAAAAAAAATGACGG + Intergenic
930299877 2:49602069-49602091 TGCTTTCTCATAATTTTGGAAGG - Intergenic
930388841 2:50734543-50734565 TGCCTTTTTATGATATTTGATGG - Intronic
930480265 2:51939974-51939996 TCCTATCTTAGAATATTTGATGG - Intergenic
930527703 2:52550447-52550469 TGATTTCTTTTCATATTTGAAGG - Intergenic
930670935 2:54149897-54149919 AGCTTCCTTCAAGTATTTGAAGG + Intronic
931011107 2:57915429-57915451 TGATTTCTTTAAATATGTGATGG - Intronic
931068800 2:58620882-58620904 CCCTGTCTTCAAATATTTGAAGG + Intergenic
931106370 2:59061059-59061081 TTCTGTCTTGGAATATTTGAGGG - Intergenic
931124549 2:59260008-59260030 TTATTTTTTAAAATATTTAATGG + Intergenic
931163465 2:59719466-59719488 TCCTTTCTTAAAATACATGGTGG + Intergenic
931204990 2:60138287-60138309 TGCATACCAAAAATATTTGAAGG - Intergenic
931303073 2:61000224-61000246 TGCTTTCCTTAAATATTTGAGGG - Intronic
931682744 2:64766076-64766098 TGCTTTTTAAAAATTTTTTATGG - Intergenic
932231772 2:70089192-70089214 TGCTGTCTTAAACTCTTTGTTGG + Exonic
932560963 2:72868459-72868481 TGTTTTCTTAAAATATTTTTAGG - Intergenic
932638800 2:73420119-73420141 TGCTATGGTCAAATATTTGAAGG + Intronic
932884289 2:75534066-75534088 TGCTTTTTTAAATTATTGGGAGG - Intronic
933038123 2:77426629-77426651 TGGTTTCTCACAATATCTGATGG + Intronic
933088857 2:78093686-78093708 TGCATTTTTAAAACATGTGAGGG - Intergenic
933104616 2:78308429-78308451 TGATTTTTAAAAATATTTCAAGG - Intergenic
933241735 2:79929336-79929358 AGAGTTCTTTAAATATTTGAAGG - Intronic
933297917 2:80511501-80511523 TGCTTTCTTAACACATTGGTGGG + Intronic
933393696 2:81705174-81705196 TGCTTTTTGAATATATTTGTTGG + Intergenic
933537239 2:83591303-83591325 TGCTTTTTTAAAGTTTCTGAAGG - Intergenic
933936993 2:87214339-87214361 TGCTTTCTTAAAATAAGAGAGGG - Intergenic
934246048 2:90307099-90307121 TGATTTTTTAAATTATTTGTAGG + Intergenic
934262698 2:91489934-91489956 TGATTTTTTAAATTATTTGTAGG - Intergenic
934970192 2:98756977-98756999 TGCTTTTTTAAAGAATGTGATGG - Intergenic
935162624 2:100542428-100542450 TACTTTGTTTAAAAATTTGAGGG + Intergenic
935726199 2:106026174-106026196 AGCTGCCTTCAAATATTTGACGG + Intergenic
935793936 2:106621964-106621986 TTCTTTCAAAAAATATTTGGTGG + Intergenic
936356149 2:111751485-111751507 TGCTTTCTTAAAATAAGAGAGGG + Intergenic
936411953 2:112267602-112267624 TGCTTTTTCAAAATCTTAGAGGG - Intergenic
936583374 2:113727099-113727121 TGAGTTCTTACAAGATTTGATGG + Intronic
936754661 2:115692960-115692982 GGATTTCTTTGAATATTTGAGGG - Intronic
938283155 2:130081997-130082019 TGCTCTCTTAACGTAATTGAGGG - Intronic
938529379 2:132168308-132168330 TGCTTTCTTGTGAAATTTGAAGG + Intronic
938871360 2:135480305-135480327 TTCTTTGTTAAATTATTTCAAGG - Intronic
939286902 2:140143475-140143497 TTCTATCTTAAGATATTTGCGGG + Intergenic
939327697 2:140715223-140715245 TGCTTACTTAAAATCTTTCAAGG - Intronic
939696578 2:145332977-145332999 TGGTTTGTTAAAAGATTTAAGGG - Intergenic
939720605 2:145645701-145645723 ATTTTTATTAAAATATTTGATGG - Intergenic
939723742 2:145688021-145688043 AAGTTGCTTAAAATATTTGAGGG + Intergenic
940483829 2:154272748-154272770 TTCTTTATTAGAATATTTCAGGG - Intronic
940915465 2:159250401-159250423 TGATTTCATAAAGAATTTGAGGG - Intronic
941383676 2:164826820-164826842 GGCTTACTTAAAATGTTTTATGG + Intronic
941807838 2:169726834-169726856 TGCCTTTTTAAAATTTTTGTGGG - Intronic
942041724 2:172071917-172071939 TTTTTTCTTAAAGTATTTGAAGG - Intronic
942373611 2:175312389-175312411 TGCTGCCTTCAAGTATTTGAAGG + Intergenic
943402530 2:187432508-187432530 AGCTTTCTGAATATTTTTGAGGG - Intronic
943485804 2:188478999-188479021 AGCTGTCTTTCAATATTTGAAGG + Intronic
943596454 2:189863169-189863191 TGCCTACTTTAAATAATTGAGGG + Intronic
943743828 2:191440214-191440236 TCCTTTCTATGAATATTTGATGG - Intergenic
943914610 2:193614093-193614115 TGCTTTATTAAAATTTTATAAGG - Intergenic
943963327 2:194296742-194296764 TTATTTCTTAAAAGATGTGATGG + Intergenic
944009832 2:194960980-194961002 TGCTTACACAAAATATTTGGAGG + Intergenic
944351431 2:198731744-198731766 TCCTGTCATTAAATATTTGATGG - Intergenic
945387793 2:209224121-209224143 TGATTTCTCAAGATATCTGATGG + Intergenic
945461044 2:210109149-210109171 TGTTTTTCTAAGATATTTGAAGG - Intronic
945596428 2:211800579-211800601 TCCTTTTTGAAAATATTTTATGG + Intronic
945647227 2:212512788-212512810 TTTTTTCTTAAAATAATTGATGG - Intronic
946508112 2:220323299-220323321 TGCCTTCTTCAAATGTATGAAGG - Intergenic
946720387 2:222599748-222599770 TGTTTTCTTAAAATGCTGGAGGG + Intronic
947328223 2:229000582-229000604 TGATTTCTCACAATATTTGATGG + Intronic
1169937204 20:10896394-10896416 TTCTTGCCTAAAATATTTAAAGG + Intergenic
1170393307 20:15899656-15899678 TGCTTTCTGTAAAAATATGATGG - Intronic
1170673020 20:18452535-18452557 TGCAGTCTTAAAGTATTTCATGG + Intronic
1170816925 20:19721479-19721501 TCCTTTTTTAAGTTATTTGATGG + Exonic
1171156360 20:22878271-22878293 TACTTTCATATAATATTTCAAGG + Intergenic
1171409944 20:24939606-24939628 TGCATCCTTCAAATCTTTGATGG + Intergenic
1171534964 20:25879215-25879237 TGCTTTCACAAAAGATTTCACGG - Intergenic
1172497548 20:35399265-35399287 TGTTTTCTTAAAATATTGTTTGG + Intronic
1172793141 20:37519915-37519937 TGCCATCTTAAAATATTTCGAGG - Intronic
1174208005 20:48855241-48855263 TGCTTTCTTAGAAGGGTTGACGG - Intergenic
1174860408 20:54086127-54086149 TGCTGTCATAAAATATATGGTGG + Intergenic
1175634888 20:60572994-60573016 TTATTTCTTAACATATTTTAAGG + Intergenic
1176700475 21:10042852-10042874 TGCATACTTATAATAATTGAAGG + Intergenic
1176767131 21:13031609-13031631 TGCTTTCTTGTGAAATTTGAAGG - Intergenic
1176989973 21:15483805-15483827 GGTTTTCAAAAAATATTTGATGG - Intergenic
1177095317 21:16824905-16824927 TGCATTCTTTAAGTTTTTGAGGG - Intergenic
1177265803 21:18781816-18781838 TGCTTTATGAAAATATATTAGGG - Intergenic
1177467174 21:21500643-21500665 TGTTTTCTTTATATATTTGTGGG - Intronic
1177616281 21:23525231-23525253 TGTTTTCATTAAATATTTTATGG - Intergenic
1177677907 21:24325955-24325977 TGCCTTGTTAATATTTTTGAAGG + Intergenic
1178942879 21:36922371-36922393 TTCTTTCTTAAAATGTTTTTAGG - Intronic
1178991029 21:37356889-37356911 AGCTTGCTTCAAATGTTTGAAGG + Intergenic
1179098883 21:38338980-38339002 TGCCTTCTTCAAATTTTTGCTGG - Intergenic
1179114776 21:38480245-38480267 TGCTGTCTGAAGATATTAGATGG - Intronic
1179364667 21:40746551-40746573 TGTTTTCCTTACATATTTGAGGG - Intronic
1180431695 22:15257971-15257993 TGCTTTCTTGTGAAATTTGAAGG - Intergenic
1181319529 22:21993960-21993982 TGCTTTGGAAACATATTTGATGG - Intergenic
1182133936 22:27883173-27883195 AGCATTCTTAATTTATTTGAAGG - Intronic
1182504892 22:30774553-30774575 AGTTTTGTAAAAATATTTGATGG + Intronic
1184935973 22:47720883-47720905 TGCGTTGTTAAAATGTCTGATGG + Intergenic
1185090260 22:48763614-48763636 GGTTTGCTTAAAACATTTGATGG + Intronic
949243345 3:1896172-1896194 TGCATCCTTAAAATACTTGCCGG - Intergenic
949337553 3:2992374-2992396 TGCTTTCTGTGAGTATTTGAGGG - Intronic
949467272 3:4356699-4356721 TGCTTTTTAAAAATATTAGTTGG + Intronic
949748484 3:7323980-7324002 TGCTTTCTTTAAATCTTTACGGG + Intronic
950349930 3:12339832-12339854 GGCTTTGTTAGAGTATTTGAGGG - Intronic
950737385 3:15021017-15021039 TTTTTTCTTAAAGTATTTTAAGG - Intronic
950816082 3:15703817-15703839 TAATTTTTTAAAATATTTTATGG - Intronic
950882658 3:16335810-16335832 TGCCCTCTTGAGATATTTGATGG - Intronic
951350423 3:21600620-21600642 TGATATCATAAGATATTTGAAGG + Intronic
951401616 3:22239551-22239573 TGATTTATTAAAATAGTTGCTGG + Intronic
951547872 3:23846915-23846937 TGCTATCTTGAAATATTCTAAGG + Intronic
951941663 3:28086302-28086324 TGCTTTCAACAAATATCTGAAGG - Intergenic
952246355 3:31597052-31597074 TACTTGCTGCAAATATTTGAGGG - Intronic
952839054 3:37628875-37628897 TGGTTTCTAAGAATATTTGGAGG + Intronic
953713821 3:45298423-45298445 GGCTTCCTTCAAATGTTTGAAGG + Intergenic
954765908 3:52916283-52916305 TGCTTTCTTCTTAGATTTGAAGG - Intronic
955106262 3:55901522-55901544 TGCTGGCTTTAAAGATTTGAGGG - Intronic
955784381 3:62521476-62521498 GTCTTTCTGAAAATATTTGGGGG + Intronic
956121823 3:65974257-65974279 TGCTTTCAACAAATGTTTGAGGG - Intronic
956373402 3:68588371-68588393 TTCTTTCTAAAAATATTTATTGG + Intergenic
957412934 3:79863303-79863325 TGAGTTCTCATAATATTTGATGG + Intergenic
957575994 3:82009111-82009133 TGCGTTCTTAAAATAAATGGGGG + Intergenic
957775081 3:84748228-84748250 TGATTTCTTACAATCTTTTATGG + Intergenic
957945940 3:87062975-87062997 TGAGTTCTGAAAATATGTGAAGG + Intergenic
958028633 3:88079404-88079426 AGCTGCCTTATAATATTTGATGG + Intronic
958080922 3:88745095-88745117 TGGGTTCATCAAATATTTGAGGG + Intergenic
958698457 3:97556526-97556548 TGAGTTCTTAAAAGATCTGATGG - Intronic
959228159 3:103613220-103613242 TGGTTTCTGAAAATATTAGATGG - Intergenic
959468339 3:106718211-106718233 TGCTTTTTTTAATTAATTGAAGG - Intergenic
959779388 3:110210331-110210353 TGCTGTCTTACAATATTATATGG - Intergenic
960652188 3:119963066-119963088 TGCTTTCTTAAACTTTTTTTTGG - Intronic
960892332 3:122462679-122462701 CGCTTATTAAAAATATTTGAAGG - Intronic
961112579 3:124297620-124297642 GGCTATCTTCAAATATTTAAAGG + Intronic
961417842 3:126774305-126774327 GGCTTTCTTAAAACATTTTTTGG + Intronic
962151389 3:132897211-132897233 TGGTTTCAAAGAATATTTGATGG - Intergenic
962356288 3:134697147-134697169 AGCTATCTTCAAATGTTTGAAGG + Intronic
962636764 3:137339378-137339400 TGAGTTCTTACAATATCTGATGG + Intergenic
963416978 3:145009230-145009252 TGCTTTCTCAAAATACTTTTAGG + Intergenic
964265673 3:154892503-154892525 GGGATTCCTAAAATATTTGAAGG - Intergenic
964721937 3:159775824-159775846 TGCTTTCTGAAAAATTTTAAAGG + Intronic
964745756 3:160010992-160011014 TGATTTCTTATTCTATTTGAAGG - Intergenic
965455369 3:168893307-168893329 TGTTTCTTTAAAATATTTTAAGG - Intergenic
965477553 3:169176157-169176179 AACTTTCTTAAAACATATGAGGG - Intronic
965911195 3:173778629-173778651 TGCTTTCATAAAAATTATGAAGG - Intronic
966103111 3:176299820-176299842 GGCTGTCTTCAAATATTTGAAGG + Intergenic
966611959 3:181876353-181876375 TATTTTCTTAAAATATTGCAGGG - Intergenic
966887471 3:184384724-184384746 TGGTTTCCTAGAACATTTGAGGG + Intronic
967447851 3:189587751-189587773 TGCTGTCTTTAAATATTTTAAGG + Intergenic
967574022 3:191068864-191068886 TGGTTTCTTAATCTATTTGAAGG - Intergenic
967652206 3:192000147-192000169 CACTTTGTTAAAATATTTGTAGG - Intergenic
967906865 3:194508602-194508624 TGGTTTGATAAAATATATGAAGG + Intergenic
968397398 4:254944-254966 TTATTTCTTAAAATTTTTGTAGG + Intergenic
970897603 4:21121410-21121432 TTCTTTGTTTAATTATTTGATGG + Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971683915 4:29739664-29739686 TCCTTTATTAAGATATCTGAAGG + Intergenic
971773812 4:30933542-30933564 TTCTTTCTTAAAATATATAAAGG + Intronic
971999596 4:34013973-34013995 TGCTTATTGAGAATATTTGAAGG + Intergenic
972067961 4:34975403-34975425 GGTTTTCTTAAAATAATTTAGGG - Intergenic
972464092 4:39336163-39336185 TGCTTTCTTATAATCTTTTTTGG - Intronic
972994875 4:44868091-44868113 TGCTTTCCTAAATTATTTTGGGG - Intergenic
973179858 4:47253863-47253885 TGCTTTAGTAAAATAGTTAATGG + Intronic
973616300 4:52681700-52681722 TGCTTTCTTAAAAAAGTCCAAGG + Intergenic
973722167 4:53735644-53735666 TGAGTTCTCAAAATATCTGATGG + Intronic
974007795 4:56576341-56576363 AGCTGTGTTAAAATATTTAAAGG + Intronic
974239384 4:59225869-59225891 TGCTTTCTAAAAATAATCGTTGG + Intergenic
974512460 4:62861979-62862001 TTCTTTCTTAAAATTATTAAAGG - Intergenic
974809947 4:66933329-66933351 TGTTTTCTTAAAATTTTGTATGG - Intergenic
974853902 4:67436491-67436513 TTTTTTCATAAAATATTTTATGG - Intergenic
975008048 4:69314848-69314870 TGTTTTTTAAAAAAATTTGAAGG - Intronic
975357430 4:73424467-73424489 TGTTTTCATATAATATTGGAGGG + Intergenic
975363260 4:73497143-73497165 AGTTTTCTTCAAATATTTGATGG - Intronic
975441419 4:74414887-74414909 TGCTGTCTATAAATATTTCAAGG - Intergenic
975811694 4:78176514-78176536 GGCTGTCTTCACATATTTGAAGG - Intronic
975867041 4:78734682-78734704 TGCTTTCTTTATAAATTTGCAGG - Intergenic
976137223 4:81951639-81951661 TCCTTTCTTGAAATTTTTCAAGG - Intronic
976965713 4:91037754-91037776 TATTTTTTAAAAATATTTGATGG + Intronic
977120720 4:93097307-93097329 TTTTGTCTTCAAATATTTGATGG - Intronic
977175344 4:93813599-93813621 TTCTATATTTAAATATTTGACGG - Intergenic
977196632 4:94070115-94070137 CTATTCCTTAAAATATTTGAAGG - Intergenic
977351993 4:95900002-95900024 TGCTTTCTTTTATGATTTGATGG - Intergenic
978492642 4:109325181-109325203 TATTTTCTTTAAATATTTGTTGG - Intergenic
978606505 4:110486101-110486123 TGCCTACTAATAATATTTGAAGG - Intronic
979125291 4:116964284-116964306 TTCCTTCTAAAAATATTTAATGG - Intergenic
979185441 4:117785462-117785484 TGAGTTCTTATAATAATTGAGGG - Intergenic
979396296 4:120193227-120193249 TGTTTTGTTCAATTATTTGAAGG + Intergenic
979425920 4:120566123-120566145 GGCTTTCTTCAAATAATTGATGG + Intergenic
980082210 4:128356315-128356337 TGATTGCTTATAATATTTTAAGG - Intergenic
980193698 4:129560080-129560102 TGCTTTCTTAACAATTTTTAAGG + Intergenic
980417303 4:132508537-132508559 TGTTTTCTTAGAATATATCATGG - Intergenic
980417902 4:132517008-132517030 TTATTGCCTAAAATATTTGAAGG - Intergenic
980796117 4:137685929-137685951 TCCTTGCTTAAAATATTTCCAGG + Intergenic
980846246 4:138328893-138328915 TGCTATTTTCAAATCTTTGAAGG + Intergenic
981032791 4:140142692-140142714 TGCTTTCTTAAAATATTTGAAGG - Intronic
981235657 4:142412362-142412384 TGCTGTCTTAAAATTCTTGAGGG - Intronic
981503286 4:145475017-145475039 TTCTTTCAGCAAATATTTGAGGG + Intergenic
981926415 4:150145180-150145202 TGATTTCTGAAAATCTTTCAAGG + Intronic
982153791 4:152494943-152494965 TGCTCTCTTAAACTAATTGTAGG + Intronic
982938755 4:161521159-161521181 TGTTCTCCTAAAACATTTGATGG + Intronic
983254386 4:165380767-165380789 TTTTTTCTTATATTATTTGAAGG - Intronic
983300004 4:165912985-165913007 TGATTTTTTCAAATATTTGCTGG - Intronic
983300303 4:165916641-165916663 AACTTTCTTAAAATATTATATGG + Intronic
983344330 4:166507220-166507242 TGAGTTCTTAAAAGATCTGATGG - Intergenic
984268987 4:177527848-177527870 TGCTTGCCTAAAATTTTTGATGG + Intergenic
984611622 4:181846094-181846116 TGGTTTTTTAATATATTTCAAGG + Intergenic
984779431 4:183511003-183511025 TGCTTTCAGAAAATGTTTTAGGG + Exonic
985879052 5:2624292-2624314 AGCTACCTTAAATTATTTGATGG - Intergenic
987549339 5:19358334-19358356 TACTTTCTTAAATTATCTGTGGG + Intergenic
987552216 5:19397846-19397868 TGTTATCTTAAGGTATTTGAAGG - Intergenic
987664105 5:20914033-20914055 TGAGTTCTTATAAGATTTGATGG - Intergenic
987695986 5:21332769-21332791 TGTGTTTTTAAAATATTTTATGG + Intergenic
987741893 5:21919880-21919902 TTCTTTTCTTAAATATTTGAAGG - Intronic
987954455 5:24720040-24720062 TCCCTTCTTAAAATATGTGTAGG + Intergenic
988574246 5:32404618-32404640 TGCTTATTTAAAATACATGAGGG + Intronic
988577161 5:32438147-32438169 TGCTTACTTAATAGATTTGGTGG + Intronic
988756215 5:34253841-34253863 TGTGTTTTTAAAATATTTTATGG - Intergenic
988758586 5:34288163-34288185 TGAGTTCTTATAAGATTTGATGG + Intergenic
989177329 5:38540972-38540994 TGCTTTCTTAACATTCTTTAGGG + Intronic
989405319 5:41054523-41054545 TGCTTATTTAAAATAATTGCAGG - Intronic
989442131 5:41485468-41485490 TTCTTTCTTCAAATACATGAAGG - Intronic
989445810 5:41527019-41527041 TGCTAACATAAAATTTTTGAGGG - Intergenic
989787570 5:45349559-45349581 TGCATTCTTTAATTTTTTGAAGG - Intronic
989851022 5:46210549-46210571 TGTTTTGGTAAAATATGTGAAGG + Intergenic
989987771 5:50722090-50722112 TGTTTTATTATAATATTTGAAGG + Intronic
990090334 5:52038447-52038469 TGATTTGGTGAAATATTTGATGG - Intronic
990131159 5:52586322-52586344 TTCCTTCTTTAAATATTTGATGG - Intergenic
990315601 5:54580414-54580436 TGCTTTCTTTTAAAATTTTATGG + Intergenic
990399789 5:55426826-55426848 TGCCTTGTTAAACAATTTGAGGG - Intronic
990480481 5:56205761-56205783 TGTTTTCTTAAACTATTTTCAGG - Intronic
990837424 5:60037843-60037865 AGTTGTCTTAAAATATTTTAGGG - Intronic
991059843 5:62362394-62362416 TGCTTTTTAAAAATATTTGTTGG + Intronic
991233724 5:64368394-64368416 TGATTTCTTCAAAAATTTGTGGG - Intronic
991744411 5:69719323-69719345 TGTGTTTTTAAAATATTTTATGG - Intergenic
991753294 5:69835910-69835932 TGTGTTTTTAAAATATTTTATGG + Intergenic
991795983 5:70299047-70299069 TGTGTTTTTAAAATATTTTATGG - Intergenic
991802911 5:70392637-70392659 TGTGTTTTTAAAATATTTTATGG + Intergenic
991823792 5:70594637-70594659 TGTGTTTTTAAAATATTTTATGG - Intergenic
991832614 5:70711029-70711051 TGTGTTTTTAAAATATTTTATGG + Intergenic
991888360 5:71298607-71298629 TGTGTTTTTAAAATATTTTATGG - Intergenic
991911330 5:71564391-71564413 TTCTTTATTAAAATTTTTCATGG + Intronic
992248908 5:74857609-74857631 TTGTTTCTTCAAATATTTTAAGG - Intronic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
992384287 5:76268679-76268701 TGTTTTCAGAAAGTATTTGATGG + Intronic
993026006 5:82647409-82647431 AGCTTTCTTAAAATAAATGAAGG + Intergenic
993558300 5:89369548-89369570 TTACTTCTTTAAATATTTGATGG - Intergenic
993569837 5:89523786-89523808 TGTTTATTTACAATATTTGAAGG - Intergenic
994216583 5:97144366-97144388 TGTTTTCTTAAGATCTTTAAAGG - Intronic
994512439 5:100721982-100722004 TGCTTTCTATAAATAGTTGAAGG - Intergenic
994540683 5:101092189-101092211 TGTTCTCTTAAAATTTTTGCAGG + Intergenic
994863488 5:105231183-105231205 TTCTTTCTTTTAATATTTGTTGG - Intergenic
994906796 5:105850515-105850537 TGCTTTCCTCAAATAATTTATGG - Intergenic
994949749 5:106446114-106446136 TGCTATTTTGAGATATTTGAGGG - Intergenic
994966501 5:106679434-106679456 TGTTTTTTTTAAATATTTGATGG - Intergenic
995378800 5:111509571-111509593 TGCTGTCAGAAAATATTGGAGGG - Intronic
995380239 5:111523521-111523543 TGCTCTTTTGAAATATTTGAAGG + Intergenic
995425071 5:112011975-112011997 CTCTTTCTGAAAATATTTGAAGG + Intergenic
995498097 5:112770400-112770422 TTCTTTTTAAAAATATTTAAAGG + Intronic
995524816 5:113042071-113042093 TGCTTTCTTTAAATATTCAGCGG - Intronic
995575730 5:113531158-113531180 TTCTCTTTTAAAATATTTGTTGG + Intronic
995713922 5:115063019-115063041 TGCTTTCATAAAATATTAGTGGG + Intergenic
995765585 5:115613379-115613401 TATTTTATTAAAATATCTGAGGG - Intronic
996098824 5:119427117-119427139 TGCTTTATTCACATATTTGAGGG - Intergenic
996192113 5:120557730-120557752 TGCTTTTTCAAAGTATTTAATGG - Intronic
996504984 5:124258562-124258584 TGCTTTCTAAACATATTTTCGGG + Intergenic
996570064 5:124924038-124924060 TACTTTCTTATACTACTTGATGG - Intergenic
996640681 5:125748779-125748801 TGTTGTCCTAAAATTTTTGAAGG - Intergenic
996969978 5:129354167-129354189 TGTTTTTTTAAAAAATTTGTAGG - Intergenic
998613453 5:143714155-143714177 TTTTTCCTTAAAATGTTTGAAGG + Intergenic
999830055 5:155310157-155310179 TGCCTTCTTTAAATATTTGAAGG + Intergenic
1000584945 5:163086060-163086082 TGTTTTGTTTATATATTTGAGGG + Intergenic
1000656946 5:163890682-163890704 TTTTTTCTGAAAATATGTGAAGG + Intergenic
1001829020 5:174769703-174769725 GGTTTTATAAAAATATTTGAGGG + Intergenic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1003506412 6:6743945-6743967 TACTTTGGTGAAATATTTGAAGG + Intergenic
1005270966 6:24163310-24163332 TGCTATCCTCAAATATTTAAAGG - Intergenic
1005554801 6:26965289-26965311 TGTGTTTTTAAAATATTTTATGG - Intergenic
1005602322 6:27440487-27440509 TGCTTTTTTAAATTAATTGAGGG + Intergenic
1005656169 6:27939936-27939958 ACCTTTCTTAAAATTTTTGAGGG - Intergenic
1005964788 6:30719767-30719789 TCCCTTCTTGAAGTATTTGAGGG + Intergenic
1006710633 6:36066435-36066457 TGCTTACCTAAAATAACTGAAGG + Intronic
1007651693 6:43426597-43426619 TGCTTCCTTAAAAGATTTATTGG + Intergenic
1008143779 6:47864362-47864384 TGCTTTGCTAAAATCCTTGATGG + Intergenic
1008300186 6:49827964-49827986 GATTTTCTTAAAATATTTGTTGG + Intergenic
1008728293 6:54448691-54448713 TGCATACTTAAAATGGTTGAGGG - Intergenic
1008832377 6:55781192-55781214 TACTTTCTTAAAATAAATGAGGG - Intronic
1009041366 6:58182854-58182876 TGCATTCTGAAAATATTAAATGG + Intergenic
1009052128 6:58288950-58288972 AGCTTTCTTGATATATTTCAAGG + Intergenic
1009217221 6:60937169-60937191 TGCATTCTGAAAATATTAAATGG + Intergenic
1009251221 6:61302014-61302036 TGCTTTTGTAGAATCTTTGAAGG - Intergenic
1009259523 6:61466789-61466811 TGTTTTCATAGAATCTTTGAAGG + Intergenic
1009262317 6:61508757-61508779 TGTTTTTGTACAATATTTGAAGG - Intergenic
1009309181 6:62127706-62127728 TACTGTCTTCAATTATTTGAAGG + Intronic
1009415837 6:63415524-63415546 TGAGTTCTTATAAGATTTGATGG - Intergenic
1009632921 6:66222313-66222335 AGCTTTACTACAATATTTGAAGG + Intergenic
1009840447 6:69066238-69066260 TCATTTCTAAAAAAATTTGAAGG - Intronic
1010023534 6:71189399-71189421 TTCATTCTTAGAATATTTGCTGG - Intergenic
1010208851 6:73347254-73347276 TTCTTTCTGAATATTTTTGATGG + Intergenic
1010223359 6:73467009-73467031 TTTTTTCTTAAAATATTAAAAGG + Intronic
1010361387 6:74998834-74998856 TGTTTTGTCATAATATTTGAAGG - Intergenic
1010383853 6:75255921-75255943 TGACTTCTAAAAATATATGACGG - Exonic
1010416130 6:75614000-75614022 TGTTTTCTTAAAATATGTCAAGG - Intronic
1010438232 6:75860682-75860704 TGTCTTCTTAAAATTTTTAAAGG - Intronic
1010474535 6:76270223-76270245 TCTCTTTTTAAAATATTTGATGG + Intergenic
1010650892 6:78454752-78454774 TGAGTTCTTACAATATATGATGG - Intergenic
1011078993 6:83468516-83468538 ATCCTTGTTAAAATATTTGAAGG - Intergenic
1011759278 6:90543058-90543080 TGCTTCCCTTAAATGTTTGAGGG - Intronic
1011759612 6:90547659-90547681 TGATTTTTAAAAATATTTCAAGG - Intronic
1011956538 6:93030940-93030962 TGAGTTCTCACAATATTTGATGG - Intergenic
1012005816 6:93711830-93711852 GGTTTTCTTAAAATAATTTATGG + Intergenic
1012255213 6:97023236-97023258 AGGTTTTTTAAAACATTTGAAGG + Intronic
1012944840 6:105454366-105454388 AGCTATCTTAAAATATTTAAAGG - Intergenic
1012995639 6:105970505-105970527 TGCGTACTTAAAATAATTGAAGG - Intergenic
1013017540 6:106174540-106174562 TATTTTCTTAAAATATTTTGTGG - Intergenic
1013645686 6:112138085-112138107 AGCTCTATTAAAACATTTGAGGG + Intronic
1013898894 6:115128105-115128127 TTTTTTCCCAAAATATTTGAAGG - Intergenic
1014787676 6:125637094-125637116 TGCATTCTTAATATCTTTAAAGG + Intergenic
1015082198 6:129240453-129240475 TGTTTTCTTGGAACATTTGAAGG - Intronic
1015268274 6:131311476-131311498 TGACTTCTTTAAATATTTGTTGG - Intergenic
1015383544 6:132596638-132596660 TGATTTCTTAAAATTTTTTAGGG + Intergenic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1016094955 6:140024267-140024289 TACTCTCTTTAAGTATTTGATGG + Intergenic
1016328649 6:142932625-142932647 TGCTATCTTTAAATAATTGTAGG + Intronic
1016397336 6:143638757-143638779 ACTATTCTTAAAATATTTGAAGG - Intronic
1016583236 6:145653272-145653294 TGATTTCTCACAATATCTGATGG + Intronic
1016753795 6:147661246-147661268 TTCTTTCATAAAAAATCTGAAGG - Intronic
1017195879 6:151699585-151699607 TGCCTTCTCAATATTTTTGAGGG - Intronic
1017373551 6:153740604-153740626 TGGTCTTTTAAAATATTGGAGGG - Intergenic
1017420977 6:154272647-154272669 TTCTTTATTAATATATGTGAAGG - Intronic
1018752610 6:166820637-166820659 AGCTTTCTTATAATATTGAAAGG + Intronic
1018871044 6:167782485-167782507 TGCTTTCATATAATATGTGAGGG - Intergenic
1018895624 6:168014529-168014551 TGCTTTCTCAGCAGATTTGATGG - Intronic
1020544868 7:9514578-9514600 TGCATTTTTAAATTATTTTAGGG - Intergenic
1021315866 7:19145977-19145999 TGCTTACTTAAGCTAATTGAAGG - Intergenic
1021509017 7:21415246-21415268 GTCTATCTTGAAATATTTGAGGG - Intergenic
1021728804 7:23576484-23576506 TGCTTTATGGAAATGTTTGATGG - Intergenic
1022057889 7:26758691-26758713 TGATTTCTTAAAAAAATTAAAGG + Intronic
1022160950 7:27710692-27710714 TACTTTCTTAAAATATTTGCAGG - Intergenic
1022194016 7:28045956-28045978 GGCTTTCTTAAATTGTTTAATGG - Intronic
1022382654 7:29874839-29874861 TGCTTCATTAATATATTTGCAGG - Intronic
1023469617 7:40500617-40500639 TGAAGTCTTGAAATATTTGATGG + Intronic
1024519370 7:50290472-50290494 TGAGTTCTTACAATATCTGATGG + Intergenic
1024972625 7:55084760-55084782 AGCTGTCTTCAAATATTTAAAGG + Intronic
1025624344 7:63206489-63206511 TGCCCACTAAAAATATTTGAAGG - Intergenic
1027649540 7:80848671-80848693 TGTTTTCTAAAAATACTTGCTGG - Intronic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1028263815 7:88697929-88697951 TTATTTTTTAAAACATTTGATGG - Intergenic
1028600967 7:92600009-92600031 TGTATTCTTTAAATATTTTATGG + Intergenic
1028705698 7:93842956-93842978 TGATTTTTTAATATTTTTGAAGG - Intronic
1028776274 7:94680782-94680804 TGCTTGGTTAAAATCTTTAAGGG - Intergenic
1028994676 7:97086606-97086628 TGGTTTGTTAAAGTTTTTGAGGG + Intergenic
1029140914 7:98409467-98409489 TACTTTATTTAAATGTTTGATGG + Intergenic
1030316708 7:108123073-108123095 CGCTGTCCTAAAATATTTAATGG - Intronic
1030460650 7:109830948-109830970 TACTTTCGTAAAATACTTAAAGG - Intergenic
1030495753 7:110297818-110297840 TGCTTTCCAAAAATATTTGAAGG + Intergenic
1030726328 7:112929968-112929990 TGCTTTTTTAGAGAATTTGATGG - Intronic
1030747244 7:113181820-113181842 TGCTTTCTTATGAAATTTCAAGG - Intergenic
1030968310 7:116021858-116021880 TGCTCTGTTTATATATTTGAAGG + Intronic
1031436817 7:121742461-121742483 TGCTGTATTCCAATATTTGATGG + Intergenic
1031532940 7:122898675-122898697 TGCTTTCTTAACATTCTCGATGG - Intergenic
1031620662 7:123930464-123930486 TGCTTTCTTAGGATATTTTTGGG - Intronic
1031746944 7:125511001-125511023 AGCTTTATTAGAATTTTTGAGGG + Intergenic
1032280525 7:130496918-130496940 TGCTATGTGAAAATACTTGAAGG - Intronic
1033963655 7:146946366-146946388 TGTTTTATTAAAATATATCATGG - Intronic
1033990740 7:147282976-147282998 TGTCTTCATAAAATTTTTGAAGG - Intronic
1034768703 7:153750807-153750829 TCCTTCTTTAAAATCTTTGATGG + Intergenic
1034779172 7:153861465-153861487 TCCTTTCTTATCACATTTGATGG - Intergenic
1035589201 8:800282-800304 TGTTTTCTTTAAAGATTAGAGGG + Intergenic
1035930984 8:3779493-3779515 TGATTTCATCAAATATGTGATGG + Intronic
1035965031 8:4181517-4181539 AACTTTCTTAAAATATTGTAAGG - Intronic
1036446535 8:8826099-8826121 TGTTTTTTTAAAAAATTTGCAGG + Intronic
1036675904 8:10833100-10833122 TGCTTTGTGAAAGTATTTAATGG - Intronic
1036909394 8:12741757-12741779 TACTTCCTTAAAAAATTTCATGG - Intronic
1037131898 8:15416653-15416675 TTTTTTCTTTAAATATTTTATGG - Intergenic
1037960621 8:23095237-23095259 TAATTTCTTTAAATATTTCATGG - Intronic
1038707235 8:29905945-29905967 TACTTTCTTCAAATATTTGAAGG + Intergenic
1038805530 8:30787638-30787660 TCCTTTCTTTAAACATTTGGTGG + Intronic
1038845739 8:31228213-31228235 TGCATTTCTCAAATATTTGATGG + Intergenic
1038998447 8:32952460-32952482 TGCTTTCCTTAAGTCTTTGAGGG + Intergenic
1039191066 8:34975242-34975264 TGCTTTTTTAAAATATTCATTGG + Intergenic
1039602464 8:38851879-38851901 TTCTTTATTAAAGTATTTGAAGG - Exonic
1039605742 8:38878845-38878867 TAATTTTTTAAAATATTTGTAGG - Intergenic
1039858377 8:41435696-41435718 TGCATTCTTAAATTGTTTTAAGG - Intergenic
1039922396 8:41902751-41902773 AGCTCTCCTCAAATATTTGAAGG - Intergenic
1040320136 8:46289198-46289220 TCCTTTCGTAAAATTTGTGAAGG - Intergenic
1040346540 8:46505402-46505424 TGCTTTTTTAGAATCTGTGAAGG - Intergenic
1041491922 8:58442615-58442637 TGCTTTCTTCTATTATGTGAGGG - Intronic
1042172520 8:66005894-66005916 TGCTTTTTTAATATATTGTATGG - Intergenic
1042211466 8:66385493-66385515 TGCTCTGCTCAAATATTTGAAGG + Intergenic
1042742048 8:72060601-72060623 TCCTTCCTTTAAATTTTTGAAGG + Intronic
1042749792 8:72145941-72145963 TGATTTATTTAAATATTTCAGGG - Intergenic
1043110338 8:76171553-76171575 TGATTTCTTCAAATGTTAGAAGG - Intergenic
1043316553 8:78929443-78929465 TGCTCTTTTAAAATACTTTATGG + Intergenic
1043534276 8:81184485-81184507 TACTTTCTAAAAATAGTTAAAGG + Intergenic
1043561361 8:81497849-81497871 TGCATTCTTAAAATCTTTGGTGG - Intergenic
1043619714 8:82174662-82174684 GGCTTTCTTAAAATTTTGCAGGG - Intergenic
1044024596 8:87152996-87153018 TCCTTTCTCAACAAATTTGAAGG - Intronic
1044176056 8:89124054-89124076 TCCTTTCTTAACATCATTGATGG + Intergenic
1044396868 8:91722873-91722895 TTAATTGTTAAAATATTTGATGG - Intergenic
1044601952 8:94014168-94014190 TGCATTTGTAAAATATTTGTAGG - Intergenic
1044855971 8:96476274-96476296 TGCTCTCTTACAATAATTCAAGG + Intergenic
1045422036 8:102026022-102026044 TGAGTTCTTACAATATCTGATGG - Intronic
1045803589 8:106130009-106130031 TGTTTTCTAAAAAATTTTGAAGG - Intergenic
1046137231 8:110044091-110044113 TGCTTACTTACTATTTTTGATGG + Intergenic
1046153913 8:110262900-110262922 TTTTGTCTTTAAATATTTGAAGG + Intergenic
1046185175 8:110704587-110704609 AGCACTCTTCAAATATTTGAAGG + Intergenic
1046306270 8:112371258-112371280 TGCATTCTAACAATATTTTAAGG - Intronic
1046402864 8:113729858-113729880 TGATTTGCTAAAATATATGAAGG + Intergenic
1046452596 8:114413541-114413563 CCCTTTCCTAAAATATTTTAGGG - Intergenic
1046933097 8:119860545-119860567 TGCATTCTTTAAATCTTTAAGGG - Intergenic
1047173767 8:122520824-122520846 TGCTTTCTTAGAAATTTGGATGG + Intergenic
1047789239 8:128185709-128185731 TACTATTTTAAAATATTAGAGGG - Intergenic
1048081153 8:131128705-131128727 TACTTTCTTGAAATATTTCAGGG + Intergenic
1048089504 8:131223715-131223737 TGCTTTTTTATACTATTGGAGGG - Intergenic
1048809825 8:138275872-138275894 TGCATTCTATAAATATTTGCCGG - Intronic
1051494175 9:17700266-17700288 TGTTCTCTTACCATATTTGAAGG + Intronic
1051821095 9:21169794-21169816 TTATTTCTTAAAATAGTTAAGGG - Intergenic
1052133882 9:24886897-24886919 TACTTTTTTGGAATATTTGAGGG - Intergenic
1052549163 9:29925830-29925852 GGCTGTCTTCAAATATGTGAAGG - Intergenic
1052600408 9:30620808-30620830 TGCTTTCTTTATATATTTGGGGG + Intergenic
1053637675 9:40029658-40029680 TGCATACTTATAATAATTGAAGG + Intergenic
1053707982 9:40774572-40774594 TGCTTTCTTGTGAAATTTGAAGG + Intergenic
1053768406 9:41435563-41435585 TGCATACTTATAATAATTGAAGG - Intergenic
1054318467 9:63626252-63626274 TGCTTACTTATAATAATTGAAGG + Intergenic
1054362933 9:64195680-64195702 TGTTTTCATAGAATCTTTGAAGG + Intergenic
1054417893 9:64895361-64895383 TGCTTTCTTGTGAAATTTGAAGG + Intergenic
1054547075 9:66347061-66347083 TGCATACTTATAATAATTGAAGG - Intergenic
1054848649 9:69823223-69823245 TGAGTTCTCAAAAGATTTGATGG - Intronic
1055421139 9:76144228-76144250 TGCTTTCTTAATATACTGTATGG + Intronic
1055605853 9:77969734-77969756 CTCTTTCTTTAAATATGTGAAGG + Intronic
1055687475 9:78792439-78792461 TGCTGTCTTAGCATATTTGAGGG + Intergenic
1055981625 9:82008705-82008727 TTCTTTCTTTAGATCTTTGATGG + Intergenic
1056280045 9:85032328-85032350 TTTTTTCTTAAAATTTTTGAAGG + Intergenic
1056649794 9:88448800-88448822 GGCTTTCTTAACATGTTTGCTGG + Intronic
1057201124 9:93140507-93140529 TGTTTTCCTAAAAAATTTGAGGG + Intergenic
1057429255 9:94979504-94979526 TGATTTCTTAATATATGTGTAGG + Intronic
1058220869 9:102300021-102300043 TGCATGCATAAAATATTTCATGG + Intergenic
1058295078 9:103295976-103295998 TTTTTTCTTAAAATATCTGTTGG - Intergenic
1058322065 9:103644986-103645008 TGCTTGATTTAAAAATTTGATGG - Intergenic
1058350668 9:104018118-104018140 TGATTCCTTAAAATAATTAAAGG - Intergenic
1058476714 9:105342183-105342205 TGCAGTCTGAAAATATTTAATGG + Intronic
1058889387 9:109347949-109347971 TGTTATCTTCAAACATTTGAAGG - Intergenic
1059265672 9:113027709-113027731 TGCTTTCTGAAAATATTACTTGG + Intergenic
1059538256 9:115104439-115104461 TGCCTTCTTAAAATTTTTCAGGG - Intronic
1060123101 9:121014422-121014444 AGCCATCTTCAAATATTTGAAGG - Intronic
1060350722 9:122857019-122857041 TGCTTTATTGAAATATTTATGGG + Intronic
1186327039 X:8490369-8490391 AGCTCTCTTCAAATATTTAAAGG - Intergenic
1186998371 X:15148836-15148858 TCCTTTCTCAAAATATTCCAAGG + Intergenic
1187648899 X:21377931-21377953 ATTTTTATTAAAATATTTGAGGG + Intronic
1187868061 X:23742111-23742133 ACCTTTGTTAAACTATTTGAAGG - Intronic
1187986790 X:24822231-24822253 TCCTTTGTTAAAATAGTTAAGGG - Intronic
1188380116 X:29481334-29481356 TGCTTTTTTAAAATGACTGAAGG - Intronic
1188949538 X:36353084-36353106 TATTTTTTTAAATTATTTGAAGG + Intronic
1189450236 X:41122397-41122419 TGATTTTTTAAAACATTTCAAGG - Intronic
1189622333 X:42855484-42855506 TGCCTTCTTAAAAAATTAAAGGG - Intergenic
1189716898 X:43876289-43876311 TTCTTCTTAAAAATATTTGAGGG - Intronic
1190480206 X:50869995-50870017 TGCTGTGTTCAAATATGTGAAGG + Intergenic
1191238898 X:58163037-58163059 TTTTTTCGTAAAATATATGAAGG + Intergenic
1193288365 X:79740338-79740360 TGCTTTCTTAAACAATTTTGTGG + Intergenic
1193608291 X:83595097-83595119 AGCTTTCCTCAAATACTTGAAGG - Intergenic
1193730792 X:85100410-85100432 TGCTTTCTTAATTTATTTTTTGG - Intronic
1193842241 X:86420449-86420471 GGCTTTGTTAAAATATTCCATGG + Intronic
1193864648 X:86716241-86716263 TCTGTTATTAAAATATTTGATGG + Intronic
1194532069 X:95062145-95062167 TGCATTTTTAAAATATTTTCAGG + Intergenic
1194866375 X:99073691-99073713 TGCTTTCTTTCAATATTTAGTGG + Intergenic
1194926421 X:99830514-99830536 TGCTTTCTCAGACTTTTTGATGG + Intergenic
1195019860 X:100816381-100816403 TACTTTCTGGGAATATTTGAGGG - Intergenic
1195493514 X:105502248-105502270 TAGTTTATTCAAATATTTGAAGG - Intronic
1195590485 X:106619137-106619159 TGTTTTTTTAAAAAATTTTATGG + Intronic
1195649285 X:107267939-107267961 TGCATTATTAAAACATTTGCTGG + Intergenic
1195715127 X:107811082-107811104 GGTTTTCTTCAAATATTTGAAGG - Intergenic
1195772143 X:108362780-108362802 AGCTGTGTTTAAATATTTGAAGG - Intronic
1196360309 X:114846990-114847012 TGTTTTCTTAAATTCTTTCATGG - Intronic
1196718919 X:118835705-118835727 TTTTTACTTAAAATATGTGATGG - Intergenic
1197043155 X:121964671-121964693 TTCTTTTTAAAAATATTTCAGGG - Intergenic
1197527956 X:127585406-127585428 TGTTTTCTGAAGATATTTAAGGG - Intergenic
1197800465 X:130342462-130342484 AGCTGTCTTTAAATATTTGAAGG + Intronic
1198037553 X:132816613-132816635 AGTTTTCTCAAAATATTTGCTGG + Intronic
1198151507 X:133915056-133915078 TGCTTTCAAAGAATATTTTATGG - Intronic
1198441363 X:136666570-136666592 TGCCTTTATAATATATTTGATGG - Exonic
1198832109 X:140761765-140761787 TGCCTCCTTAGAATATTTGTTGG + Intergenic
1199259643 X:145756679-145756701 ATCTCTCTTAAAATATTTTATGG + Intergenic
1200477280 Y:3653516-3653538 TGGTTACTTAAAATATTGGGAGG - Intergenic
1201434964 Y:13947698-13947720 AGCTCTCTTCAAATATTTAAAGG + Intergenic
1201940991 Y:19459893-19459915 TTCTTTATTCAAATATTAGAGGG - Intergenic
1202054093 Y:20811133-20811155 TAATTTCTTAAAATCATTGAGGG - Intergenic
1202587974 Y:26451860-26451882 TGATTTTTTAAATTATTTGTAGG + Intergenic